This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jia, Y.
Right arrow Articles by Churchward, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jia, Y.
Right arrow Articles by Churchward, G.

 Previous Article  |  Next Article 

Journal of Bacteriology, October 1999, p. 6114-6123, Vol. 181, No. 19
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.

Interactions of the Integrase Protein of the Conjugative Transposon Tn916 with Its Specific DNA Binding Sites

Yunhua Jia and Gordon Churchward*

Department of Microbiology and Immunology, Emory University, Atlanta, Georgia 30322

Received 13 January 1999/Accepted 28 July 1999


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

The binding of two chimeric proteins, consisting of the N-terminal or C-terminal DNA binding domain of Tn916 Int fused to maltose binding protein, to specific oligonucleotide substrates was analyzed by gel mobility shift assay. The chimeric protein with the N-terminal domain formed two complexes of different electrophoretic mobilities. The faster-moving complex, whose formation displayed no cooperativity, contained two protein monomers bound to a single DNA molecule. The slower-moving complex, whose formation involved cooperative binding (Hill coefficient > 1.0), contained four protein monomers bound to a single DNA molecule. Methylation interference experiments coupled with the analysis of protein binding to mutant oligonucleotide substrates showed that formation of the faster-moving complex containing two protein monomers required the presence of two 11-bp direct repeats (called DR2) in direct orientation. Formation of the slower-moving complex required only a single DR2 repeat. Binding of the N-terminal domains in vivo could serve to position two Int monomers on the DNA near each end of the transposon and assist in bringing together the ends of the transposon so that excision can occur. The chimeric protein with the C-terminal domain of Int also formed two complexes of different electrophoretic mobilities. The major, slower-moving complex, whose formation involved cooperative binding, contained two protein molecules bound to one DNA molecule. This finding suggested that while the C-terminal domain of Int can bind DNA as a monomer, a cooperative interaction between two monomers of the C-terminal domain may help to bring the ends of the transposon together during excision.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Tn916 (15-17) and its close relative Tn1545 (12) were first isolated from Enterococcus faecalis and Streptococcus pneumoniae, respectively. Tn916 encodes resistance to tetracycline, and Tn1545 encodes resistance to both tetracycline and erythromycin. They are representatives of a large group of conjugative transposons, which are mobile elements that during transposition transfer themselves from donor to recipient bacteria. In some cases, conjugation can occur between bacteria belonging to different species and genera (10, 44, 46). Most conjugative transposons encode antibiotic resistance, frequently the tetM determinant encoding resistance to tetracycline, which is expressed in an extremely wide range of bacteria.

Unlike the case for most bacterial transposons, integration of Tn916 does not cause a duplication of the target sequence (9). Instead, a 6-bp sequence flanking the transposon in the donor bacterium is found at the end of the transposon in the recipient (7, 9, 42). Excision of the transposon either restores the original target sequence or results in replacement of 6 bp of the target sequence by the 6 bp brought in with the transposon. The 6 bp flanking the transposon at each end are referred to as coupling sequences (7).

During excision of Tn916, staggered cleavages occur at the ends of the coupling sequences and a circular form of the transposon is produced (7, 47). This circular DNA contains a 6-bp heteroduplex between the ends of the transposon that consists of one strand from each coupling sequence flanking the transposon in the donor (7, 31). The circular form of the transposon then transfers to the recipient bacterium, using an origin of conjugal transfer that is distinct from the transposon ends (21). Genetic evidence indicates that only a single strand of the circular transposon is transferred during conjugation (45). Subsequently, integration of Tn916 can occur at different sites in the recipient genome (45, 47).

Two transposon-encoded proteins, Int and Xis, whose genes are located at the left end of the transposon (15, 37, 49), play a role in transposon excision and conjugative transposition (4, 22, 38, 48). Int is a member of the integrase family of site-specific recombinases (2, 14, 28), and is a bivalent sequence-specific DNA binding protein (30). As shown in Fig. 1, the N-terminal DNA binding domain of Int recognizes and protects from nuclease digestion two regions of approximately 50 bp located 150 bp from the left and 90 bp from the right end of Tn916 (30). The Int-protected region at the left end (DR23) contains three copies of a repeated sequence called direct repeat 2 (DR2) (6, 9). Two copies are in direct orientation, and one copy is in indirect orientation. The protected region at the right end (DR22) contains two copies of DR2 in direct orientation. The structure of the N-terminal domain of Int, both alone and complexed with an oligonucleotide containing a single DR2, has been determined by nuclear magnetic resonance spectroscopy (11, 52). The N-terminal domain contains a three-stranded beta -sheet which is structurally similar to protein domains that bind double-stranded RNA. A single N-terminal domain binds to a single DR2. The C-terminal domain of Int binds to the ends of Tn916 and flanking bacterial DNA (CL and CR) and protects approximately 50 nucleotides from nuclease cleavage (30). Like other integrase family members, Int cleaves the DNA to leave 5' protruding hydroxyl groups and remains covalently attached by a phosphotyrosine linkage to the 3' side of the cleavage site (50).


View larger version (4K):
[in this window]
[in a new window]
 
FIG. 1.   Relative orientation of DNA binding sites for Tn916 Int and Xis proteins. The thick line represents transposon DNA, thin lines represent flanking bacterial DNA, diamonds represent the region of DNA protected from nuclease cleavage by the C-terminal domain of Int (Int-C), closed triangles represent DR2 elements bound by the N-terminal domain of Int (Int-N), and the open triangles represent the region of DNA protected from nuclease cleavage by Xis. The short labeled lines show the oligonucleotides used in this study.

Xis is a small, basic sequence-specific DNA binding protein that binds near each end of Tn916 (Fig. 1), close to the DR2-containing sequences that are protected from nuclease cleavage by the N-terminal DNA binding domain of Int (43). Nuclease protection experiments using high concentrations of Xis, reveal a pattern of cleavages with a regular periodicity that extends away from the specific binding sites as though the DNA substrate is wrapped around a core of Xis molecules (43). In excision reactions in vitro using purified Int and Xis proteins, Xis, at concentrations required to produce these periodic patterns of nuclease cleavage, stimulates excision in low (37.5 mM) NaCl concentrations and is required for excision at higher (150 mM) concentrations of NaCl (41).

The DNA binding of Tn916 Int and Xis is similar to the binding of phage lambda Int and Xis (20, 33, 39, 40, 53). Lambda Int is also bivalent (33), and the N-terminal binding domain binds to two arm-type sites, P1 and P2, in the left arm of the phage and to a region containing three adjacent arm-type sites, P'1, P'2, and P'3, in the right arm of the phage (20, 33, 39). These arm-type sites are analogous to the DR2 motifs in Tn916 and are similar in size. The C-terminal domain of lambda Int binds and protects from nuclease cleavage core-type sites at the ends of the phage and, when it is integrated into the bacterial chromosome, in flanking bacterial DNA (33, 40). Unlike Tn916 Xis, lambda Xis binds to only one end of the phage (5, 53). A dimer of Xis binds cooperatively to two adjacent sites in the left arm of the phage. During excision, the accessory proteins Xis, integration host factor, and Fis bend the DNA (51). This permits a single Int molecule to bind an arm-type and a core-type site at the same end of the phage, while a second Int molecule interacts with an arm-type site at one end of the phage and a core-type site at the other end of the phage, bringing together the two ends of the phage so that recombination can occur (24, 25, 53). In addition to its architectural role in excision, lambda Xis modulates the binding of lambda Int and integration host factor, with important consequences for the regulation of recombination (32).

