Department of Biological Sciences, University
of Maryland Baltimore County, Baltimore, Maryland
21250,1 and Department of Biology,
University of Rochester, Rochester, New York 146272
We investigated the regulation of the S10 ribosomal protein
(r-protein) operon among members of the gamma subdivision of the proteobacteria, which includes Escherichia coli. In
E. coli, this 11-gene operon is autogenously controlled by
r-protein L4. This regulation requires specific determinants within the
untranslated leader of the mRNA. Secondary structure analysis of the
S10 leaders of five enterobacteria (Salmonella typhimurium,
Citrobacter freundii, Yersinia enterocolitica,
Serratia marcescens, and Morganella morganii) and two nonenteric members of the gamma subdivision (Haemophilus influenzae and Vibrio cholerae) shows that these
foreign leaders share significant structural homology with the E. coli leader, particularly in the region which is critical for
L4-mediated autogenous control in E. coli. Moreover, these
heterologous leaders produce a regulatory response to L4 oversynthesis
in E. coli. Our results suggest that an E. coli-like L4-mediated regulatory mechanism may operate in all of
these species. However, the mechanism is not universally conserved
among the gamma subdivision members, since at least one,
Pseudomonas aeruginosa, does not contain the required S10
leader features, and its leader cannot provide the signals for
regulation by L4 in E. coli. We speculate that L4-mediated autogenous control developed during the evolution of the gamma branch
of proteobacteria.
 |
INTRODUCTION |
All organisms have evolved
mechanisms to regulate ribosome synthesis so that rapidly dividing
cells dedicate a larger fraction of their mass and energy to
manufacturing ribosomes than do more slowly growing cells. This
optimization of metabolism has been particularly well studied in the
bacterium Escherichia coli. Regulation of rRNA synthesis
depends, at least in part, on an unusual sensitivity of rRNA
transcription initiation to the nucleoside triphosphate concentration
(9), which increases with growth rate (2). Ribosomal protein (r-protein) synthesis is regulated, in turn, in
response to the availability of nascent rRNA molecules. Most r-protein
operons contain a gene whose product functions not only as an r-protein
but also as a repressor of the expression of the operon (see reference
46 for a review). When r-protein production exceeds
rRNA synthesis, free regulatory r-proteins accumulate and each
represses expression of its own operon, usually by inhibiting translation of the r-protein mRNA. This autogenous control mechanism is
believed to coordinate the production of rRNA and r-protein and to
balance the expression of individual r-protein operons (46)
(although additional mechanisms also contribute to regulating r-protein
production [22, 46]).
The 11-gene S10 operon of E. coli is autogenously regulated
by r-protein L4, encoded by the third gene of the operon (Fig. 1A). Unlike other regulatory r-proteins,
L4 inhibits not only translation but also transcription. Regulation of
transcription is accomplished by L4-mediated termination (attenuation)
within the S10 leader, about 140 bases from the start of transcription (Fig. 1B). This process requires the RNA polymerase accessory factor
NusA and two hairpins in the nascent leader transcript (35, 36,
47, 51). One of these hairpins is also required for L4-mediated
repression of translation, although distinguishable attributes of the
leader RNA are required for the two levels of regulation (7,
34).

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 1.
Maps of the S10 operon and plasmids used for regulatory
studies. (A) Organization of genes in the E. coli S10
operon. (B) Region of the S10 operon amplified by PCR. The site of
L4-mediated termination (att) is indicated by the arrowhead. Positions
of the primers L1 and L2 are indicated by hatched bars. Open boxes on
the primer bars indicate recognition sites for EcoRI (E) and
HindIII (H) introduced during the amplification
reaction. (C and D). General structures of L4 target and L4 source
plasmids. Leader-S10'/lacZ' or leader-lacZ genes
driven by E. coli PS10 were introduced into
cells carrying an IPTG-inducible Plac-L4 plasmid
(C). Leader-S10'/lacZ' or leader-lacZ genes
driven by the IPTG-inducible Ptrc were
introduced into cells carrying an arabinose-inducible
Para-L4 plasmid (D). SD-S10 and
SD-lacZ refer to the Shine-Dalgarno sequences for the S10
and lacZ structural genes, respectively.
