Previous Article | Next Article 
Journal of Bacteriology, October 1999, p. 6098-6102, Vol. 181, No. 19
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Mutational Analysis of the RecJ Exonuclease of
Escherichia coli: Identification of Phosphoesterase
Motifs
Vincent A.
Sutera Jr.,
Eugene S.
Han,
Luis A.
Rajman, and
Susan T.
Lovett*
Department of Biology and Rosenstiel Basic
Medical Sciences Research Center, Brandeis University, Waltham,
Massachusetts 02454-9110
Received 27 May 1999/Accepted 30 July 1999
 |
ABSTRACT |
The recJ gene, identified in Escherichia
coli, encodes a Mg+2-dependent 5'-to-3' exonuclease
with high specificity for single-strand DNA. Genetic and biochemical
experiments implicate RecJ exonuclease in homologous recombination,
base excision, and methyl-directed mismatch repair. Genes encoding
proteins with strong similarities to RecJ have been found in every
eubacterial genome sequenced to date, with the exception of
Mycoplasma and Mycobacterium tuberculosis. Multiple genes encoding proteins similar to RecJ are found in some
eubacteria, including Bacillus and
Helicobacter, and in the archaea. Among this divergent set
of sequences, seven conserved motifs emerge. We demonstrate here that
amino acids within six of these motifs are essential for both the
biochemical and genetic functions of E. coli RecJ. These
motifs may define interactions with Mg2+ ions or substrate
DNA. A large family of proteins more distantly related to RecJ is
present in archaea, eubacteria, and eukaryotes, including a
hypothetical protein in the MgPa adhesin operon of Mycoplasma, a domain of putative polyA polymerases in
Synechocystis and Aquifex, PRUNE of
Drosophila, and an exopolyphosphatase (PPX1) of
Saccharomyces cereviseae. Because these six RecJ motifs are shared between exonucleases and exopolyphosphatases, they may constitute an ancient phosphoesterase domain now found in all kingdoms
of life.
 |
INTRODUCTION |
The recJ gene of
Escherichia coli encodes a Mg2+-dependent
single-strand DNA (ssDNA) specific exonuclease with 5'-to-3' polarity (19). The recJ gene was first identified by its
effects on recBCD-independent recombination pathways;
mutants deficient in both the RecBCD and RecJ nucleases show extreme
recombination deficiency, sensitivity to UV irradiation, and partial
cell inviability (18). Subsequently, RecJ was shown to
affect the efficiency of RecBCD-mediated recombination as well
(22, 26, 30). In addition, RecJ is one of three exonucleases
that have been implicated in the excision reaction of the
methyl-directed mismatch repair pathway responsible for removing
polymerase errors (6). Removal of abasic deoxyribose phosphate residues in DNA, produced either spontaneously or by enzymatic removal of altered bases, may also be mediated by RecJ (7).
The ubiquity of RecJ-related proteins in eubacteria points to its
ancient origin and important cellular function. Predicted proteins
homologous to RecJ can be found in virtually all bacterial species for
which we have genomic sequences, including eight major eubacterial
divisions: Proteobacteria, Cyanobacteria,
gram-positive bacteria, spirochetes, Thermotogales,
radioresistant bacteria, Aquificales, and the chlamydiae.
Within this diverged set of RecJ amino acid sequences, seven conserved
motifs emerge. In this report, we present evidence that these conserved
amino acids are essential for RecJ exonuclease activity in vitro and
genetic activity in vivo. Based on similarity to motifs present in the
5' exonucleases of Taq polymerase I and T4 RNase H, for
which crystal structures have been determined (16, 24),
these motifs within RecJ are likely to be sites of interaction with
Mg2+ ions and phosphates of the substrate DNA.
Archaeal species also possess two or three proteins with reasonably
strong similarity to RecJ; among these, six of the RecJ motifs are
largely conserved. A larger group of other proteins in the database,
including those from eubacterial, archaeal, and eukaryotic species,
also possess these RecJ motifs but are otherwise distantly related to
RecJ (2). These include, among others, a domain in polyA
polymerase from Synechocystis and Aquifex, the 28-kDa protein of the MgPa adhesin operon in Mycoplasma
genitalium, an exopolyphosphatase from yeast, and the PRUNE
protein from Drosophila. These findings suggest that the
conserved RecJ motifs constitute an ancient structure characteristic of
the phosphoesterases now found in proteins from all three domains of life.
 |
MATERIALS AND METHODS |
Plasmid constructions.
Plasmid DNA was prepared by alkali
lysis (3). Transformation of plasmid DNA into the
appropriate strain backgrounds was performed by electroporation
(8). Selection for plasmids employed Luria broth
(23) containing 60 µg of kanamycin (Km) or 100 µg of
ampicillin (Ap) per ml. Tetracycline (Tc) was used in some experiments
at a concentration of 10 µg/ml to select for chromosomal Tn10 mutations.