To understand how transposon-encoded proteins function in Tn916 transposition, we have therefore first examined in detail how the DNA binding domains of Int bind to their specific sites on the DNA. Our results confirm that a monomer of the N-terminal domain of Int interacts with a single DR2 and show that two or four Int monomers bind to directly repeated DR2 sequences close to each end of the transposon. A single monomer of the C-terminal domain of Int can interact with the end of the transposon or flanking bacterial DNA, but cooperative interactions between protein monomers lead to the formation of complexes containing two C-terminal domains at each end of the transposon. These results suggest a model for how Int interacts with DNA during Tn916 recombination.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Proteins and DNA. Maltose binding protein (MBP) fused to a protein consisting of amino acids 3 to 78 of Int (Int3-78) and MBP-Int82-403 were expressed in Escherichia coli and purified by chromatography on amylose as described previously (30). DNA substrates were made by annealing pairs of oligonucleotides as follows: DR22    5' AGCTCATTCATAAGTAGTAAATTAGTAGTAAATTGAGTGGTTTTGACCTTGAT 5' ACTTTATCAAGGTCAAAACCACTCAATTTACTACTAATTTACTACTTATGAAT DR22M1   5' AGCTCATTCATACTGCTGCCCGGAGTAGTAAATTGAGTGGTTTTGACCTTGATA 5' ACTTTATCAAGGTCAAAACCACTCAATTTACTACTCCGGGCAGCAGTATGAATG DR22M2   5' AGCTCATTCATAAGTAGTAAATTCTGCTGCCCGGGAGTGGTTTTGACCTTGAT 5' ACTTTATCAAGGTCAAAACCACTCCCGGGCAGCAGAATTTACTACTTATGAA DR23    5' TAGCTGTCAGAAGTGGTAAATAAGTAGTAAATTCATTTGTACTACTAAGCAA 5' CTTGTTGCTTAGTAGTACAAATGAATTTACTACTTATTTACCACTTCTGAC DR23M3   5' TAGCTGTCAGAAGTGGTAAATAAGTAGTAAATTACGGGTGCAGCAGAAGCA 5' CTTGTTGCTTCTGCTGCACCCGTAATTTACTACTTATTTACCACTTCTGAC DR23M1   5' TAGCTGTCAGACTGTTGCCCGCAGTAGTAAATTCATTTGTACTACTAAGCA 5' CTTGTTGCTTAGTAGTACAAATGAATTTACTACTGCGGGCAACAGTCTGAC DR23M2   5' TAGCTGTCAGAAGTGGTAAATACTGCTGCCCGGCATTTGTACTACTAAGCA 5' CTTGTTGCTTAGTAGTACAAATGCCGGGCAGCAGTATTTACCACTTCTGAC CL   5' ACTTATGAAGAAAAAAATGATTTTAATAATAAACAAAGTATAAATTTCTA 5' AATTAGAAATTTATACTTTGTTAATTATTAAAATCATTTTTTTCTTCAT CR    5' ACTAGATTTTTATGCTATTTTTTAAAATAAAAAAGGAAATGTTGGAAA 5' TTCTTTTCCAACATTTCCTTTTTTATTTTAAAAAATAGCATAAAAATC

DR2 sequences are underlined, inversely repeated DR2 sequences present in DR23 are in plain boldface, and changes in oligonucleotides used to construct mutant DNA substrates are in italicized boldface. After annealing, the oligonucleotides were labeled at one end by using the Klenow fragment of DNA polymerase I and a single alpha -32P-labeled deoxynucleoside triphosphate.

Electrophoretic mobility shift assays. Radiolabeled DNA substrates at a concentration of 10 pM were incubated in the presence of increasing concentrations of proteins at room temperature for 20 min in either 10 mM Tris-Cl (pH 7.5) containing 100 mM KCl, 10 mM MgCl2, 0.1 mM EDTA, 1 mM beta -mercaptoethanol, and 0.1% NP40 (DR2 and DR3 oligonucleotides) or 50 mM Tris-Cl (pH 7.5) containing 37.5 mM NaCl, 10 mM MgCl2, and 1 mM EDTA (CL and CR oligonucleotides). For competition assays, radiolabeled DNA was mixed with different concentrations of competitor DNA prior to the addition of protein. In experiments to determine if protein-DNA complexes contain more than one DNA molecule, two DNA substrates of different lengths, each at 10 pM, were used. Either one or both substrates were radiolabeled. Short DNA substrates were the DR22, DR23, CL, and CR oligonucleotides. Long DNA substrates were fragments cloned from Tn1545del4 (37) and flanking bacterial DNA as described elsewhere (30). After incubation, samples were subjected to electrophoresis on a 6% polyacrylamide gel. The gels were exposed to a phosphorimager screen, and the amount of DNA bound was quantitated with a Molecular Dynamics PhosphorImager.

Stoichiometry of protein-DNA complexes. The ratio of protein to DNA was determined by using radiolabeled protein and DNA of known specific activities (18, 27). 32P-labeled DNA was prepared by labeling annealed oligonucleotides with the Klenow fragment of DNA polymerase I. DNA concentrations were determined by measuring the optical density at 260 nm and calculating the molar extinction coefficient of oligonucleotides from their nucleotide composition. The specific activity of DNA substrates was adjusted by mixing labeled and unlabeled DNA so that it was less than one-fifth that of the protein to reduce errors from spillover corrections during scintillation counting. 3H-labeled protein was prepared by labeling cultures of bacteria with [3H]lysine as described elsewhere (27). Labeled protein was purified by chromatography on amylose resin. The concentration of protein was determined by quantitative analysis of dabsyl chloride-derivatized amino acids separated by microbore reverse-phase high-pressure liquid chromatography (HPLC) (8) on a LUNA C18(2) column, using phenylalanine as the reference amino acid. The specific activities of DNA substrates and proteins were determined by subjecting known amounts in triplicate to electrophoresis on 6% polyacrylamide gels. Radioactive slices containing DNA or protein were excised and dissolved in 21% (vol/vol) HClO4-17% (vol/vol) H2O2 at 60°C, and the amount of radioactivity in each slice was determined by scintillation counting. The specific activities were 1.25 × 104 (DR22), 1.14 × 104 (DR23), 1.50 × 104 (CL), 1.66 × 104 (CR), 1.79 × 105 MBP-Int3-78), and 2.07 × 105 (MBP-Int82-403) cpm/pmol. Protein and DNA were mixed and allowed to form complexes, which were separated by electrophoresis on 6% polyacrylamide gels. Gel slices containing the complexes were excised and dissolved, and the amount of radioactive protein and DNA in each complex was determined by scintillation counting.

Methylation interference. A 0.2-pmol aliquot of radiolabeled DNA was methylated with 1 µl of dimethylsulfate (DMS) in a 200-µl reaction and then purified by ethanol precipitation. The DNA was then incubated with protein and subjected to gel electrophoresis. Unbound DNA and protein-DNA complexes were eluted from the gel, extracted with phenol-chloroform (1:1), and precipitated with ethanol. The pellets were suspended in 20 µl of water to which 2 µl of 1 M NaOH was added, and the DNA was incubated at 95°C for 30 min. The cleavage reaction was stopped by ethanol precipitation, and the cleavage products were analyzed by electrophoresis on a 20% denaturing polyacrylamide gel.


    RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Interaction of the N-terminal domain of Int with the DR2-containing region from the right end of Tn916. Using either native Int or a chimeric protein consisting of Int fused to MBP, we have been unable to identify complexes formed between Int and Tn916 DNA in electrophoretic mobility shift assays. Under all the conditions that we tested, aggregates formed which did not enter the gels. We therefore used a chimeric protein, MBP-Int3-78, consisting of the N-terminal DNA binding domain of Int fused to MBP. This protein binds specifically and protects from nuclease digestion a region of approximately 50 bp close to the right end of Tn916 that contains two copies of DR2 in direct orientation. As shown in Fig. 2A, incubation of increasing amounts of MBP-Int3-78 with an end-labeled, double-stranded oligonucleotide (DR22) consisting of the protected region containing DR2 repeats leads to the formation of a faster-moving complex (complex I) and subsequently a slower-moving complex (complex II). To determine if these complexes represented specific binding of MBP-Int3-78 to the DR22 oligonucleotide, we performed competition-binding experiments. An excess of unlabeled DR22 oligonucleotide or an unrelated oligonucleotide was mixed with the radiolabeled DR22 oligonucleotide prior to the addition of MBP-Int3-78. As shown in Fig. 2B, excess unlabeled DR22 oligonucleotide inhibited formation of both complexes I and II, while the nonspecific competitor had no effect, indicating that both complexes were formed by specific binding of MBP-Int3-78 to the DR22 oligonucleotide. When a 375 bp fragment (B011) containing the DR2 repeats, transposon end, and flanking bacterial DNA from pUC18::Tn1545del4 (30, 37) was used as the DNA substrate, two complexes similar to those observed with the DR22 oligonucleotide substrate were formed (Fig. 2C).