|
|
While the molecular mechanisms of autogenous control of r-protein
synthesis have been studied extensively in E. coli,
knowledge of the control of r-protein synthesis in other organisms
remains comparatively sparse. The general organization of r-protein
genes is highly conserved. For example, in systems as diverse as
gram-positive and gram-negative eubacteria, cyanobacteria, thermophilic
eubacteria, archaea, protist cyanelles, chloroplasts, and mitochondria,
clusters of r-protein genes corresponding to the S10, spc,
and alpha operons of E. coli are strikingly similar
(16, 42, 43). Nevertheless, the regulatory circuits
identified in E. coli are not universal for all bacteria,
since the positions of promoters and transcription terminators are not
well conserved. For example, in E. coli, the 28 genes in the
S10-spc-alpha region are organized into three consecutive
transcription units (21, 27-29, 38). In contrast, the
corresponding genes in Bacillus subtilis appear to be
organized into a single transcription unit (15, 19, 38).
Also, genes encoding r-proteins identified as regulators in E. coli are sometimes dissociated in other organisms from some or all
of the r-protein genes that they regulate in E. coli. For
example, the gene encoding r-protein S4, the autogenous regulator of
the alpha operon in E. coli, maps outside the
S10-spc-alpha cluster of B. subtilis (10,
14) and regulates only its own synthesis in this organism (11). Thus, while r-protein gene order in the
S10-spc-alpha region is highly conserved, the molecular
mechanisms for regulation of these genes are clearly more diverse.
To learn more about the evolution of regulatory mechanisms governing
r-protein synthesis, we have focused on the regulation of the genes
corresponding to the S10 operon of E. coli. Our earlier experiments suggested that in B. subtilis this gene cluster
is regulated by a mechanism different from the E. coli-like
L4-mediated control (19). To extend these studies, we
inspected the S10 operons in a variety of eubacterial species within
the gamma subdivision of the proteobacteria, which includes E. coli. Since the target for L4-mediated autogenous control is
contained within the untranslated leader of the E. coli
operon (7, 35, 48), we concentrated on this region. Our
studies suggest that specific features of the S10 leader structure that
are essential for L4-mediated autogenous control in E. coli
are conserved in several, but not all, branches of the gamma
subdivision, including all of the enterobacteria that we investigated.
Moreover, our regulatory studies confirm that foreign leaders
containing these features are sensitive to L4-mediated control in
E. coli. We speculate that the conservation of these
features reflects a conservation of L4-mediated autogenous control and
therefore that this regulatory mechanism developed during the evolution
of the gamma branch of the proteobacteria.
 |
MATERIALS AND METHODS |
Strains, plasmids, and other materials.
The E. coli strain was LL308 (23). Salmonella
typhimurium, Citrobacter freundii, Yersinia
enterocolitica, Morganella morganii, and
Pseudomonas aeruginosa were obtained from the School of
Medicine, University of Rochester. We obtained S. typhimurium LT2 and Serratia marcescens from the
American Type Culture Collection and S. typhimurium MS1868
from M. Suskind via R. Wolf. Haemophilus influenzae was a
gift from G. J. Barcak. Vibrio cholerae was from
J. B. Kaper.
Plasmids pLF1 (8), pLF17 (8), pLL235
(20), pSma2R (48), pLL202 (8), pLL226
(48, 51), pLL229 (48), pACYC-Bsu (19),
and pAra-L4 (19) have all been described previously. The
pBAD-L4 plasmids are analogous to pAra-L4 but are derived from pBAD18
(12).
Restriction enzymes were purchased from New England Biolabs or Promega.
Taq DNA polymerase was from Perkin-Elmer/Cetus, Fisher Biotech, or Promega. Vent DNA polymerase was purchased from New England
Biolabs. Reagents and enzymes used for sequencing reactions were
purchased from U.S. Biochemical.
Cloning and sequencing of PCR-amplified DNA.