Site-directed mutants were constructed by two methods. RecJ-D81A and
RecJ-D79A were constructed using the T7 In Vitro Mutagenesis Kit
(United States Biochemical, Amersham); the remainder of the site-directed mutants were obtained using modifications (as suggested by New England Biolabs) to the Kunkel method (17).
Single-strand plasmid template was obtained from the phagemid pSTL175
with the help of M13-K07 helper phage (28). pSTL175 contains
the wild-type sequence of recJ fused to an optimal ribosome
binding sequence derived from plasmid pRDK115 (20) in
PstI-EcoRI sites of the high-copy vector
pBluescript SK(
) (Stratagene). Primer sequences for site-directed
mutagenesis are as follows: recJD79A,
GGCGTCGAAATTACCGACCAC; recJD81A,
GTCGGCGTCGGCATCACCGAC; recJD83A,
GGTCGCGCCGGCGGCGTCGAA; recJD137A,
AATACCGTTAGCCACCACGAC; recJH161A,
TGGCAAATGGGCATCGGTAAC; recJH162A,
GCCTGGCAAAGCGTGATCGGT; recJD236A,
CGGCACGACGGCCGCCACTGT; recJR401A,
CTGAATGGAGGCACCGGAACC; and recJH429A,
CGCCATCGCAGCACCGCCAAA. Mutations were confirmed by DNA
sequence analysis using a Sequenase version 2.0 DNA sequencing kit
(Amersham) or a SequiTherm EXCEL DNA sequencing kit by Epicentre Technologies.
For biochemical and genetic analyses, the
recJ mutant
alleles were subcloned from the relevant high-copy pBluescript SK(

)
plasmids into the low-copy vectors pWSK29, pWKS30, and pWKS130
(
31) using restriction endonucleases
ApaI and
SacII. In the
pWSK29 derivatives, the
recJ genes
are controlled by the T7 RNA
polymerase promoter; in pWKS30 and pWKS130
derivatives, the genes
are expressed from the
lac promoter.
pWSK29 and pWKS30 encode
Ap resistance, and pWKS130 encodes Km
resistance.
Mutation D160A was produced by random mutagenesis in a
mutD
mutator strain (STL913, F
mutD5 lacZ trpA
metE). The
recJ+ gene was subcloned from
plasmid pSTL175 into low-copy plasmid
pWKS130 (
31) with
enzymes
ApaI and
SacII, producing pSTL245.
After
several cycles of mutagenic growth in STL913, plasmid DNA
was harvested
and transformed into RDK1656 (
recJ284::Tn
10
recB21 recC22 sbcA23 Rac
+ derivative of AB1157).
Candidate
recJ mutants were identified
by small colony
morphology and UV sensitivity, as described below.
The mutation D160A
was identified by DNA sequence analysis in
one of these isolates, and
the
recJD160A allele was subcloned
into vectors pWKS30 and
pWKS130.
Strain construction.
A deletion allele of recJ,
recJ
2060::Tn10-9, was constructed as
follows. DNA from pRDK163, carrying
recJ2003::Tn10-9, and pRDK161, carrying
recJ2051::Tn10-9 (21), was
cut with XhoI and AlwN, mixed, and ligated. A
resultant plasmid, pSTL41, carries a deletion of recJ from
nucleotides 124 to 1252, relative to the GTG initiation codon of
recJ, which is marked with a single copy of
Tn10-9, encoding Km resistance. By selection for Ap
resistance, pSTL41 was transformed into strain RDK1445, a
zgb-224::Tn10 serA6 derivative of
AB1157. The zgb-224::Tn10 marker is
tightly linked to recJ in transductional crosses
(17a). Integrants of pSTL41 into the E. coli
chromosome were selected by preparing a P1virA transducing
lysate (23) on the pSTL41 transformant of RDK1445 and using
it to transduce strain JC8679 (recB21 recC22 sbcA23 Rac+ derivative of AB1157) to Tc and Km resistance. The
resulting strain, STL3801, carried an integration of the entire pSTL41
plasmid and was Ap resistant. Kmr Aps
segregants that had deleted the plasmid but retained the
recJ
2060::Tn10-9 mutation were
isolated, producing strain STL3803.
Nuclease activity and protein stability assays.
A
two-plasmid system was used to express RecJ proteins from the T7
promoter. The relevant pWSK29 mutant derivatives were introduced by
transformation in strain STL327 (F
recJ284::Tn10 sbcB15 endA
(xth-pncA)
(tet) gal thi) that
harbors plasmid pGP1-2 (29) on which the T7 RNA polymerase
is under control of the thermolabile cI857 repressor.
Overexpression was induced by growth at high temperature as previously
described (20), and rifampin (200 µg/ml) (Sigma) was added
to inhibit E. coli RNA polymerase. Crude cell extracts were
prepared by lysozyme treatment and were assayed for nuclease activity
as previously described (20). Substrate DNA consisted of
denatured bacteriophage T7 DNA which had been uniformly labeled with
[3H]thymidine (12). The reaction buffer
contained 20 mM Tris HCl (pH 8.5), 10 mM MgCl2, 0.67 mM
dithiothreitol, 1 mg of bovine serum albumin per ml, and 10 µg of
substrate DNA per ml. One unit of nuclease activity corresponds to the
production of 1 nmol of acid-soluble nucleotides in 20 min at 37°C.