View larger version (62K):
[in this window]
[in a new window]
 
FIG. 2.   Binding of MBP-Int3-78 to oligonucleotide DR22. (A) Gel mobility shift assay showing binding of increasing concentrations of MBP-Int3-78 to radiolabeled DR22 (10 pM). Lane 1, no protein; lanes 2 to 10, twofold increases in MBP-Int3-78 beginning with 6.3 nM; lane 11, as lane 10 but with radiolabeled DR23 DNA instead of DR22 DNA. The arrows labeled I and II indicate the positions of complexes I and II, respectively. (B) Gel mobility shift assay showing competition for binding of MBP-Int3-78 to radiolabeled DR22 (10 pM) by specific and nonspecific competitor DNA. Lane 1, no competitor; lanes 2 to 5, increasing amounts of unlabeled DR22 (101-, 102-, 103-, and 104-fold excess); lanes 6 to 9, increasing amounts of nonspecific oligonucleotide competitor (101-, 102-, 103-, and 104-fold excess). The arrows labeled I and II indicate the positions of complexes, I and II, respectively. (C) Gel mobility shift assay showing binding of increasing concentrations of MBP-Int3-78 to radiolabeled B011 (20 pM). Lane 1, no protein; lanes 2 to 7, twofold increases in MBP-Int3-78 beginning with 6.3 nM. The arrows labeled I and II indicate the positions of complexes, I and II, respectively. (D) Gel mobility shift assay showing binding of MBP-Int3-78 to mutant and wild-type DR22 DNA (10 pM). Lanes 1 to 6, radiolabeled DR22M1 DNA lacking one DR2 element; lanes 7 to 12, radiolabeled DR22 DNA. Lanes 1 and 7, no protein; lanes 2 to 6 and 8 to 12, increasing amounts of MBP-Int3-78 beginning with 6.3 nM. The arrows labeled I and II indicate the positions of complexes I and II, respectively.

To estimate the number of MBP-Int3-78 and DNA molecules involved in the formation of each complex, we determined the ratio of protein to DNA in each complex, using 32P-labeled DNA and 3H-labeled protein of known specific activities (18, 27). Complex I contained 1.9 ± 0.4 protein molecules per DNA molecule, and complex II contained 4.0 ± 0.2 protein molecules per DNA molecule.

The complexes formed between MBP-Int3-78 and the DR22 oligonucleotide could have contained two or more DNA molecules. To rule out this possibility, two DNA molecules of different lengths were incubated with MBP-Int3-78. One molecule was the DR22 oligonucleotide, and the second was the 375-bp fragment (B011) used in the experiment shown in Fig. 2C (30). As shown in Fig. 3A, in an assay using 24 nM MBP-Int3-78, the major complex observed with both radiolabeled DR22 DNA (lanes 1 and 2) and with radiolabeled B011 DNA (lanes 3 and 4) corresponded to complex I shown in Fig. 2A and C. When equal amounts of radiolabeled DR22 DNA and unlabeled B011 DNA (lane 5), unlabeled DR22 DNA and radiolabeled B011 DNA (lane 6), and radiolabeled DR22 DNA and radiolabeled B011 DNA (lane 7) were used in the binding assay, we observed no new bands that were not present in the reactions containing a single DNA substrate. If complex I contained more than one DNA molecule, new complexes containing DNA molecules of different lengths should be found in those reactions containing two DNA substrates. In addition, titration of increasing amounts of unlabeled B011 DNA into reactions containing radiolabeled DR22 resulted in competition for binding of MBP-Int3-78, but no new complexes were observed (data not shown). Therefore, we conclude from these data and the stoichiometry measurements described above that complex I formed between MBP-Int3-78 and DR22 DNA shown in Fig. 2A contains two protein molecules bound to a single DNA molecule.


View larger version (59K):
[in this window]
[in a new window]
 
FIG. 3.   Binding of MBP-Int3-78 and MBP-Int82-403 to pairs of DNA substrates of different length. (A) Gel mobility shift assay showing binding of MBP-Int3-78 (24 pM) to radiolabeled DR22 or B011 DNA. Lane 1, radiolabeled DR22 DNA; lane 2, radiolabeled DR22 DNA plus MBP-Int3-78; lane 3, radiolabeled B011 DNA; lane 4, radiolabeled B011 DNA plus MBP-Int3-78; lane 5, radiolabeled DR22 DNA, unlabeled B011 DNA, and MBP-Int3-78; lane 6, radiolabeled B011 DNA, unlabeled DR22 DNA, and MBP-Int3-78; lane 7, radiolabeled DR22 and B011 DNA plus MBP-Int3-78. (B) As in panel A but with 750 nM MBP-Int3-78. (C) Gel mobility shift assay showing binding of MBP-Int3-78 (24 pM) to radiolabeled DR23 or B001 DNA. Lane 1, radiolabeled DR23 DNA; lane 2, radiolabeled DR23 DNA plus MBP-Int3-78; lane 3, radiolabeled B001 DNA; lane 4, radiolabeled B001 DNA plus MBP-Int3-78; lane 5, radiolabeled DR23 DNA, unlabeled B001 DNA, and MBP-Int3-78; lane 6, radiolabeled B001 DNA, unlabeled DR23 DNA and MBP-Int3-78. Lane 7, radiolabeled DR23 and B001 DNA plus MBP-Int3-78. (D) As in panel A but with 750 nM MBP-Int3-78. (E) Gel mobility shift assay showing binding of MBP-Int82-403 (24 pM) to radiolabeled CL or B001 DNA. Lane 1, radiolabeled CL DNA; lane 2, radiolabeled CL DNA plus MBP-Int82-403; lane 3, radiolabeled B001 DNA; lane 4, radiolabeled B001 DNA plus MBP-Int82-403; lane 5, radiolabeled CL DNA, unlabeled B001 DNA, and MBP-Int82-403; lane 6, radiolabeled B001 DNA, unlabeled CL DNA, and MBP-Int82-403; lane 7, radiolabeled CL and B001 DNA plus MBP-Int82-403. (F) Gel mobility shift assay showing binding of MBP-Int82-403 (24 pM) to radiolabeled CR or B011 DNA. Lane 1, radiolabeled CR DNA; lane 2, radiolabeled CR DNA plus MBP-Int82-403; lane 3, radiolabeled B011 DNA; lane 4, radiolabeled B011 DNA plus MBP-Int82-403; lane 5, radiolabeled CR DNA, unlabeled B011 DNA, and MBP-Int82-403; lane 6, radiolabeled B011 DNA, unlabeled CR DNA, and MBP-Int82-403; lane 7, radiolabeled CR and B011 DNA plus MBP-Int82-403.

An experiment similar to that shown in Fig. 3A was carried out at a higher concentration of MBP-Int3-78 (750 nM) to determine if complex II shown in Fig. 2A contained more than one DNA molecule (Fig. 3B). As with complex I, no new bands corresponding to complexes containing DNA molecules of different lengths were observed (compare lanes 2 and 4 with lanes 5, 6, and 7). We conclude that complex II shown in Fig. 2A contains four molecules of MBP-Int3-78 bound to a single DNA molecule.

