INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

Bacillus thuringiensis is unique in its capacity to produce a variety of insecticidal -endotoxins, which are arranged in different classes (7, 13). The structure of these toxins appears to be highly conserved (10, 13, 19), especially the seven amphipathic  helices which comprise domain I. Following binding of the toxin to specific receptors on cells lining the larval midgut (12, 15), one or more of these helices insert into the membrane and participate in the formation of an ion channel (8, 10, 16, 22). The mode of killing is believed to be colloid osmotic lysis (17), although more subtle and/or more rapid effects have not been ruled out.

Previously we had mutagenized regions of the cry1Ac1 gene encoding residues within three of these helices, i.e., 2, 5, and 6, and found that helix 5 was the only one in which many of the mutations abolished toxicity (2, 27). As an extension of the previous studies, we have investigated the role of helix 4 and the loop connecting helices 4 and 5. Thirty-nucleotide mutagenic oligonucleotides were used to obtain random mutations in regions of the cry1Ac1 gene encoding residues in helix 4 and the loop. Four site-specific mutations which should have altered the hydrophobic properties of helix 3 were also examined. Many mutations in helix 4 resulted in either the loss of toxicity or toxin instability, and one mutant toxin had enhanced activity. Mutations in the loop connecting helices 4 and 5 or within helix 3, however, had little effect on stability or toxicity. The nontoxic 4 mutant toxins oligomerized in the membrane as well as the wild-type toxin but did not form functional ion channels. Helices 4 and 5, which comprise a very hydrophobic loop within domain I, are both important for toxicity but have different roles in toxin aggregation and probably ion channel formation and/or function.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Bacterial strains and media. Propagation of phage M13 clones was carried out in Escherichia coli JM101 at 37°C in Luria-Bertani medium (21). Other subclones were propagated in E. coli DH5, using the same medium, in the presence of 50 µg of ampicillin ml¹. The acrystalliferous derivative of Bacillus thuringiensis subsp. kurstaki HD1, strain CryB (24), was grown at 30°C on a rotary shaker in G-Tris medium (3) with or without erythromycin at 25 µg ml¹.

Mutagenesis and subcloning. The cry1Ac1 gene in M13mp19 was mutagenized as described previously (27). Thirty-nucleotide mutagenic oligonucleotides encoding residues 129 to 137 within helix 4 (5' CATGTCATTGAATTGAATACGCATCTC 3' with 90% as specified plus 3% of each of the other 3 bases) and residues 145 to 155 within the carboxyl terminus of helix 4 and the loop connecting helices 4 and 5 (5' AACTTGATAATTTTGAACTGCAAAAAGAGGAAT 3' with 90% as specified plus 3% of each of the other 3 bases) were used to generate random mutations in each of these regions.

Immunoblotting and bioassays. E. coli JM101, at a density of 1 × 10⁸ to 2 × 10⁸ in Luria-Bertani medium, was infected with the M13 clones, and the cultures were incubated on a rotary shaker at 37°C for 6 h. To test the stability of the mutant toxins, crude extracts of the infected cells, prepared as described previously (2), were incubated with tolylsulfonyl phenylalanylchloromethyl ketone (TPCK)-trypsin at a ratio of 1 µg of extract to 20 µg of TPCK-trypsin in 0.03 M NaHCO₃, pH 8.6, for 2 h. The trypsin-treated toxins were tested for stability by separation by sodium dodecyl sulfate (SDS)-10% polyacrylamide gel electrophoresis (PAGE) and immunoblotting with a polyclonal rabbit antibody against the Cry1Ac1 toxin (20).