The protein concentration in the extracts was determined by the method
of Bradford (5), using reagent from Bio-Rad and bovine serum
albumin as the standard.
To measure the stability of mutant proteins, expression was induced as
described above in the presence of rifampin. Cultures
were prepared in
minimal medium using 56/2 salts (
32) and 0.4%
glucose.
Cellular proteins were labeled with [
35S]methionine (NEN
Dupont) in a 5-min pulse as described previously
(
20). The
cultures were split, and one was harvested immediately
and the other
was allowed to grow for an additional 10 h with
the addition of an
unlabeled methionine chase at a final concentration
of 0.05%. Cells
were then harvested and resuspended in electrophoresis
sample buffer,
and the proteins were resolved by polyacrylamide
gel electrophoresis
(
3). Gels were dried, and the radioactivity
in the band
corresponding to RecJ was determined by phosphorimage
analysis
(Molecular Dynamics, Inc.) using ImageQuant software.
The radioactivity
in the RecJ band of the 10-h chased samples
was compared to that of the
immediate pulse to determine the stability
of individual mutant
proteins.
UV survival assays.
Genetic experiments for complementation
and dominance employed recJ mutant constructs in the pWKS30
or pWKS130 vectors described above where recJ expression
originates from the lac promoter. Plasmids were introduced
by transformation into either STL3803 (recB21 recC22 sbcA23
recJ
2060::Tn10-9) or JC8679 (recB21
recC22 sbcA23). Transformants were grown in Luria-Bertani agar
plus Km and Ap (STL3803) or Luria-Bertani agar plus Km (JC8679).
Early-exponential-phase cultures were split, and one half was allowed
to grow in the original medium while the other half was grown in the
same medium with 1 mM isopropyl-
-D-thiogalactopyranoside
(IPTG) to induce expression of recJ from the lac
promoter on the plasmid. After 2 h of growth, cultures were
serially diluted in 56/2 salts, plated on 1.5% Luria-Bertani agar plus
Km or Luria-Bertani agar plus Km and Ap. Plates were exposed to either
10 J of UV irradiation/m2 or no irradiation. Plates
were incubated overnight in the dark at 37°C. Surviving fractions
were calculated as the number of CFU on UV-irradiated plates relative
to the total number of CFU from the nonirradiated plate. Data reported
are the averages of two to four experiments.
Database sequence analysis.
The PSI-BLAST program
(1) was used to generate sequence alignments. The Geneman
program (DNA Star, Inc.) was used to search for individual amino acid
motifs. The sequence of the Chlamydophila caviae recJ gene
was determined as described above from plasmid pRCH104 (15)
kindly provided by Ru-Ching Hsia.
Nucleotide sequence accession number.
The sequence of the
Chlamydophila caviae recJ gene was deposited in GenBank
under accession no. AF058396.
 |
RESULTS AND DISCUSSION |
Alignment of eubacterial RecJs.
A multisequence alignment of
the eubacterial RecJ-related proteins presently found the database is
shown in Fig. 1. The PSI-BLAST program
(1, 25) was used to generate initial alignments, although
some portions were aligned manually. Not shown are sequences homologous
to RecJ which are apparent in the incomplete genome sequences
accessible through the National Center for Biotechnology Information
(25): Actinobacillus actinomycetemcomitans,
Bordetella pertussis, Campylobacter jejuni,
Caulobacter crescentus, Chlorobium tepidum,
Clostridium acetobutylicum, Deinococcus
radiodurans, Enterococcus faecalis, Neisseria
gonorrhoeae, Neisseria meningitidis, Pasteurella
multocida, Porphyromonas gingivalis, Pseudomonas
aeruginosa, Pseudomonas putida, Salmonella
typhi, Shewanella putrefaciens, Staphylococcus
aureus, Streptococcus pneumoniae, Streptococcus pyogenes, Thermotoga maritima, Thiobacillus
ferrooxidans, Vibrio cholerae, and Yersinia
pestis.

View larger version (99K):
[in this window]
[in a new window]
|
FIG. 1.
A sequence alignment with eubacterial RecJ-related
sequences. Shown in parentheses are the number of amino acids not shown
in the alignment. Shown in bold are residues conserved in at least 13 of the 14 eubacterial sequences. Motifs with invariant residues are
numbered. Asterisks are placed above those residues mutated in this
study. Sequences are listed in order of similarity to E. coli RecJ as determined by BLAST alignment (25). Eco,
E. coli RecJ (PID2507106); Ech, Erwinia
chrysanthemi (PID2507107); Hin, Haemophilus influenzae
(PID1172895); Bsu1, B. subtilis YrvE (PID2635226); Rpr,
Rickettsia prowazekii (PID3861077); Ctr, Chlamydia
trachomatis (PID3328879); Ssp, Synechocystis sp.