To identify nucleotides within the MBP-Int3-78 protected region that are involved in the formation of complexes I and II, we performed methylation interference analysis. Radiolabeled DR22 DNA was incubated with DMS and then, after removal of the DMS, with MBP-Int3-78. Complex I and complex II were separated by gel electrophoresis; then the DNA from each complex was recovered and subjected to cleavage under conditions where both modified G and A residues are attacked. Figure 4A shows methylated DR22 DNA (lane 3), unbound DNA (lanes 4 and 7), and DNA extracted from complex I (lane 5) and complex II (lane 6). Comparison of lanes 3 (methylated DNA) with lanes 4 and 7 (unbound) and lane 5 (complex I) shows an absence of cleavage product at four positions in lane 5 and enhanced cleavage in the corresponding positions in lanes 4 and 7. These positions correspond to four G residues, two in each DR2 motif. PhosphorImager analysis showed that cleavage was reduced to background levels at these positions in DNA extracted from complex I. A reduction in cleavage at a specific nucleotide in DNA extracted from a protein-DNA complex compared to methylated DNA with a corresponding enhancement in unbound DNA implies that methylation of that nucleotide prevents formation of the complex, and that an interaction involving the nucleotide is required for the formation of the complex. Therefore, it appears that in order to form complex I, MBP-Int3-78 must interact with all four G residues in both DR2 motifs.


View larger version (107K):
[in this window]
[in a new window]
 
FIG. 4.   Methylation interference in binding of MBP-Int3-78 to radiolabeled DR22 DNA (A) and radiolabeled DR23 DNA (B). (A) Lane 1, A + G; lane 2, C + T; lane 3, DMS-treated methylated DNA; lane 4, unbound DNA; lane 5, DNA extracted from complex I; lane 6, DNA extracted from complex II; lane 7, unbound DNA. (B) Lane 1, A + G; lane 2, C + T; lane 3, DMS-treated methylated DNA; lane 4, unbound DNA; lane 5, DNA extracted from complex I; lane 6, unbound DNA; lane 7, DNA extracted from complex II. Vertical arrows on the left of each panel show DR-2 repeats. Horizontal arrows on the right of each panel show cleavage at G residues within directly oriented DR-2 repeats. The asterisk shows cleavage at a G residue present in the third inversely oriented DR-2 repeat of DR23.

Comparison of lanes 3 and 6 of Fig. 4A shows that in DNA extracted from complex II, cleavage is suppressed at the same four G residues as in DNA extracted from complex I. However, phosphorimager analysis showed that cleavage at these positions in the DNA extracted from complex II was reduced approximately 50% compared to unaffected bases, in contrast to the complete suppression of cleavage observed at these positions in the DNA extracted from complex I.

The estimates of stoichiometry of complexes I and II and the methylation interference analysis suggested that the two complexes might be formed in different ways. The observation that all four G residues in both DR2 motifs were apparently required to form complex I, which contained a dimer of MBP-Int3-78, suggested that complex I resulted from two monomers of Int each contacting a single DR2 and that interactions with both repeats were required for formation of the complex. If true, then this would suggest that the 50% reduction in cleavage at these same residues observed in DNA extracted from complex II could mean that complex II required interactions between MBP-Int3-78 and one or other of the DR2 repeats rather than with both repeats. These models imply that complex I is not simply a precursor of complex II and predict that if one DR2 is destroyed, formation of complex I should be abolished, while formation of complex II is unaffected.

To test these models for the formation of complexes I and II, we synthesized derivatives of the DR22 oligonucleotide where one or other DR2 was destroyed by making transversion mutations at each position within the repeat. Increasing amounts of MBP-Int3-78 were incubated with wild-type and mutant DR2 oligonucleotide lacking one DR2. As shown in Fig. 2D, alteration of one DR2 abolished the formation of complex I. The formation of complex II was still observed, though at somewhat reduced levels. The same results were obtained when the other repeat was destroyed (data not shown). Mutating both repeats abolished the formation of complex II.

These results are consistent with the predictions of the models for the formation of complexes I and II but do not address whether a dimer or tetramer of MBP-Int3-78 forms in solution prior to binding or if the binding of MBP-Int3-78 to DR22 involves cooperative interactions between protein monomers in the case of complex I and dimers in the case of complex II. We therefore used a Hill plot to analyze the data from the experiment shown in Fig. 2A. The maximum slope of the Hill plot for the formation of complex I was 0.8, and that for complex II was 2.0. A value of 1.0 indicates no cooperativity in binding, while a value of >1.0 suggests positive cooperativity in binding (13). Therefore these results suggest that binding of MBP-Int3-78 to form complex I was not cooperative, and therefore most likely resulted from binding of a protein dimer already formed in solution, while binding of MBP-Int3-78 to form complex II resulted from the cooperative interaction during binding of two protein dimers.

Interaction of the N-terminal domain of Int with the DR2-containing region at the left end of Tn916. Increasing amounts of MBP-Int3-78 were incubated with a radiolabeled double-stranded oligonucleotide DR23 containing the DR2 region from the left end of the transposon. As shown in Fig. 5A, similar to the situation observed at the right end of the transposon, a faster-moving complex (complex I) formed at lower concentrations of MBP-Int3-78, while a second, slower-moving complex (complex II) appeared at higher concentrations of MBP-Int3-78. Comparison of lanes 2 to 10 with lane 11 in Fig. 2A and lanes 2 to 9 with lane 10 in Fig. 5A shows that the electrophoretic mobilities of complexes formed between MBP-Int3-78 and DR23 were similar to those formed between MBP-Int3-78 and DR22 from the right end of Tn916. To determine if complexes I and II formed between MBP-Int3-78 and DR23 were specific, increasing amounts of unlabeled DR23 or an unrelated oligonucleotide were mixed with radiolabeled DR23 prior to the addition of MBP-Int3-78. As shown in Fig. 5B, unlabeled DR23 DNA competed for binding with MBP-Int3-78 whereas the nonspecific competitor DNA did not, indicating that both complexes were the result of specific binding of MBP-Int3-78 to DR23. Two complexes were also observed when MBP-Int3-78 was incubated with a 250-bp fragment (B001) containing the DR2 elements, transposon end and flanking bacterial DNA from pUC18::Tn1545del4 (30, 37) (Fig. 5C).


View larger version (51K):
[in this window]
[in a new window]
 
FIG. 5.   Binding of MBP-Int3-78 to oligonucleotide DR23. (A) Gel mobility shift assay showing binding of increasing concentrations of MBP-Int3-78 to radiolabeled DR23 (10 pM). Lane 1, no protein; lanes 2 to 9, twofold increases in MBP-Int3-78 beginning with 6.3 nM; lane 10, as lane 9 but with radiolabeled DR22 DNA instead of DR23 DNA. The arrows labeled I and II indicate the positions of complexes I and II, respectively. (B) Gel mobility shift assay showing competition for binding of MBP-Int3-78 to radiolabeled DR23 (10 pM) by specific and nonspecific competitor DNA. Lane 1, no competitor; lanes 2 to 5, increasing amounts of unlabeled DR23 (101-, 102-, 103-, and 104-fold excess); lanes 6 to 9, increasing amounts of nonspecific oligonucleotide competitor (101-, 102-, 103-, and 104-fold excess). The arrows labeled I and II indicate the positions of complexes I and II, respectively. (C) Gel mobility shift assay showing binding of increasing concentrations of MBP-Int3-78 to radiolabeled B001 DNA (20 pM). Lane 1, no protein; lanes 2 to 7, twofold increases in MBP-Int3-78 beginning with 6.3 nM. The arrows labeled I and II indicate the positions of complexes I and II, respectively. (D) Gel mobility shift assay showing binding of MBP-Int3-78 to wild-type and mutant DR23 DNA (10 pM). Lanes 1 to 7, radiolabeled DR23 DNA; lanes 8 to 14, radiolabeled DR23M3 DNA; lanes 1 and 8, no protein; lanes 2 to 7 and 9 to 14, increasing amounts of MBP-Int3-78 beginning with 6.3 nM. The arrows labeled I and II indicate the positions of complexes I and II, respectively. (E) Gel mobility shift assay showing binding of MBP-Int3-78 to wild-type and mutant DR23 DNA (10 pM). Lanes 1 to 6, radiolabeled DR23 DNA; lanes 7 to 12, radiolabeled DR23M1 DNA; lanes 1 and 7, no protein. Lanes 2 to 6 and 8 to 12, increasing amounts of MBP-Int3-78 beginning with 6.3 nM. The arrows labeled I and II indicate the positions of complexes I and II, respectively.