Toxin purification. The pHT3101-cry1Ac1 plasmids containing the various mutations were electroporated into B. thuringiensis CryB as described previously (2). Clones were spread on G-Tris-erythromycin agar and incubated for 72 h at 30°C. The confluent plates of spores plus inclusions were harvested in 1 M KCl-5 mM EDTA, pH 7.0. Following centrifugation at 8,000 rpm for 8 min, the pellets were each resuspended in 2 to 3 ml of deionized water and the suspensions were incubated at 65°C for 2 min to inactivate residual proteases. The cells were recentrifuged at 7,700 × g for 8 min, and the pellets were suspended in a minimal volume of solubilization buffer (0.03 M NaHCO₃-0.02% -mercaptoethanol, pH 9.6). Suspensions in this buffer were incubated at 37°C for 20 min and then centrifuged at 7,700 × g, and the supernatants were saved. This extraction was repeated twice, and the pooled supernatants were dialyzed overnight at 4°C against 2 liters of 1 mM Tris, pH 8.5. After dialysis, the solubilized protoxin was incubated with TPCK-trypsin at a ratio of 1 µg of extract to 20 µg of TPCK-trypsin at 37°C for 1 h. This trypsin treatment was repeated with an additional 1-h incubation. The digested toxin was dialyzed in Spectropor dialysis tubing with a 50,000-Da-molecular-size cutoff against 1,000 volumes of 0.03 M Tris-HCl, pH 8.5, followed by dialysis against 0.03 M NaHCO₃-0.25 M NaCl, pH 9.6.

Ligand blotting and membrane insertion studies. Brush border membrane vesicles (BBMV) were prepared from fifth-instar larvae of M. sexta according to the method of Wolfersberger et al. (26), and the protein concentration of the preparation was determined with the bicinchoninic acid reagent. Ligand blotting was performed by the method of Mohammed et al. (20). Twenty micrograms of BBMV protein (solubilized in the loading buffer) was loaded onto an SDS-8% polyacrylamide gel, and each lane was blotted separately onto a polyvinylidene difluoride membrane (Immobilon P; Millipore) strip. After nonspecific groups were blocked with 5% milk powder in Tris-buffered saline, pH 7.5, the membrane strips were incubated with either the wild-type or mutant toxin. The blots were developed after treatment with rabbit anti-Cry1Ac1 antibody followed by an anti-rabbit antibody-alkaline phosphatase conjugate.

Light scattering assays. The solute permeability of BBMV containing the wild-type and nontoxic-mutant toxins was analyzed by a light scattering assay as described by Carroll et al. (5) with minor modifications. BBMV (0.2 mg/ml) equilibrated with 10 mM 2-(cyclohexylamino)ethanesulfonic acid (CHES)-KOH (pH 9.0)-1% (wt/vol) BSA were incubated with Cry1Ac1 toxin (36 pmol/mg of BBMV) for 60 min at 21°C. The treated BBMV were mixed with an equal volume of 10 mM CHES-KOH-0.1% (wt/vol) BSA containing 150 mM KCl, pH 9.0, at 21°C. Reswelling was measured by using an SpectraKinetic stopped-flow spectrophotometer (Applied Physics) with 90°C light scattering at 450 nm. All measurements were the averages of at least three replicas with errors as in Table 3.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Mutations within helix 4 affect toxicity. Twelve different single-amino-acid substitutions and four different double-amino-acid substitutions were generated within helix 4 (Table 1). Five of the single mutants (Q₁₃₃R, I₁₃₂S, I₁₃₂L, I₁₃₂V, and I₁₃₂N) were nontoxic. The R₁₃₁L change and the double mutation (I₁₃₂V-D₁₃₆Y) resulted in an approximately 10-fold reduction in toxicity. The F₁₃₄L mutant, on the other hand, showed an approximately threefold increase in toxicity compared to the wild type. Extracts of the M13 clones were tested for toxin stability, and they all produced stable toxins, as shown for three of them in Fig. 1. Five other single-amino-acid substitutions in this region, i.e., R₁₃₁C, R₁₃₁S, M₁₃₀I, M₁₃₇T, and Q₁₃₃H, did not affect toxicity. Among the four mutant toxins with double-amino-acid substitutions, M₁₃₀I-R₁₃₁L, I₁₃₂F-N₁₃₅S, and F₁₃₄A-M₁₃₇I were unstable. Those helix 4 mutant toxins which exhibited significant differences from the wild type in terms of toxicity against M. sexta were further tested for toxicity against larvae of H. virescens. All of the mutant toxins which were nontoxic for M. sexta were also nontoxic for H. virescens.