Chromosomal DNA
was prepared according to standard procedures. PCRs to amplify the S10
leader regions were performed under standard reaction conditions. For
genomes for which we had no a priori S10 operon sequence
information (S. typhimurium, C. freundii, Y. enterocolitica, and M. morganii), the upstream
oligonucleotide was L1
(TTGAATTCCTAGCAATACGCTTGCGTTCGGTGGTTAAGTATGTATA ATG);
the underlined sequence corresponds to the
35/
10 region of the
E. coli S10 operon (Fig. 1B). The downstream oligonucleotide
was L2 (CGAAGCTTTCCGCGGTTGCTTGATCGA), corresponding to the
E. coli S10 structural gene (Fig. 1B). Amplified DNA was
purified by cutting the band from a low-melting-point agarose gel and
passing it through an Elutip column (Schleicher & Schuell) or a Wizard
PCR Prep DNA purification system (Promega). The purified DNA was
digested with the indicated restriction enzymes, cloned into M13mp18,
and sequenced (33). For S. marcescens, the 5'
oligonucleotide, O175 (CGTACTACTGACGTGACTGG), was derived
from the upstream tufA gene, and the downstream
oligonucleotide was O243 (GCGCTTGGCAGTCTCGACGAT), from the
S10 gene. The amplified DNA was sequenced directly. In all cases, two
to five independent clones or PCR products were sequenced.
For in vivo regulatory studies, heterologous leader/S10' sequences were
inserted into pLL202 (8), containing a partial lacZ gene (lacking the first eight codons). The resulting
constructs consisted of the E. coli S10 promoter
(PS10), heterologous leader, and proximal 54 codons of the
S10 gene, fused in frame with lacZ' (Fig. 1C). To analyze
only transcriptional control, heterologous leader sequences (without
the S10 gene) were inserted upstream of the intact lacZ gene
in pLL229 (48) (Fig. 1C). In later experiments, the
heterologous leader/S10' sequences were cloned downstream of the
Ptrc promoter by replacing the B. subtilis S10 leader/S10' fragment in pACYC-Bsu
(19; Fig. 1D). For in vitro transcription studies,
the E. coli leader in plasmid pLL226 (48, 51) was
replaced with the heterologous leader.
Computer analysis.
DNA sequence alignments were determined
by first using a multiple-sequence alignment program such as CLUSTAL W
(39) and then manually aligning the sequences to obtain
maximum identity. The RNA secondary structures were predicted by using
Zuker's MFOLD program on the mfold server (55), using the
energy rules described by Walter et al. (41). Searches for
S10 genes in other bacteria were performed by using BLAST 2.0 (1) on the NCBI BLAST server (27). The
phylogenetic tree was constructed by using the Ribosome Database
Project server (24, 31).
Labeling and gel electrophoresis of proteins.
E. coli
cells were grown at 37°C in AB minimal medium (3)
supplemented with 0.5% glycerol, 1 µg of thiamine per ml, and the
appropriate antibiotics. For experiments with cells carrying a
Plac-L4 plasmid and a PS10-foreign
leader-S10'/lacZ' or lacZ plasmid, cells were
labeled for 2 min with 50 µCi of [35S]methionine (ca.
1,000 Ci/mmol) per ml immediately before or 10 min after addition of
isopropyl-
-D-thiogalactopyranoside (IPTG) to induce L4
oversynthesis and then lysed at 95°C in sodium dodecyl sulfate (SDS)
sample buffer (17). For cells carrying both pAra-L4 and a
Ptrc-foreign leader-S10'/lacZ' or
lacZ plasmid, the synthesis of S10'/
-galactosidase
(
-Gal') or
-Gal was first induced by addition of IPTG (to 2 mM).