(PID2984349); Hpy1, H. pylori HP0348 (RecJ) (PID2313437);
Cca, C. caviae (PID2126389); Aae, Aquifex
aeolicus (PID2984349); Bbu, Borrelia burgdorferi
(PID2688156); Tpa, Treponema pallidum (PID3323008); Bsu2,
B. subtilis YorK (PID2634428); Hpy2, H. pylori
HP0425 (PID2313533).
|
|
Excepting the
Mycoplasma species and
Mycobacterium
tuberculosis, all the eubacterial genomes contain sequences whose
products
are closely related to
E. coli RecJ.
Bacillus
subtilis has two
RecJ homologs, YrvE and YorK. YorK appears to be
encoded by a
temperate bacteriophage, SP

c2. YrvE is more closely
related to
the proteobacterial forms than it is to YorK, but BLAST
sequence
alignment demonstrates that both proteins show strong
similarity
to
E. coli RecJ (data not shown). Likewise,
Helicobacter pylori has three RecJ-related sequences: one
(HP0348) appears to be the
true RecJ homolog, and two others, the
products of duplicated
gene segments (HP0425 and HP1410), are more
weakly similar to
the other eubacterial
RecJs.
The amino acid sequence is quite diverged in this set (Fig.
1), and
seven conserved motifs emerge, four of which contain six
invariant
aspartate residues. Five of these motifs have also been
noted by others
(
2). These motifs are good candidates for interaction
with
Mg
2+ ions, a cofactor required for RecJ-mediated hydrolysis
of DNA
(
19). Motifs 1 and 2 of RecJ are somewhat similar to
the ExoI
and ExoII motifs of the PolI-Fen1 group of 5' exonucleases
(
10,
11,
13,
27) (Fig.
2). The
structures of three members of
this group,
Thermus aquaticus
(
Taq) polymerase, bacteriophage
T4 RNase H, and
Pyrococcus furiosus FEN-1, have been solved and
shown to
have similar features (
14,
16,
24): the conserved
carboxylates cluster at the bottom of a cleft and coordinate two
(RNase
H and FEN-1) or three (
Taq Pol) metal ions. By analogy
to
the 3' exonuclease of the Klenow fragment (
E. coli PolI),
the
metal ions are believed to interact with the phosphate of the
substrate, generate the attacking hydroxide ion, and facilitate
product
release (
4).

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 2.
Similarity of RecJ motifs 1 and 2 with ExoI
and ExoII motifs as exhibited by members of the RAD2-FEN-1
family of 5' exonucleases. Sequences include E. coli RecJ,
T4 RNase H, Taq polymerase, T7 gene 6 protein, S. cerevisiae RAD2, human XP-G, and murine FEN-1 with respect to the
published alignment of the RAD2-FEN-1 group (24).
|
|
Mutational analysis of E. coli RecJ.
Mutations
within six of the conserved motifs were isolated either by random
mutagenesis, selecting for loss of recJ genetic function in
vivo, or by site-directed mutagenesis of plasmid-borne recJ.
Tests were employed to measure the loss of RecJ function both
biochemically and genetically. The mutant proteins were overexpressed from the T7 promoter, and exonuclease activity on ssDNA was
assayed in crude extracts. The stability of mutant RecJ proteins
was determined by [35S]methionine pulse-chase
experiments. In addition, the genetic function was tested by expressing
the mutant RecJ proteins from the lac promoter on
low-copy plasmids, both with and without IPTG induction, in various
strain backgrounds. Complementation was tested by the UV survival of
plasmid transformants of a strain carrying
recJ
2060::Tn10-9 on its chromosome,
STL3803. Genetic dominance of the mutants was tested similarly by UV
survival assays of plasmid transformants of a strain carrying
recJ+ on its chromosome, JC8679.
Mutational analysis showed that all six motifs are essential for RecJ
function (Table
1). Mutations in the
conserved aspartates
in motifs 1, 3, and 4 (D79A, D81A, D83A, D160A,
and D236A) produced
a severe (at least 400-fold) reduction of ssDNA
exonuclease activity
assayed in crude extracts. (Other nucleases in
E. coli contribute
to nuclease activity in crude extracts;
therefore, reduction in
RecJ activity below this level cannot be
ascertained.) These mutant
genes, even when overexpressed, could not
genetically complement
the UV repair deficiency conferred by a
recJ chromosomal mutation.
This group of mutations also had
a genetic dominant-negative effect:
they produced a RecJ

(UV-sensitive) phenotype even in strains carrying
recJ+ on the chromosome. For D79A, D81A, D83A,
and D160A, this dominance
was more severe when expression from the
plasmid was induced with
IPTG, indicating a competitive effect between
the wild-type and
mutant forms of RecJ. In contrast, the D236A
mutation was dominant
even without the induction of the
lac
promoter. All of the mutant
proteins also produced a dominant effect on
genetic recombination
as measured after conjugation (data not shown).