Interpretation of these results obtained with the DR23 oligonucleotide are more complicated than those for DR22 because unlike the right end of the transposon, which contains only two DR2 elements, the region in the left end of Tn916 that is protected by Int from nuclease cleavage contains three (Fig. 1). Two repeats are present in direct orientation, while the third is present in inverted orientation. To determine if the third repeat played a role in the formation of the two complexes observed between MBP-Int3-78 and DR23, we synthe sized a derivative of DR23 where the third repeat was destroyed by transversion mutations. As shown in Fig. 5D, destruction of the third repeat had little effect on the formation of complex I. Complex II was detectable in reduced amounts at protein concentrations similar to those required to form complex II with a wild-type DNA substrate. We therefore concluded that the third repeat was not required for the formation of either complex. This conclusion was supported by methylation interference experiments described below.

We determined the stoichiometry of the two complexes formed between MBP-Int3-78 and DR23 in the same way as described for the complexes formed between MBP-Int3-78 and the DR2 repeats from the right end of the transposon. Complex I contained 2.5 ± 0.5 protein molecules per DNA molecule, and complex II contained 3.8 ± 0.2 protein molecules per DNA molecule.

To rule out the possibility that the two complexes formed between MBP-Int3-78 and DR23 DNA contained more than a single DNA molecule, binding experiments using two different DNA substrates of different lengths were performed. As shown in Fig. 3C, comparison of lanes 2 and 4 with lanes 5, 6, and 7 shows that when mixtures of DR23 and the 250-bp fragment (B001) used in the experiment shown in Fig. 5C were used with 24 nM MBP-Int3-78, no additional complexes were detected in reactions containing mixtures of fragments compared to those observed with a single DNA fragment. In addition, no new complexes were observed when increasing amounts of the longer B001 fragment were titrated into reactions containing DR23 DNA (data not shown). Similar results, shown in Fig. 3D, were obtained at a higher MBP-Int3-78 concentration where complex II was visible. We therefore conclude that complex I and complex II formed between DR23 DNA and MBP-Int3-78 contain one DNA molecule and two or four protein molecules, respectively.

To determine if formation of the complexes observed between MBP-Int3-78 and DR23 was similar to the formation of complexes between MBP-Int3-78 and DR22, we performed methylation interference analysis. Comparison of lanes 3 and 5 in Fig. 4B shows that cleavage at five G residues in the two directly oriented DR2 repeats of DR23 was suppressed to background levels in DNA extracted from complex I. This indicated that formation of complex I required interactions between MBP-Int3-78 and both repeats. Comparison of lanes 3 and 7 in Fig. 4B shows that cleavage at the same five residues was reduced but not abolished in DNA extracted from complex II. This indicated that formation of complex II involved an interaction between MBP-Int3-78 and one or other of the DR2 motifs. In DNA extracted from both complexes, there was no suppression of cleavage at a G residue in the third, inversely oriented repeat although some enhancement of cleavage could be observed in unbound DNA, supporting the conclusion that this repeat was not required for the formation of either complex.

To confirm the conclusions drawn from the methylation interference experiments, we constructed mutant derivatives of DR23 lacking one or other of the directly oriented DR2 elements. As shown in Fig. 5E, removal of one directly oriented repeat inhibited formation of complex I but not of complex II. The same result was observed when the other repeat was removed.

Hill plot analysis of the data shown in Fig. 5A showed no apparent cooperativity in the formation complex I (slope 1.0) but that formation of complex II did involve cooperative binding (slope 1.6). We therefore conclude that these complexes between MBP-Int3-78 and DR23 form similarly to those observed between MBP-Int3-78 and DR22. At each end of Tn916, a dimer of Int interacts with two DR2 repeats in direct orientation to form a specific complex. Nucleotides in both repeats are required for the formation of this complex. At higher concentrations of MBP-Int3-78, two dimers of Int can bind to the DR2 elements, but in this case, nucleotides in only one of the repeats are required for formation of the complex.

Interaction between the C-terminal domain of Int and sequences at left and right ends of Tn916. The C-terminal domain of Int binds and protects from nuclease cleavage the ends of Tn916 and flanking bacterial DNA. We therefore synthesized two double-stranded oligonucleotides, CL and CR, containing the protected regions from the left and right ends of the transposon respectively. Incubation of increasing amounts of MBP-Int82-403 containing the C-terminal domain of Int fused to MBP with either CL or CR resulted in the formation of a transient, faster-moving complex, complex I, which rapidly disappeared as the concentration of protein increased. A slower-moving complex, complex II, accumulated (Fig. 6A and C). To determine if these complexes represented specific binding of MBP-Int82-403 to CL and CR, competition binding experiments were carried out by mixing radiolabeled CL or CR DNA with either unlabeled CL or CR DNA as specific competitor, or an unrelated oligonucleotide of similar size as nonspecific competitor. In both cases, as shown in Fig. 6B and D, the specific competitor competed for binding of MBP-Int82-403 while the nonspecific competitor showed no effect indicating that binding was specific.


View larger version (77K):
[in this window]
[in a new window]
 
FIG. 6.   Binding of MBP-Int82-403 to oligonucleotides CL and CR. (A) Gel mobility shift assay showing binding of increasing concentrations of MBP-Int82-403 to radiolabeled CL (10 pM). Lane 1, no protein; lanes 2 to 9, two fold increases in MBP-Int82-403 beginning with 6.3 nM. The arrows labeled I and II indicate the positions of complexes I and II, respectively. (B) Gel mobility shift assay showing competition for binding of MBP-Int82-403 to radiolabeled CL (10 pM) by specific and nonspecific competitor DNA. Lane 1, no competitor; lanes 3 to 6, increasing amounts of unlabeled CL (101-, 102-, 103-, and 104-fold excess); lanes 7 to 10, increasing amounts of nonspecific oligonucleotide competitor (101-, 102-, 103-, and 104-fold excess). The arrows labeled I and II indicate the positions of complexes I and II respectively. (C) Gel mobility shift assay showing binding of increasing concentrations of MBP-Int82-403 to radiolabeled CR (10 pM). Lane 1, no protein; lanes 2 to 11, two fold increases in MBP-Int82-403 beginning with 6.3 nM. The arrows labeled I and II indicate the positions of complexes I and II, respectively. (D) Gel mobility shift assay showing competition for binding of MBP-Int82-403 to radiolabeled CR (10 pM) by specific and nonspecific competitor DNA. Lane 1, no competitor; lanes 2 to 5, increasing amounts of unlabeled CR (101-, 102-, 103-, and 104-fold excess); lanes 6 to 9, increasing amounts of nonspecific oligonucleotide competitor (101-, 102-, 103-, and 104-fold excess). The arrows labeled I and II indicate the positions of complexes I and II respectively.