View this table: [in this window] [in a new window]   TABLE 1.   Mutations in helix 4 and their effects on toxin stability and toxicity

View larger version (50K): [in this window] [in a new window]   FIG. 1.   Crude extracts of M13 clones digested with trypsin were electrophoresed in an 10% SDS-polyacrylamide gel and transferred to an Immobilon-P membrane for immunoblotting with the Cry1Ac1 antibody. Lane 1, molecular mass standards; lane 2, wild-type M13 crude extract; lane 3, wild-type M13 crude extract, trypsin treated; lane 4, Q133R M13 crude extract; lane 5, Q133R M13 crude extract, trypsin treated; lane 6, I132S M13 crude extract; lane 7, I132S M13 crude extract, trypsin treated; lane 8, I132L M13 crude extract; lane 9, I132L M13 crude extract, trypsin treated. All other nontoxic helix 4 mutants were also stable to trypsin digestion (data not shown).

Mutations within the 4-5 loop do not affect toxicity. Seven different single-amino-acid substitutions were generated either within the carboxyl end of helix 4 or within the loop connecting helices 4 and 5 (Table 2). Only the Q₁₅₄R substitution resulted in instability to trypsin. All of the others produced stable, fully active toxins.

View this table: [in this window] [in a new window]   TABLE 2.   Mutations in helix 3 and the loop connecting helices 4 and 5 do not affect toxicity

Increasing the hydrophobicity of helix 3 does not affect toxicity. Among the seven -helix peptides, the synthetic peptide of helix 3 exhibited the lowest level of binding to phospholipid vesicles (9). It was thought that binding could be enhanced by converting hydrophilic surface residues to hydrophobic ones, thereby increasing toxicity. Asparagines 94 and 105 were identified as being solvent exposed (14) and were mutated to either V or F (Table 2). None of any of the four single-amino-acid substitutions had any effect on toxicity or toxin stability.

Binding to a toxin receptor and oligomerization within the membrane. To test whether the lack of toxicity of the helix 4 mutants was due to a loss of receptor binding, ligand blot and membrane insertion studies were performed. The nontoxic helix 4 mutant toxins bound as well as the wild-type toxin to a single 120-kDa protein in M. sexta BBMV (Fig. 2). Nontoxic helix 4 mutant toxins were recovered from BBMV as oligomers of ca. 200 and 130 kDa to about the same extent as the wild-type toxin (Fig. 3). Results like those shown for mutants Q₁₃₃R and I₁₃₂S in Fig. 3 were obtained with all of the helix 4 mutant toxins. In contrast, a nontoxic helix 5 mutant toxin, A₁₆₄P, did not insert efficiently into the membrane or oligomerize as previously reported for this mutant and other nontoxic helix 5 mutants (4).

View larger version (63K): [in this window] [in a new window]   FIG. 2.   Immunoblot of M. sexta BBMV solubilized proteins fractionated by SDS-8% PAGE and incubated with Cry1Ac1 wild-type and mutant toxins. The blots were developed after treatment with rabbit anti-Cry1Ac1 antibody followed by an anti-rabbit antibody-alkaline phosphatase conjugate. Lane 1, molecular mass standards (in kilodaltons); lane 2, BBMV not incubated with toxin; lane 3, BBMV incubated with wild-type toxin; lane 4, BBMV incubated with mutant toxin Q133R; lane 5, BBMV incubated with mutant toxin I132S; lane 6, BBMV incubated with mutant toxin I132L; lane 7, BBMV incubated with mutant toxin I132V; lane 8, BBMV incubated with mutant toxin I132N; lane 9, BBMV incubated with mutant toxin A164P. Mutant toxins R131L and I132V-D136Y, with reduced toxicity, also bound to the 120-kDa BBMV protein (data not shown).