Immediately before and 15 to 20 min after addition of IPTG, aliquots of
the culture were pulse-labeled and harvested by lysing at 95°C in SDS
sample buffer (17). Synthesis of L4 protein was then induced
by addition of arabinose (to 0.25%), and 10 to 15 min later aliquots
were pulse-labeled and harvested. The total extracts were fractionated
by gel electrophoresis on an SDS-7.5% or 12% (wt/vol) polyacrylamide
gel (17) and visualized by autoradiography. The 12% gel
resolves small proteins like L4 (22 kDa) and allowed us to confirm that
the synthesis of L4 was increased following arabinose induction; based
on earlier studies, we estimate that L4 synthesis was induced at least
threefold (52). The 7.5% gel provides better resolution of
the S10'/
-Gal' fusion protein. The radioactivity in the
S10'/lacZ' protein band was quantified by using a Molecular
Dynamics PhosphorImager. To control for variable loadings, the
radioactivity in S10'/
-Gal' was normalized to the radioactivity in a
protein band whose intensity was not affected by IPTG or arabinose addition.
S. typhimurium MS1868 was grown and pulse-labeled as for
E. coli except that the growth medium included 19 amino
acids (no methionine). The source of L4 was plasmid pLL235
(Plac-L4) (20), and the target
plasmid was pLF1 (PS10-E. coli S10
leader-S10'/lacZ') (8, 45) or pSma2R
(PS10-E. coli S10 leader-lacZ)
(48).
In vitro transcription reactions.
Standard 10-µl
transcription reaction mixtures contained 20 mM Tris acetate (pH 7.9),
4 mM magnesium acetate, 0.1 mM EDTA, 100 mM potassium glutamate, 20 nM
E. coli RNA polymerase, and 20 nM plasmid DNA. Where
indicated, r-protein L4 or S7 from E. coli was added to 160 nM, and NusA from E. coli was added to 40 nM. The DNA
template was pLL226 (48, 51) or a derivative containing a
non-E. coli leader. The reaction components were mixed
together with 500 µM each CTP and GTP and incubated at 37°C for 10 min to allow formation of the initiation complex and incorporation of
the proximal several nucleotides. A single round of transcription elongation was then started by addition of ATP to 500 µM, UTP to 100 µM, 5 µCi of [32P]UTP, and rifampin to 10 µg/ml.
Reactions were terminated at the indicated times by the addition of 8 µl of sequencing stop mix. The RNA products were heated at 95°C for
2 min before loading on a 8% sequencing gel.
Nucleotide sequence accession numbers.
The S10 leader
sequences determined in our laboratory have been deposited in the
GenBank database under accession no. AF089898 (C. freundii),
AF089899 (M. morganii), AF058449 (S. typhimurium), AF058451 (S. marcescens), and AF089900
(Y. enterocolitica). The H. influenzae leader
sequence is found in the database under accession no. U32761.
 |
RESULTS |
Cloning and sequencing of the S10 leader from gamma
proteobacteria.
Our Southern analysis of the DNA at the 5' end of
the S. typhimurium S10 operon showed that the sequence
immediately upstream of the promoter has no detectable homology with
the corresponding E. coli sequence (data not shown).
Therefore, to clone the S10 leader of S. typhimurium and
other enteric bacteria, we designed an upstream primer that contained
the E. coli promoter (as well as an EcoRI site to
use for subsequent manipulations [Fig. 1B]), expecting that the
promoter regions in the various enterobacteria would be sufficiently
similar to hybridize to an oligonucleotide containing the E. coli promoter sequence. We also predicted that the S10 structural
gene sequence would be very similar in all enterobacteria, and so the
downstream primer contained a sequence from the E. coli S10
gene, as well as a HindIII site for cloning (Fig. 1B).
Amplification of chromosomal DNA from four species of enterobacteria,
S. typhimurium, C. freundii, Y. enterocolitica, and M. morganii, generated PCR products
of the expected ca. 270 bases (not shown); this DNA was then cloned
into M13mp18 and sequenced. The S10 leader region from the
enterobacterium S. marcescens was also amplified and
sequenced directly from the PCR product. Sequences of the five
enterobacterial S10 leaders were then aligned to determine their
relationship with the E. coli sequence. Recently, we
identified the Yersinia pestis S10 leader sequence via a
BLAST search of the DNA sequence database at the Sanger Centre
(44); this sequence was included in our alignment analysis.