The stoichiometry of the predominant complexes (complex II) formed between MBP-Int82-403 and CL and CR was determined. The complex formed with CL contained 2.0 ± 0.1 protein molecules per DNA molecule and the complex formed with CR contained 1.9 ± 0.1 protein molecules per DNA molecule. Binding experiments using DNA substrates of different lengths showed no evidence that the complexes contained more than a single DNA fragment (Fig. 4E and F). Thus, we conclude that complex II formed between CL or CR and MBP-Int82-403 contains one DNA molecule and two protein monomers, while complex I most likely contains one DNA molecule bound to a single protein monomer. Hill plot analysis of the data for the formation of complex II in Fig. 6A and B yielded slopes of 1.8 and 1.5, respectively, indicating some degree of cooperativity during the formation of complex II. This conclusion was supported by the analysis of complexes formed between MBP-Int82-403 and derivatives of the CL and CR oligonucleotides where the end of the transposon was mutated. With both mutated substrates, complex I and complex II were visible, but a greater proportion of the DNA remained in complex I (data not shown). As discussed below, cooperative interactions between monomeric C-terminal binding domains of Int could provide a mechanism for bringing together the two ends of the transposon during excision.


    DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

We have investigated the interaction between chimeric proteins containing the N- and C-terminal DNA binding domains of Tn916 Int with their specific DNA binding sites. Both chimeric proteins form two complexes, one with greater electrophoretic mobility that forms at lower protein concentrations (complex I) and one with reduced electrophoretic mobility that forms at higher protein concentrations (complex II). For the N-terminal domain of Int, complex I contains two protein molecules bound to one DNA molecule, while complex II contains four protein molecules. For the C-terminal domain of Int, complex II contains two protein molecules bound to one DNA molecule.

For the N-terminal domain of Int, a protein dimer binds to DR2 to form complex I. This binding displays no cooperativity and presumably requires an interaction between each protein monomer and a single DR2. Binding only occurs to two DR2 elements in direct orientation. If one or other repeat is altered, complex I does not form. At higher protein concentrations, a cooperative interaction indicates that two protein dimers form complex II. This binding requires only a single DR2. For the C-terminal domain of Int, a single protein monomer can bind DNA to form complex I, but a cooperative interaction between two protein monomers leads to the formation of the predominant complex II.

Our results are consistent with recent nuclear magnetic resonance analysis of the structure of a complex formed between a peptide consisting of amino acids 1 to 74 of Int and a 14-bp oligonucleotide containing a single DR2 (11, 52). This analysis shows that a monomer of the peptide binds the oligonucleotide and this binding involves hydrogen bonding between the peptide and the G residues shown in our methylation interference experiments to be required for binding of MBP-Int3-78. However, our results show that in contrast to the peptide, MBP-Int3-78 can bind to two DR2 repeats only as a dimer. We have never observed the formation of a complex of greater electrophoretic mobility than complex I, which would be expected if a monomer of MBP-Int3-78 bound the DR22 or DR23 oligonucleotide. Furthermore, our experiments with mutant derivatives of DR22 and DR23 and our methylation interference experiments suggest that two DR2 elements are required for the formation of complex I.

One explanation for this discrepancy between the behavior of the N-terminal peptide and MBP-Int3-78 is that the chimeric protein is a dimer in solution. However, this does not explain why the peptide can bind a single DR2 while the chimeric protein can bind only to a DNA substrate containing two DR2 elements. One possibility is that the mutations that we have made in one of the two repeats so perturb the interaction between the DNA substrate and one monomer of MBP-Int3-78 that the second monomer of the protein dimer is unable to interact correctly with the wild-type DR2. Alternatively, the presence of the MBP portion of the chimeric protein may perturb the structure of the N-terminal Int domain so that it is unable to make all the protein-DNA contacts observed for the peptide, and a stable complex can be formed only between two protein molecules and two repeats.

Our results suggest a model for the interaction between Tn916 Int and DNA during excision and integration of the transposon. We suppose that in vivo a dimer of Int binds the DR2 repeats close to the ends of the transposon. The C-terminal domains of this Int dimer could each contact the end of the transposon and flanking DNA adjacent to the DR2 repeats , as shown in Fig. 7A, resulting in a small DNA loop at each end of the transposon. However, our observations that a tetramer of the N-terminal domain of Int can form a complex with DR2 elements whereas cooperative interactions occur between C-terminal domains and DNA at the end of the transposon raise a second possibility shown in Fig. 7B. The C-terminal domains of Int monomers bound to DR2 elements at different ends of the transposon could bind the transposon end and flanking DNA, while interactions occur between the N-terminal domains bound close to each end of the transposon. This would provide a mechanism to hold the transposon ends together during recombination. The complex shown in Fig. 7B could arise in two ways. Dimers of Int could bind the DR2 elements close to each end of the transposon and then exchange C-terminal domains of the bound Int molecules to bring the ends of the transposon together. Alternatively, the C-terminal domains of Int monomers could bind the ends of the transposon and then exchange N-terminal domains to bring the transposon ends together. Currently both pathways seem equally likely since both domains of Int have similar apparent affinities for their specific binding sites, and both pathways postulate an exchange of protein domains.


View larger version (19K):
[in this window]
[in a new window]
 
FIG. 7.   Models for the interaction of Tn916 Int with DNA prior to transposon excision. (A) Two Int monomers bound to DR2 elements interact with the adjacent transposon end. The thick line represents transposon DNA, thin lines represent flanking bacterial DNA; closed diamonds represent the region of DNA protected from nuclease cleavage by the C-terminal domain of Int (Int-C), closed triangles represent DR2 elements bound by the N-terminal domain of Int (Int-N), open triangles represent the region of DNA protected from nuclease cleavage by Xis, small circles represent the N-terminal domain of Int, and large circles represent the C-terminal domain. Possible interactions between N-terminal domains of Int are indicated by arrows. (B) One Int monomer of a pair of Int molecules bound to DR2 elements interacts with the adjacent transposon end, while the second member of the pair interacts with the distant transposon end. Symbols are as in panel A except that the dashed lines indicate interactions between the N-terminal domains of Int bound to DR2 elements close to each transposon end.

Possible interactions between dimeric N-terminal domains of Int bound to each transposon end are shown in Fig. 7. Obviously such interactions could also contribute to bringing the transposon ends together during excision, and the possibility of such interactions is suggested by our observation that the N-terminal domain of Int can make a tetrameric complex with DNA substrates containing two DR2 elements. However, one would expect that such interactions would involve four N-terminal Int domains bound to two DNA molecules. As shown in Fig. 3, we have not observed the formation of such complexes, and so the possibility of such interactions occurring is questionable. We favor the idea that only four Int monomers rather than eight are involved in formation of the excision complex because it is well established that for other members of the integrase family of site-specific recombinases, only four protein monomers are required for recombination to occur (1, 3, 19, 29, 35, 40).

The arrangement of DR2 repeats in Tn916 is similar to that of the arm-type binding sites in phage lambda that are recognized by the N-terminal domain of lambda Int (46). These arm-type sites are similar in length to the DR2 elements of Tn916. At the left end of lambda, there are three arm-type-binding sites, all in direct orientation, while at the right end of the phage there are two arm-type binding sites in inverted orientation. The three sites at the left end of the phage and the two sites at the right end of the phage lie within segments of DNA that are protected from nuclease cleavage by lambda Int. At the right end of lambda, lambda Int binds the P1 site at low concentrations; then, as the concentration of protein increases, Int binds to the P2 site as well (39).

Since lambda Int is a monomer in solution (23, 26), these results show that a monomer of lambda Int can bind a single arm-type site. In contrast, we have found that at low concentrations, the chimeric protein MBP-Int3-78 can bind only as a dimer to two DR2 elements. We have observed no evidence that at low protein concentrations the N-terminal domain of a monomer of MBP-Int3-78 can bind a single DR2 repeat.

The notion that Tn916 Int may interact with both ends of the transposon is supported by observations made with lambda Int (24, 25). During excision of lambda, one molecule of Int binds to the P2 site in attR with its N-terminal domain and a core-type site in attL with its C-terminal domain. A second molecule binds to the P2' site of attL with its N-terminal domain and to a core-type site in attR with its C-terminal domain. Thus, in the formation of a nucleoprotein complex that includes both ends of the prophage and four Int molecules, two of the Int molecules hold the ends of the phage together. However, the formation of this tetrameric complex of lambda Int with attL and attR appears to differ from that proposed here for Tn916. The binding affinity of the C-terminal domain of lambda Int protein is much weaker than that of the N-terminal domain (34), and so the protein relies on interactions between the N-terminal domain and arm-type binding sites to direct binding of the C-terminal domain. However, given the monomeric nature of Int in solution, it seems most likely that these interactions involve the binding of Int monomers. At least one lambda Int molecule binds DNA as a monomer because one Int monomer is apparently recruited into the tetrameric complex from solution (24).