View larger version (64K): [in this window] [in a new window]   FIG. 3.   Binding and oligomerization of toxins in M. sexta BBMV. BBMV (20 µg of protein) were incubated with 60 ng of toxin at 30°C for 1 h. The vesicles were centrifuged, washed, and extracted as described in Materials and Methods. The extracts were subjected to electrophoresis (SDS-6% polyacrylamide gels) and western blotting, and the immunoblots were treated with rabbit anti-Cry1Ac1 antibody and then an anti-rabbit antibody conjugated with alkaline phosphatase. Lane 1, molecular mass standards; lane 2, wild-type toxin; lane 3, wild-type toxin extracted from BBMV; lane 4, mutant toxin A164P; lane 5, mutant toxin A164P extracted from BBMV; lane 6, mutant toxin Q133R; lane 7, mutant toxin Q133R extracted from BBMV; lane 8, mutant toxin I132S; lane 9, mutant toxin I132S extracted from BBMV; lane 10, BBMV. All other nontoxic helix 4 mutants also oligomerized in the membrane (data not shown).

Nontoxic helix 4 mutant toxins are affected in BBMV permeability. Toxin-induced changes in BBMV permeability were measured by a light scattering assay (Fig. 4). The rate of decrease for the wild-type toxin was much higher than that for the I₁₃₂L mutant, with the latter being close to the buffer control value. Similar analyses were done for all of the nontoxic helix 4 mutant toxins, and in all cases there was a seven- to eightfold difference in the initial rate compared to that of the wild type (Table 3).

View larger version (22K): [in this window] [in a new window]   FIG. 4.   Toxin-induced permeability changes in M. sexta BBMV as measured by a decrease in light scattering with time (5). x, wild-type toxin (w.t.); o, I132L mutant toxin; +, BBMV with buffer only.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

Six of 12 single-amino-acid changes within helix 4 resulted in either a total loss of or greatly reduced toxicity. This frequency is comparable to that found for random mutations in helix 5 (27). No nontoxic mutants had been isolated following random mutagenesis in the regions of the cry1Ac1 gene encoding helices 2 and 6 (2, 27). As discussed below, mutations of surface residues within helix 3 did not affect toxicity (Table 2). Helix 1 does not bind to synthetic phospholipid vesicles (9), and it is the only part of the toxin that is susceptible to protease K after binding of the toxin to BBMV (4). It is unlikely, therefore, to play a critical role in toxin function within the membrane.

Since only mutations in helices 4 and 5, among six of the seven helices comprising domain I, affected toxicity, this portion of the toxin must contribute significantly to the formation and function of an ion channel. The 4-loop-5 is the most hydrophobic region of the Cry1A toxins (10), and it probably inserts into the membrane, as indicated by studies with synthetic peptides of these helices (9). Helix cross-linking studies of the Cry1Aa1 toxin indicate the importance of this region of domain I in toxicity (23). Studies of mutants with single proline substitutions in helix 4 or 3 of the Cry4Ba1 toxin also suggested the importance of helix 4 in toxicity (25).

Single substitutions for 6 of the 10 residues encoded by the mutagenic oligonucleotide were identified, 4 within the hydrophobic face and 2 within the hydrophilic face of the amphipathic helix (Fig. 5). Among the former, only one in five mutations (Q₁₃₃R) resulted in the loss of toxicity. Interestingly, the Q₁₃₃H mutant was fully toxic, as were the other endotoxins with mutations in this region, which were largely hydrophobic-to-hydrophobic changes. It was also interesting that F₁₃₄L was about threefold more toxic than the wild type. Five mutations (affecting only two residues) in the hydrophilic face resulted in the loss of toxicity. One, R₁₃₁L, involved the loss of a charge; the other four were relatively conserved changes of I₁₃₂. None of the nontoxic mutants was affected in terms of binding to the receptor. It appears that I₁₃₂, which is a hydrophobic residue within the hydrophilic face of the helix, and Q₁₃₃, which is within the hydrophobic face, have critical functions in the properties of the ion channel. Since the F₁₃₄L mutant showed a toxicity increase versus the wild type for two different insects, further studies are under way to characterize this mutant and to study the effect of other mutations of this residue.