None of these
dominant mutants expressed a noticeably unstable protein,
even
after overnight pulse-chase experiments. These results and their
observed genetic dominance suggest that no gross conformational
changes
result from these mutations.
Mutations in the invariant residues of motif 2 (D137A), motif 6 (R401A), or motif 7 (H429A) or in the histidines of motif
3 (H161A and
H162A) produced at least a 100- to 500-fold decrease
in exonuclease
activity and a recessive mutant phenotype. The
H429A mutation appeared
genetically "leaky" in two respects: it
showed a level of
exonuclease activity above background and that
induction of high
expression with IPTG partially suppressed its
mutant phenotype. These
recessive mutant proteins were not detectably
unstable in overnight
pulse-chase experiments, indicating that
they most likely have a
specific defect in catalysis rather than
gross conformational
alterations.
The genetic dominance of the aspartate mutants in motifs 1, 3, and 4 suggested that these mutant proteins in some way interfere
with the
normal functioning of wild-type RecJ protein in vivo.
Genetic dominance
is common among mutants of multimeric proteins.
However, purified RecJ
exonuclease is believed to be a monomer,
as judged by gel filtration
and glycerol gradient sedimentation
criteria (
9,
20a). We
cannot, however, rule out the possibility
that a RecJ multimer has
other, unknown, functions or that interactions
with other unknown
partners in vivo account for the dominant-negative
phenotype. Another
explanation for the observed dominance may
be that these proteins bind
substrate but do not degrade it, acting
as inhibitors of the wild-type
RecJ and potentially of other enzymes
as well. We have observed that
Mg
2+ is not required for the binding of DNA
oligonucleotides by RecJ
protein in gel-shift experiments
(
21a). These dominant mutant
proteins may have lost the
ability to bind one or more Mg
2+ ions, which would negate
exonucleolytic activity but not DNA
binding. According to this latter
scenario, the recessive mutants
may have lost their ability to bind DNA
substrate and therefore
cannot interfere with the wild-type RecJ
protein. Further experiments
with purified mutant proteins should
clarify the molecular basis
of this observed
dominance.
This study illustrates the usefulness of a large sequence set to
identify catalytically important amino acid residues. The
most
pronounced genetic effects were obtained for D236A, a strongly
dominant
allele, and this residue was difficult to identify as
conserved by many
pairwise sequence comparisons. Motif 5 was likewise
often not aligned
in BLAST searches but was seen in certain position-iterated,
PSI-BLAST
alignments. Mutations in this motif are presently being
tested for
activity.
Multiple RecJ genes and a larger RecJ-related superfamily.
Helicobacter, Bacillus, and the archaeal genera
possess more than one sequence related to RecJ. Two of the proteins in
Helicobacter, HP0425 and HP1410, and their DNA sequences are
virtually identical and are therefore the result of recent gene
duplication. The archaeal forms are quite diverged from other forms
within the same organism and therefore have resulted from more ancient
duplication or by horizontal transfer from another species. One of the
two Bacillus forms is encoded on a temperate bacteriophage.
In other organisms, multiple genes could conceivably express enzymes
with differential substrate specificities, reaction optima, or
regulations. As RecJ may be involved in the repair of apurinic sites
(7), those organisms that grow at low pH or high temperature
may have a higher demand for RecJ activity because of elevated rates of
spontaneous depurination.
Searches for individual motifs (motif 1, DXDG; motif 3, DHH; and motif
6, GGH) and position-specific iterated BLAST searches
(
1)
with numerous RecJ-related proteins reveal a larger set
of sequences
more weakly related to RecJ. This set includes sequences
from archaea,
eubacteria, and eukaryotes. Many organisms harbor
multiple members of
this larger RecJ-related family; a total of
seven sequences with RecJ
motifs were found in
Archaeoglobus,
six each in
Methanococcus and
B. subtilis, four in
Helicobacter,
and three each in
Synechocystis and
Aquifex. We have recently
demonstrated that one of the
methanococcal
recJ-related genes
encodes a thermostable
ssDNA exonuclease activity, similar to
E. coli RecJ
exonuclease in many of its properties (
25a). This
superfamily also includes the hypothetical 29-kDa protein of the
MgPa
adhesin operon (MG170) and numerous related proteins of
Mycoplasma species. Two putative polyA polymerases from
Aquifex and
Synechocystis carry the RecJ motifs
at their N termini, in domains distinct
from their polymerase domains.
The existence of this larger family
of proteins has also been noted
independently and described in
detail by others (
2).
Included in this larger group is the
S. cerevisiae PPX1
protein, a cytoplasmic exopolyphosphatase that is believed to degrade
storage polyphosphate (
33,
34). Proteins in four other
organisms
(
Archaeoglobus,
Methanococcus,
Streptococcus mutans, and
Schizosaccharomyces pombe) have been designated exopolyphosphatases based on
similarity
to the
S. cerevisiae protein. Polyphosphate is
stored in many
organisms, including bacteria and fungi, and some of
these RecJ-related
proteins may play a role in phosphate release. Other
eukaryotic
proteins,
Drosophila melanogaster PRUNE protein
and the products
of two open reading frames from the protozoa
Leishmania major,
are also members of this subfamily.