Our results suggest that the third DR2 element at the left end of the transposon which is present in inverted orientation compared with the two directly repeated DR2 sequences is not required for binding of Int. However, it may be that in vivo this inverted DR2 sequence is involved in Tn916 transposition. There are examples of proteins that can bind to either direct repeats or inverted repeats. In particular, the cytR repressor of E. coli can bind DNA substrates with both direct and inverted repeats, and the spacing of the repeats can be different in the presence and absence of the catabolite gene activator protein, presumably due to DNA bending induced by this protein (36). This remarkable ability to bind different DNA sequences is attributed to the presence of a flexible segment in the CytR protein, permitting the DNA binding domains of a CytR dimer to adopt different configurations. Our results do not rule out the possibility that intact Tn916 Int, in the presence of accessory proteins such as Xis, can also adopt different DNA binding configurations during excision and integration.

The identification of specific nucleotides important in Int binding achieved in the methylation interference experiments described here will allow us to construct and characterize mutant derivatives of Tn916. This will enable us to test the model of Int binding during excision and integration of Tn916 that we have presented and allow us to determine if different DNA binding configurations of Int are important in conjugative transposition.


    ACKNOWLEDGMENTS

This work was supported by grants GM50376 from the National Institutes of Health and MCB9876427 from the National Science Foundation and by a grant from the Emory University School of Medicine. We are grateful to the Wilson Foundation for funds to purchase the microbore/capillary HPLC system.

We are grateful to Jan Pohl and the Microchemical Facility of Emory University for performing the quantitative amino acid analysis.