As shown in Fig. 2, all six
enterobacterial leaders showed significant primary sequence homology
with E. coli's, particularly in the 3' two-thirds of the
leader.

View larger version (96K):
[in this window]
[in a new window]
|
FIG. 2.
Alignment of S10 leader sequences. Bases differing from
the E. coli sequence are indicated by white text on black
background. The approximate positions of presumed hairpins are also
shown. Ecoli, E. coli; Styph, S. typhimurium; Cfr, C. freundii;
Yentero, Y. enterocolitica; Ypestis,
Y. pestis; Smarc, S. marcescens;
Mmorg, M. morganii; Hinf, H. influenzae; Vibrio, V. cholerae;
Pseudo, P. aeruginosa. Except for the
Pseudomonas sequence (see below), the 5' ends of the various
leaders were presumed from potential promoter sequences. The
Vibrio leader probably begins about 80 bases upstream of the
indicated sequence. The alignment programs did not identify any
significant sequence homology in the Vibrio leader upstream
of nucleotide 149, and so only the 3' two-thirds of the leader sequence
is shown. The complete sequence is shown in Fig. 3H. The asterisks
below the Pseudomonas sequence refer to likely 35 and 10
sequences for the S10 promoter in this species. Therefore, the leader
is probably much shorter than the leaders of other eubacteria. However,
for comparison the sequence upstream of the presumptive transcription
start site is included in the alignment.
|
|
To examine S10 leader sequences in other bacteria, we searched
available bacterial databases, using the E. coli S10 protein sequence as the query sequence in BLAST2 (1) and then
investigating the sequence upstream of the structural gene. Since the
putative S10 leaders of more distant species shared no primary or
secondary structure similarity with E. coli (data not
shown), we focused on species that, like the enterobacteria, are
members of the gamma subdivision of the proteobacteria. In addition to
Y. pestis (44), already described, we analyzed
H. influenzae, whose complete DNA sequence has been released
(5), and V. cholerae (40) and P. aeruginosa (30). The latter two genomes were in the
process of being sequenced.
The putative S10 leader sequences of the nonenteric proteobacteria
showed very limited sequence similarity with the E. coli sequence (Fig. 2). For P. aeruginosa, the predicted S10
leader is very short, and only the S10 structural gene and 15 or so
bases immediately upstream could be aligned with the E. coli sequence. For V. cholerae and H. influenzae, the alignment was somewhat more convincing (Fig. 2).
Assuming that we have identified the correct S10 promoter sequences,
the V. cholerae leader is considerably longer.
Secondary structure of the S10 leaders.
Our previous studies
showed that two hairpins within the E. coli S10 leader are
required for L4-mediated autogenous control. Hairpin HD (Fig.
3A) is essential for transcriptional, but
not translational, control (7, 48). Hairpin HE (Fig. 3A) is
required for both levels of control (7). To determine if the
S10 leader sequences shown in Fig. 2 can form comparable hairpins, we
used the mfold computer algorithm (54) to determine possible
secondary structures of each leader.

View larger version (59K):
[in this window]
[in a new window]
|
FIG. 3.
Secondary structure predictions for the S10 leader
regions. The secondary structures were predicted by using mfold
(55). The computer-predicted E. coli structure
has been confirmed by in vitro structure probing analysis
(37). The site of L4-mediated transcription termination in
the E. coli leader is indicated. Nucleotides differing from
the E. coli sequence in the alignments shown in Fig. 2 are
indicated by the black circles with white text. The Shine-Dalgarno
sequence and the AUG initiation codon for the S10 structural gene are
indicated by boxes. entero, enterobacterium.
|
|
All of the enterobacterial leaders could in fact generate structures
strikingly similar to the structure from E. coli (Fig. 3B to
F). Despite the unimpressive primary sequence homology for the H. influenzae and V. cholerae leaders, these two RNAs also generated secondary structures with remarkable similarities to E. coli structures in the region containing the HD, HE, and HG hairpins (Fig. 3G and H). However, the very short P. aeruginosa leader had no obvious structural similarity with
E. coli's (Fig. 3I).
Consistent with the primary sequence comparisons (Fig. 2), the 5' third
of the enterobacterial and H. influenzae and V. cholerae leaders displays limited secondary structure similarity:
while all of the species have leader sequences compatible with the
formation of hairpins HA, HB, and HC, there are significant variations
between species with respect to details such as bulges, helix length, and loop size, particularly for the much longer V. cholerae
leader. Variability among these three hairpins is not likely to have a significant effect on L4-mediated regulation of the operon, since their
deletion from the E. coli leader has no measurable effect on
autogenous control (48).