View larger version (22K): [in this window] [in a new window]   FIG. 5.   Helical wheel of 18 residues in helix 4, including the 10 mutagenized residues (E129 to N138). Mutations which resulted in the loss of toxicity (including one double mutant) are indicated by solid arrows. Changes with no resultant loss of toxicity are indicated by dashed arrows. The asterisk indicates an increase in toxicity. Parentheses indicate double mutations. The hydrophobic and hydrophilic faces are demarcated by the internal lines.

None of six mutations among four residues either at the carboxyl end of helix 4 or within the loop connecting helices 4 and 5 resulted in the loss of toxicity (Table 2). Some of these changes were relatively conserved, but others involved the substitution of a charged residue (I₁₄₅D or V₁₅₀D) or replacement of a large residue (F₁₄₈I). Following toxin insertion into the membrane, this loop could be close to the cytoplasmic side of the membrane or might even project into the cytoplasm. It was conceivable, therefore, that there was a specific interaction of this loop with a cytoplasmic component which was important for toxicity. If there were such an interaction, it is not likely that A149 and V150 would be involved.

Site-directed mutagenesis of two N residues in helix 3 was undertaken to enhance the hydrophobic properties of this helix, since a synthetic peptide of helix 3 bound very poorly to phospholipid vesicles (9). Residues N₉₄ and N₁₀₅ are surface exposed (14), so the mutations should have increased the hydrophobicity of this helix and, thus, its affinity for BBMV. Since there was no change in toxicity for any of the four mutants (Table 2), binding studies were not done. It appears that the surface properties of this helix are not critical for toxicity. An unexpected result was the ability of the nontoxic helix 4 mutants to insert into BBMV and oligomerize as well as the wild-type toxin (Fig. 3). It should be noted, however, that the relative rates of insertion were not determined. An inactive helix 5 mutant toxin, A₁₆₄P, did not remain bound to the membrane, nor did other nontoxic helix 5 mutant toxins (4), although they all bound to a 120-kDa protein from BBMV in immunoblots (as in Fig. 2). All helix 5 mutant toxins which retained toxicity, except for H₁₆₈R, did oligomerize (4).

Some very large (>200-kDa) toxin oligomers have been found in purified Cry1Ac1 and other toxins, and this capacity to aggregate may be important for toxin insertion into the membrane after binding to the receptor (11). There is some aggregation of purified Cry1Ac1, but not Cry1Ab3, toxin in solution, but in both cases the formation of ca. 200-kDa oligomers was enhanced by incubating purified toxin with BBMV (4). In addition, this oligomer is not a complex of a toxin molecule and the 120-kDa aminopeptidase N receptor (15), since antibody to the latter did not react with this oligomer (4). While interaction with other membrane components has not been ruled out, the formation of a toxin trimer is likely. The lower 130-kDa band could represent toxin dimers.

Helix 5 seems to be very important for oligomerization, perhaps among its other functions in toxicity. In contrast, mutations within helix 4 did not affect the capacity of the toxin to oligomerize in BBMV, despite the lack of permeability to ions in light scattering experiments. A different role for this helix, most likely in the function of the ion channel, is indicated. It was recently reported that a nontoxic helix 4 mutant toxin (N₁₃₅Q) of Cry1Ac1 was altered in a second phase of binding, as measured in a BIOCORE biosensor instrument with aminopeptidase N anchored in synthetic phospholipid (6). The inability to form an irreversible association implied a lack of membrane penetration by this helix 4 mutant, in contrast to the results with other helix 4 mutants reported here. The difference in results may be due to the specific mutation or, more likely, the use of BBMV, rather than synthetic phospholipids, in the present experiments.