However, except for
S. cerevisiae PPX1,
E. coli
RecJ, and the methanococcal RecJ-like protein mentioned
above, whether
individual members of this superfamily are polyphosphatases
or DNA
exonucleases has not been experimentally
determined.
A common feature of the RecJ and PPX1 enzymes is phosphoesterase
activity, and therefore these seven motifs may be predictive
of
phosphoesterases. Both RecJ and PPX1 activities are dependent
on
Mg
2+ cofactor, and we presume that the motifs reflect a
conserved
architecture of Mg
2+ coordination and phosphate
interaction sites within the enzymes.
The substrate range of the
proteins within the PPX subfamily is
not known but could conceivably
include other phosphate esters
including protein phosphoester bonds,
DNA, RNA, or nucleotide
phosphate esters. It is not known whether such
proteins can hydrolyze
multiple classes of substrates (tests for ssDNA
exonuclease activity
for PPX1 protein have not been reported); however,
we have detected
no polyphosphatase activity for purified RecJ protein
(data not
shown). The existence of similar motifs within enzymes with
quite
different biological substrates points out a potential danger
of
assigning biochemical activity to unknown proteins purely on
the basis
of sequence
similarity.
 |
ACKNOWLEDGMENTS |
This work was supported by Public Health Service grant RO1
GM43889, T32 training grant GM07122 (to E.S.H. and L.A.R.), and predoctoral fellowship F31 GM19179 (to L.A.R.).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Rosenstiel Basic
Medical Sciences Research Center, Brandeis University, Waltham, MA 02454-9110. Phone: (781) 736-2487. Fax (781) 736-2405. E-mail: lovett{at}hydra.rose.brandeis.edu.
 |
REFERENCES |
| 1.
|
Altschul, S. F.,
T. L. Madden,
A. A. Schaffer,
J. Zhang,
Z. Zhang,
W. Miller, and D. J. Lipman.
1997.
Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res.
25:3389-3402[Abstract/Free Full Text].
|
| 2.
|
Aravind, L., and E. V. Koonin.
1998.
A novel family of predicted phosphoesterase includes Drosophila prune protein and bacterial RecJ exonuclease.
Trends Biochem. Sci.
23:17-19[Medline].
|
| 3.
|
Ausubel, F. A.,
R. Brent,
R. E. Kingston,
D. D. Moore,
J. G. Seidman,
J. A. Smith, and K. Struhl.
1989.
Short protocols in molecular biology.
Greene Publishing and Wiley-Interscience, New York, N.Y.
|
| 4.
|
Beese, L. S., and T. A. Steitz.
1991.
Structural basis for the 3' - 5' exonuclease activity of Escherichia coli DNA polymerase I: a two metal ion mechanism.
EMBO J.
10:25-33[Medline].
|
| 5.
|
Bradford, M. M.
1976.
A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding.
Anal. Biochem.
72:248-254[Medline].
|
| 6.
|
Cooper, D. L.,
R. S. Lahue, and P. Modrich.
1993.
Methyl-directed mismatch repair is bidirectional.
J. Biol. Chem.
268:11823-11829[Abstract/Free Full Text].
|
| 7.
|
Dianov, G.,
B. Sedgwick,
G. Daly,
M. Olsson,
S. Lovett, and T. Lindahl.
1994.
Release of 5'-terminal deoxyribose-phosphate residues from incised abasic sites in DNA by the Escherichia coli RecJ protein.
Nucleic Acids Res.
22:993-998[Abstract/Free Full Text].
|
| 8.
|
Dower, W. J.,
J. F. Miller, and C. W. Ragsdale.
1988.
High efficiency transformation of E. coli by high voltage electroporation.
Nucleic Acids Res.
16:6127-6145[Abstract/Free Full Text].
|
| 9.
|
Franklin, W. A., and T. Lindahl.
1988.
DNA deoxyribophosphodiesterase.
EMBO J.
7:3617-3622[Medline].
|
| 10.
|
Gutman, P. D., and K. W. Minton.
1993.
Conserved sites in the 5'-3' exonuclease domain of the Escherichia coli DNA polymerase.
Nucleic Acids Res.
21:4406-4407[Free Full Text].
|
| 11.
|
Harrington, J. J., and M. R. Lieber.
1994.
Functional domains within FEN-1 and RAD2 define a family of structure-specific endonucleases: implication for nucleotide excision repair.
Genes Dev.
8:1344-1355[Abstract/Free Full Text].
|
| 12.
|
Hinkle, D. C., and M. J. Chamberlin.
1972.
Studies of the binding of Escherichia coli RNA polymerase to DNA. I. The role of sigma subunit in site selection.
J. Mol. Biol.
70:157-185[Medline].
|
| 13.
|
Hollingsworth, H. C., and N. G. Nossal.