The structure of the fourth hairpin (HD) is completely preserved among
the various enterobacterial species and is indeed an excellent example
of a hairpin whose structure is supported by compensatory changes
during evolution. That is, there are changes in basepairs in the stem,
but none disrupt the helix (Fig. 3C to F). The H. influenzae
and V. cholerae leaders also form an HD hairpin with 6 bp,
although they both have additional bases in the loop (Fig. 3G and H).
These results suggest that hairpin HD, which is required for
L4-mediated transcription termination in E. coli (34,
48), is conserved in these proteobacteria.
All of the enterobacterial S10 leader sequences have the potential to
form an extended hairpin similar to the HE hairpin of E. coli. There is almost complete sequence conservation in this region of the leader and therefore insufficient substitutions to
provide a phylogenetic proof for this structure. Nevertheless, all of
the enterobacteria have sequences compatible with the salient features
of the E. coli HE hairpin: an upper hairpin consisting of a
5-bp stem and an 8-base loop with changes in only one base, an extended
stem with several internal loops, and a U-rich sequence on the distal
side in the position corresponding to the site of L4-mediated
transcription termination in E. coli.
Despite having very different primary sequences, the leaders from
H. influenzae and V. cholerae form HE hairpins
similar in size and overall structure to the HE hairpins found in the
enterobacteria, including a U-rich sequence at the base of the
descending side of the hairpin. However, the closing loop of V. cholerae has six bases, while H. influenzae's HE
hairpin loop has nine bases.
Our previous studies showed that the upper stem-loop structure in
hairpin HE is involved in both transcription and translation control by
L4 (7, 34) and that the string of U's near the descending
base of the HE hairpin is required for transcription control (34,
35). Again, our phylogenetic results suggest that these
structural features are conserved among these proteobacteria.
The most distal hairpin in the E. coli leader, HG, contains
the ribosome binding site and initiation codon for the S10 structural gene. Since the sequence of this region of the leader is identical in
all enterobacterial species, the structure of the HG hairpin is also
preserved. The leaders from H. influenzae and V. cholerae form similar HG hairpin structures. Furthermore, the
single-stranded region between HE and HG, which may be an entry site
for ribosomes initiating translation of the S10 structural gene
(46), is AU rich in all of the species. The P. aeruginosa leader lacks the single-stranded AU-rich sequence.
In vivo regulation in E. coli with non-E.
coli S10 leaders.
Given the conservation of the HD and HE
hairpin structures in the various bacterial species and their critical
role in L4-mediated autogenous control in E. coli, we
suspected that these foreign S10 operons might also be regulated
autogenously by r-protein L4. We analyze L4 regulation by inducing
oversynthesis of the r-protein from a plasmid and then measuring the
effect on the expression of a lacZ gene placed downstream of
the S10 promoter/leader on a second plasmid (7, 48, 53).
Since most of the species analyzed here lack well-developed genetic
systems that would allow conditional oversynthesis of L4, we tested the
regulation of the heterologous leaders in E. coli. We have
shown that L4 proteins from bacteria as divergent from E. coli as Bacillus stearothermophilus (only 42% amino