    FOOTNOTES

* Corresponding author. Mailing address: Department of Microbiology and Immunology, Emory University, Atlanta, GA 30322. Phone: (404) 727-2538. Fax: (404) 727-3659. E-mail: ggchurc{at}microbio.emory.edu.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Arciszewska, L. K., and D. J. Sherratt. 1995. Xer site-specific recombination in vitro. EMBO J. 14:2112-2120[Medline].
2. Argos, P., A. Landy, K. Abremski, J. B. Egan, E. Haggard-Ljungquist, R. H. Hoess, M. J. Kahn, W. Kalionis, S. V. L. Narayana, L. S. Pierson, N. Sternberg, and J. M. Leong. 1986. The integrase family of site-specific recombinases: regional similarity and global diversity. EMBO J. 5:433-440[Medline].
3. Blakely, G., G. May, R. McCulloch, L. K. Arciszewska, M. Burke, S. Lovett, and D. J. Sherratt. 1993. Two related recombinases are required for site-specific recombination at dif and cer in E. coli K12. Cell 75:351-361[Medline].
4. Bringel, F. G., G. L. Van Alstine, and J. R. Scott. 1992. Conjugative transposition of Tn916: the transposon int gene is required only in the donor. J. Bacteriol. 174:4036-4041[Abstract/Free Full Text].
5. Bushman, W., S. Yin, L. L. Thio, and A. Landy. 1984. Determinants of directionality in lambda site-specific recombination. Cell 39:699-706[Medline].
6. Caillaud, F., and P. Courvalin. 1987. Nucleotide sequence of the ends of the conjugative shuttle transposon Tn1545. Mol. Gen. Genet. 209:110-115[Medline].
7. Caparon, M. G., and J. R. Scott. 1989. Excision and insertion of the conjugative transposon Tn916 involves a novel recombination mechanism. Cell 59:1027-1034[Medline].
8. Chang, J.-Y., R. Knecht, and D. G. Braun. 1983. Amino acid analysis in the picomole range by precolumn derivatization and high performance liquid chromatography. Methods Enzymol. 91:41-49[Medline].
9. Clewell, D. B., S. E. Flannagan, Y. Ike, J. M. Jones, and C. Gawron-Burke. 1988. Sequence analysis of termini of conjugative transposon Tn916. J. Bacteriol. 170:3046-3052[Abstract/Free Full Text].
10. Clewell, D. B., S. E. Flannagan, and D. D. Jaworski. 1995. Unconstrained bacterial promiscuity: the Tn916-Tn1545 family of conjugative transposons. Trends Microbiol. 3:229-236[Medline].
11. Connolly, K. M., J. M. Wojciak, and R. T. Clubb. 1998. Site-specific DNA binding using a variation of the double stranded RNA binding motif. Nat. Struct. Biol. 7:546-550.
12. Courvalin, P., and C. Carlier. 1986. Transposable multiple antibiotic resistance in Streptococcus pneumoniae. Mol. Gen. Genet. 205:291-297[Medline].
13. Dahlquist, F. W. 1978. The meaning of Scatchard and Hill plots. Methods Enzymol. 48:270-299[Medline].
14. Esposito, D., and J. J. Scocca. 1997. The integrase family of tyrosine recombinases: evolution of a conserved active site domain. Nucleic Acids Res. 25:3605-3614[Abstract/Free Full Text].
15. Flannagan, S. E., L. A. Zitzow, Y. A. Su, and D. B. Clewell. 1994. Nucleotide sequence of the 18-kb conjugative transposon Tn916 from Enterococcus faecalis. Plasmid 32:350-354[Medline].
16. Franke, A. E., and D. B. Clewell. 1981. Evidence for a chromosome-borne resistance transposon (Tn916) in Streptococcus faecalis that is capable of conjugative transfer in the absence of a conjugative plasmid. J. Bacteriol. 145:494-502[Abstract/Free Full Text].
17. Gawron-Burke, C., and D. B. Clewell. 1982. A transposon in Streptococcus faecalis with fertility properties. Nature 300:281-284[Medline].
18. Greenstein, D., and K. Horiuchi. 1990. Replication enhancer-independent mutation increases the co-operativity with which an initiator protein binds its origin. J. Mol. Biol. 211:91-101[Medline].
19. Han, Y. W., R. I. Gumport, and J. F. Gardner. 1993. Complementation of bacteriophage lambda integrase mutants: evidence for an intersubunit active site. EMBO J. 12:4677-4684[Medline].
20. Hsu, P., W. Ross, and A. Landy. 1980. The lambda phage att site: functional limits and interaction with Int protein. Nature 285:85-91[Medline].
21. Jaworski, D. D., and D. B. Clewell. 1995. A functional origin of transfer (oriT) on the conjugative transposon Tn916. J. Bacteriol. 177:6644-6651[Abstract/Free Full Text].
22. Jaworski, D. D., S. E. Flannagan, and D. B. Clewell. 1996. Analyses of traA, int-Tn, and xis-Tn mutations in the conjugative transposon Tn916 in Enterococcus faecalis. Plasmid 36:201-208[Medline].
23. Kikuchi, Y., and H. Nash. 1978. The bacteriophage lambda int gene product. J. Biol. Chem. 253:7149-7157[Abstract/Free Full Text].
24. Kim, S., and A. Landy. 1992. Lambda Int protein bridges between higher order complexes at two distant chromosomal loci attL and attR. Science 256:198-203[Abstract/Free Full Text].
25. Kim, S., L. Moitoso de Vargas, S. E. Nunes-Duby, and A. Landy. 1990. Mapping of a higher order protein-DNA complex: two kinds of long range interaction in lambda attL. Cell 63:773-781[Medline].
26. Kotewicz, M., E. Grzesiuk, W. Courschesne, R. Fischer, and H. Echols. 1980. Purification and characterization of the integration protein specified by bacteriophage lambda. J. Biol. Chem. 255:2433-2439[Free Full Text].
27. Kuo, C.-F., A. Zou, M. Jayaram, E. Getzoff, and R. M. Harshey. 1991. DNA-protein complexes during attachment-site synapsis in Mu transposition. EMBO J. 10:1585-1589[Medline].
28. Kwon, H. J., R. Tirumalai, A. Landy, and T. Ellenberger. 1997. Flexibility in DNA recombination: structure of the lambda integrase catalytic core. Science 276:126-131[Abstract/Free Full Text].
29. Lee, J., I. Whang, and M. Jayaram. 1994. Directed protein replacement in recombination full sites reveals trans-horizontal DNA cleavage by Flp recombinase. EMBO J. 13:5346-5354[Medline].
30. Lu, F., and G. Churchward. 1994. Conjugative transposition: Tn916 integrase contains two independent DNA binding domains that recognize different DNA sequences. EMBO J. 13:1541-1548[Medline].
31. Manganelli, R., S. Ricci, and G. Pozzi. 1996. Conjugative transposon Tn916: evidence for excision with formation of 5'-protruding termini. J. Bacteriol. 178:5813-5816[Abstract/Free Full Text].
32. Moitoso de Vargas, L., and A. Landy. 1991. A switch in the formation of alternative DNA loops modulates lambda site-specific recombination. Proc. Natl. Acad. Sci. USA 88:588-592[Abstract/Free Full Text].
33. Moitoso de Vargas, L., C. A. Pargellis, N. M. Hasan, E. W. Bushman, and A. Landy. 1988. Autonomous DNA binding domains of lambda integrase recognize two different sequence families. Cell 54:923-929[Medline].
34. Moitoso de Vargas, L., C. A. Pargellis, N. M. Hasan, E. W. Bushman, and A. Landy. 1988. Autonomous DNA binding domains of lambda integrase recognize two different sequence families. Cell 54:923-929.
35. Nunes-Düby, S. E., R. S. Tirumalai, L. Dorgai, E. Yagil, R. A. Weisberg, and A. Landy. 1994. Lambda integrase cleaves DNA in cis. EMBO J. 13:4421-4430[Medline].
36. Pedersen, H., and P. Valentin-Hansen. 1997. Protein-induced fit: the CRP activator protein changes sequence-specific DNA recognition by the CytR repressor, a highly flexible LacI member. EMBO J. 16:2108-2118[Medline].
37. Poyart-Salmeron, C., P. Trieu-Cuot, C. Carlier, and P. Courvalin. 1989. Molecular characterization of two proteins involved in the excision of the conjugative transposon Tn1545: homologies with other site-specific recombinases. EMBO J. 8:2425-2433[Medline].
38. Poyart-Salmeron, C., P. Trieu-Cuot, C. Carlier, and P. Courvalin. 1990. The integration-excision system of the conjugative transposon Tn1545 is structurally and functionally related to those of the lambdoid phages. Mol. Microbiol. 4:1513-1521[Medline].
39. Ross, W., and A. Landy. 1982. Bacteriophage lambda Int protein recognizes two classes of sequence in the phage att site: characterization of arm-type sites. Proc. Natl. Acad. Sci. USA 79:7724-7728[Abstract/Free Full Text].
40. Ross, W., and A. Landy. 1983. Patterns of lambda int recognition in the regions of strand exchange. Cell 33:261-272[Medline].
41. Rudy, C., K. L. Taylor, D. Hinerfeld, J. R. Scott, and G. Churchward. 1997. Excision of a conjugative transposon in vitro by the Int and Xis proteins of Tn916. Nucleic Acids Res. 25:4061-4066[Abstract/Free Full Text].
42. Rudy, C. K., and J. R. Scott. 1996. Length of the coupling sequence of Tn916. J. Bacteriol. 176:3386-3388[Abstract/Free Full Text].
43. Rudy, C. K., J. R. Scott, and G. Churchward. 1997. DNA binding by the Xis protein of the conjugative transposon Tn916. J. Bacteriol. 179:2567-2572[Abstract/Free Full Text].
44. Scott, J. R. 1993. Conjugative transposons, p. 597-614. In A. L. Sonenshein, J. A. Hoch, and R. Losick (ed.), Bacillus subtilis and other gram-positive bacteria. American Society for Microbiology, Washington, D.C..
45. Scott, J. R., F. Bringel, D. Marra, G. Van Alstine, and C. K. Rudy. 1994. Conjugative transposition of Tn916: preferred targets and evidence for conjugative transfer of a single strand and for a double-stranded circular intermediate. Mol. Microbiol. 11:1099-1108[Medline].
46. Scott, J. R., and G. G. Churchward. 1995. Conjugative transposition. Annu. Rev. Microbiol. 49:367-397[Medline].
47. Scott, J. R., P. A. Kirchman, and M. G. Caparon. 1988. An intermediate in the transposition of the conjugative transposon Tn916. Proc. Natl. Acad. Sci. USA 85:4809-4813[Abstract/Free Full Text].
48. Senghas, E., J. M. Jones, M. Yamamoto, C. Gawron-Burke, and D. B. Clewell. 1988. Genetic organization of the bacterial conjugative transposon Tn916. J. Bacteriol. 170:245-249[Abstract/Free Full Text].
49. Su, Y. A., and D. B. Clewell. 1993. Characterization of the left 4 kb of conjugative transposon Tn916: determinants involved in excision. Plasmid 30:234-250[Medline].
50. Taylor, K., and G. Churchward. 1997. Specific DNA cleavage mediated by the integrase of conjugative transposon Tn916. J. Bacteriol. 179:1117-1125[Abstract/Free Full Text].
51. Thompson, J. F., L. M. de Vargas, C. Koch, R. Kahmann, and A. Landy. 1987. Cellular growth factors couple recombination with growth phase: characterization of a new component in the lambda site-specific recombination pathway. Cell 50:901-908[Medline].
52. Wojciak, J. M., K. M. Connolly, and R. T. Clubb. 1999. Solution structure of the Tn916 integrase-DNA complex: specific binding using a three-strand beta-sheet. Nat. Struct. Biol. 6:366-373[Medline].
53. Yin, S., W. Bushman, and A. Landy. 1985. Interaction of the lambda site-specific recombination protein Xis with attachment site DNA. Proc. Natl. Acad. Sci. USA 82:1040-1044[Abstract/Free Full Text].


Journal of Bacteriology, October 1999, p. 6114-6123, Vol. 181, No. 19
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Song, B., Shoemaker, N. B., Gardner, J. F., Salyers, A. A. (2007). Integration Site Selection by the Bacteroides Conjugative Transposon CTnBST. J. Bacteriol. 189: 6594-6601 [Abstract] [Full Text]  
  • Rice, L. B., Carias, L. L., Hutton-Thomas, R., Rudin, S. (2007). Interaction of Related Tn916-Like Transposons: Analysis of Excision Events Promoted by Tn916 and Tn5386 Integrases. J. Bacteriol. 189: 3909-3917 [Abstract] [Full Text]  
  • Rice, L. B., Carias, L. L., Marshall, S., Rudin, S. D., Hutton-Thomas, R. (2005). Tn5386, a Novel Tn916-Like Mobile Element in Enterococcus faecium D344R That Interacts with Tn916 To Yield a Large Genomic Deletion. J. Bacteriol. 187: 6668-6677 [Abstract] [Full Text]  
  • Hinerfeld, D., Churchward, G. (2001). Specific Binding of Integrase to the Origin of Transfer (oriT) of the Conjugative Transposon Tn916. J. Bacteriol. 183: 2947-2951 [Abstract] [Full Text]  
  • Cheng, Q., Paszkiet, B. J., Shoemaker, N. B., Gardner, J. F., Salyers, A. A. (2000). Integration and Excision of a Bacteroides Conjugative Transposon, CTnDOT. J. Bacteriol. 182: 4035-4043 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jia, Y.
Right arrow Articles by Churchward, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jia, Y.
Right arrow Articles by Churchward, G.