1991.
Bacteriophage T4 encodes an RNase H which removes RNA primers made by the T4 DNA replication system in vitro.
J. Biol. Chem.
266:1868-1897.
|
| 14.
|
Hosfield, D. J.,
C. D. Mol,
B. Shen, and J. A. Tainer.
1998.
Structure of the DNA repair and replication endonuclease and exonuclease FEN-1: coupling DNA and PCNA binding to FEN-1 activity.
Cell
95:135-146[Medline].
|
| 15.
|
Hsia, R.-C., and P. M. Bavoil.
1996.
Homologs of Escherichia coli recJ, gltS and of a putative "early" gene of avian Chlamydia psittaci are located upstream of the "late" omp2 locus of Chlamydia psittaci strain Guinea Pig Inclusion Conjunctivitis.
Gene
176:163-169[Medline].
|
| 16.
|
Kim, Y.,
S. H. Eom,
J. Wang,
D.-S. Lee,
S. W. Suh, and T. A. Steitz.
1995.
Crystal structure of Thermus aquaticus DNA polymerase.
Nature
376:612-616[Medline].
|
| 17.
|
Kunkel, T. A.,
K. Bebenek, and J. McClary.
1991.
Efficient site-directed mutagenesis using uracil-containing DNA.
Methods Enzymol.
204:125-139[Medline].
|
| 17a.
| Lovett, S. Unpublished data.
|
| 18.
|
Lovett, S. T., and A. J. Clark.
1984.
Genetic analysis of the recJ gene of Escherichia coli K-12.
J. Bacteriol.
157:190-196[Abstract/Free Full Text].
|
| 19.
|
Lovett, S. T., and R. D. Kolodner.
1989.
Identification and purification of a single-strand-specific exonuclease encoded by the recJ gene of Escherichia coli.
Proc. Natl. Acad. Sci. USA
86:2627-2631[Abstract/Free Full Text].
|
| 20.
|
Lovett, S. T., and R. D. Kolodner.
1991.
Nucleotide sequence of the Escherichia coli recJ chromosomal regions and construction of RecJ-overexpression plasmids.
J. Bacteriol.
173:353-364[Abstract/Free Full Text].
|
| 20a.
| Lovett, S. T., and R. D. Kolodner.
Unpublished results.
|
| 21.
|
Lovett, S. T., and V. A. Sutera, Jr.
1995.
Suppression of RecJ exonuclease mutants of Escherichia coli by alterations in DNA helicases II (uvrD) and IV (helD).
Genetics
140:27-45[Abstract].
|
| 21a.
| Lovett, S. T., and V. A. Sutera, Jr.
Unpublished data.
|
| 22.
|
Miesel, L., and J. R. Roth.
1996.
Evidence that SbcB and RecF pathway functions contribute to RecBCD-dependent transductional recombination.
J. Bacteriol.
178:3146-3155[Abstract/Free Full Text].
|
| 23.
|
Miller, J. H.
1992.
A short course in bacterial genetics.
Cold Spring Harbor Press, Cold Spring Harbor, N.Y.
|
| 24.
|
Mueser, T. C.,
N. G. Nossal, and C. C. Hyde.
1996.
Structure of bacteriophage T4 RNase H, a 5' to 3' RNA-DNA and DNA-DNA exonuclease with sequence similarity to the RAD2 family of eukaryotic proteins.
Cell
85:1101-1112[Medline].
|
| 25.
| National Center for Biotechnology Information.
[Online.] http://www.ncbi /nlm.nih.gov/BLAST [25 May 1999, last
date accessed.]
|
| 25a.
| Rajman, L. A., and S. T. Lovett.
Unpublished results.
|
| 26.
|
Razavy, H.,
S. K. Szigety, and S. M. Rosenberg.
1996.
Evidence for both 3' and 5' single-strand DNA ends in intermediates in Chi-stimulated recombination in vivo.
Genetics
142:333-339[Abstract].
|
| 27.
|
Robins, P.,
D. J. C. Pappin,
R. D. Wood, and T. Lindahl.
1994.
Structural and functional homology between mammalian DNase IV and the 5'-nuclease domain of Escherichia coli DNA polymerase I.
J. Biol. Chem.
269:28535-28538[Abstract/Free Full Text].
|
| 28.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 29.
|
Tabor, S.
1990.
Expression using the T7 RNA polymerase/promoter system, p. 16.2.1-16.2.11.
In
F. A. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.), Current protocols in molecular biology. Green Publishing and Wiley-Interscience, New York, N.Y.
|
| 30.
|
Viswanathan, M., and S. T. Lovett.
1998.
Single-strand DNA specific exonucleases in Escherichia coli: roles in repair and mutation avoidance.
Genetics
249:7-16.
|
| 31.
|
Wang, R. F., and S. R. Kushner.
1991.
Construction of versatile low-copy vectors for cloning, sequencing and gene expression in Escherichia coli.
Gene
100:195-199[Medline].
|
| 32.
|
Willetts, N. S.,
A. J. Clark, and B. Low.
1969.
Genetic location of certain mutations conferring recombination deficiency in Escherichia coli.
J. Bacteriol.
97:244-249[Abstract/Free Full Text].
|
| 33.
|
Wurst, H., and A. Kornberg.
1994.
A soluble exopolyphosphatase of Saccharomyces cerevisiae.
J. Biol. Chem.
269:10996-11001[Abstract/Free Full Text].
|
| 34.
|
Wurst, H.,
T. Shiba, and A. Kornberg.
1995.
The gene for a major exopolyphosphatase of Saccharomyces cerevisiae.
J. Bacteriol.
177:898-906[Abstract/Free Full Text].
|
Journal of Bacteriology, October 1999, p. 6098-6102, Vol. 181, No. 19
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Fang, M., Zeisberg, W.-M., Condon, C., Ogryzko, V., Danchin, A., Mechold, U.
(2009). Degradation of nanoRNA is performed by multiple redundant RNases in Bacillus subtilis. Nucleic Acids Res
0: gkp527v1-gkp527
[Abstract]
[Full Text]
-
Romo-Gonzalez, C., Salama, N. R., Burgeno-Ferreira, J., Ponce-Castaneda, V., Lazcano-Ponce, E., Camorlinga-Ponce, M., Torres, J.
(2009). Differences in Genome Content among Helicobacter pylori Isolates from Patients with Gastritis, Duodenal Ulcer, or Gastric Cancer Reveal Novel Disease-Associated Genes. Infect. Immun.
77: 2201-2211
[Abstract]
[Full Text]
-
Kickstein, E., Harms, K., Wackernagel, W.
(2007). Deletions of recBCD or recD influence genetic transformation differently and are lethal together with a recJ deletion in Acinetobacter baylyi. Microbiology
153: 2259-2270
[Abstract]
[Full Text]
-
Tammenkoski, M., Moiseev, V. M., Lahti, M., Ugochukwu, E., Brondijk, T. H. C., White, S. A., Lahti, R., Baykov, A. A.
(2007). Kinetic and Mutational Analyses of the Major Cytosolic Exopolyphosphatase from Saccharomyces cerevisiae. J. Biol. Chem.
282: 9302-9311
[Abstract]
[Full Text]
-
Han, E. S., Cooper, D. L., Persky, N. S., Sutera, V. A. Jr, Whitaker, R. D., Montello, M. L., Lovett, S. T.
(2006). RecJ exonuclease: substrates, products and interaction with SSB. Nucleic Acids Res
34: 1084-1091
[Abstract]
[Full Text]
-
Jaffe, J. D., Stange-Thomann, N., Smith, C., DeCaprio, D., Fisher, S., Butler, J., Calvo, S., Elkins, T., FitzGerald, M. G., Hafez, N., Kodira, C. D., Major, J., Wang, S., Wilkinson, J., Nicol, R., Nusbaum, C., Birren, B., Berg, H. C., Church, G. M.
(2004). The Complete Genome and Proteome of Mycoplasma mobile. Genome Res
14: 1447-1461
[Abstract]
[Full Text]
-
Yamagata, A., Kakuta, Y., Masui, R., Fukuyama, K.
(2002). The crystal structure of exonuclease RecJ bound to Mn2+ ion suggests how its characteristic motifs are involved in exonuclease activity. Proc. Natl. Acad. Sci. USA
99: 5908-5912
[Abstract]
[Full Text]
-
Skaar, E. P., Lazio, M. P., Seifert, H. S.
(2002). Roles of the recJ and recN Genes in Homologous Recombination and DNA Repair Pathways of Neisseria gonorrhoeae. J. Bacteriol.
184: 919-927
[Abstract]
[Full Text]
-
Yamagata, A., Masui, R., Kakuta, Y., Kuramitsu, S., Fukuyama, K.
(2001). Overexpression, purification and characterization of RecJ protein from Thermus thermophilus HB8 and its core domain. Nucleic Acids Res
29: 4617-4624
[Abstract]
[Full Text]
-
Bzymek, M., Lovett, S. T.
(2001). Evidence for Two Mechanisms of Palindrome-Stimulated Deletion in Escherichia coli: Single-Strand Annealing and Replication Slipped Mispairing. Genetics
158: 527-540
[Abstract]
[Full Text]
-
Rajman, L. A., Lovett, S. T.
(2000). A Thermostable Single-Strand DNase from Methanococcus jannaschii Related to the RecJ Recombination and Repair Exonuclease from Escherichia coli. J. Bacteriol.
182: 607-612
[Abstract]
[Full Text]
-
Yamagata, A., Kakuta, Y., Masui, R., Fukuyama, K.
(2002). The crystal structure of exonuclease RecJ bound to Mn2+ ion suggests how its characteristic motifs are involved in exonuclease activity. Proc. Natl. Acad. Sci. USA
99: 5908-5912
[Abstract]
[Full Text]