acid identity) maintain the features required for autogenous control of
the E. coli leader (53). Therefore, we reasoned
that if the S10 operons from closely related species were subject to
L4-mediated autogenous control, their leaders should respond to
E. coli L4.
We first analyzed the leaders from the enterobacteria S. typhimurium, C. freundii, M. morganella, and
Y. enterocolitica, by inserting the heterologous leader/S10'
sequences between the E. coli S10 promoter and
lacZ' (Materials and Methods; Fig. 1C). Each of these
plasmids was transformed into an E. coli strain already
containing a plasmid with an E. coli L4 gene under control of the lac promoter (Fig. 1C). The effect of L4 was measured
by pulse-labeling the cells with [35S]methionine
immediately before and 10 min after inducing L4 oversynthesis by
addition of IPTG and examining whole-cell extracts of the labeled cells by SDS-polyacrylamide gel electrophoresis (PAGE). All four of the
enterobacterial leader constructs were sensitive to L4 regulation, as
evidenced by the decreased rate of synthesis of S10'/
-Gal' after
induction of L4. Indeed, expression of S10'/
-Gal' from the
heterologous leader clones was inhibited by L4 to approximately the
same extent as the protein expressed from the E. coli leader (data not shown).
Although the foreign leaders appeared to be well regulated by E. coli L4, the plasmids containing these leaders slowed the growth
of the E. coli host, resulting in a selection for mutated plasmids with no or reduced synthesis of the S10'/lacZ'
product. Indeed, when we re-sequenced the Y. enterocolitica
plasmid, we found a mutation in the
35 region of the S10 promoter.
Because the constitutive expression of heterologous
leader-S10'/lacZ' constructs appeared to be toxic to the
E. coli host (for unidentified reasons), we modified the
system so that the leader-S10'/lacZ' was expressed from the
IPTG-inducible Ptrc promoter and the L4 gene was
expressed from an arabinose-inducible promoter (Fig. 1D). Using this
system, we analyzed the E. coli and M. morganii leaders, as well as the more divergent H. influenzae and
V. cholerae RNAs. For comparison, we also analyzed the
P. aeruginosa leader, which shares no obvious structural
similarities with the other proteobacterial S10 leaders.
The effect of L4 regulation of these leaders was monitored by first
inducing expression of the S10'/lacZ' gene by addition of
IPTG, and then, approximately 20 min later, inducing oversynthesis of
L4 by addition of arabinose. The results (Fig.
4; Table 1) indicate that not only the M. morganii leader but even the
H. influenzae and V. cholerae leaders, which have
little primary sequence conservation relative to E. coli,
contain the determinants sufficient for autogenous control by L4.
Regulation of the M. morganii and H. influenzae
leaders was not significantly different from the regulation of E. coli, but the V. cholerae leader, whose secondary
structure is also less similar to E. coli's, was not regulated as well. Not surprisingly, the P. aeruginosa
leader, which has neither primary sequence nor secondary structure
homology with the E. coli leader, showed no regulation by
E. coli L4 (Fig. 4; Table 1).

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 4.
Effect of L4 on in vivo synthesis of S10'/ -Gal' from
plasmids carrying foreign S10 leaders. Cells carrying a
Para-L4 plasmid and a
Ptrc-leader-S10'/lacZ' fusion plasmid
(Fig. 1D) with the indicated heterologous leader sequence were grown
exponentially. Aliquots of the culture were labeled for 2 min with
[35S]-methionine immediately before or 20 min after the
addition of IPTG to induce expression of S10'/ -Gal'. Twenty-three
minutes after IPTG addition, arabinose (ara) was added to the culture
to induce L4 oversynthesis; after another 15 min, an aliquot was
labeled with [35S]methionine. Total protein extracts were
fractionated by PAGE and analyzed by autoradiography. The protein band
corresponding to S10'/ -Gal' is indicated by the horizontal arrows.
Control experiments showed that the synthesis of this protein is
dependent on the presence of a plasmid carrying the
Ptrc-leader-S10'/lacZ' construct, and
its regulation is dependent on the leader and on the induction of an
active L4 protein (references 8, 19, 20, and
48 and data not shown). A second band, smaller than
the S10'/ -Gal' band, is also induced by IPTG but is not affected by
L4 induction. This protein ( ) is the product of the
lacZ M15 gene carried by the F' lac
plasmid carried in LL308 (23). It is well resolved in the
gels shown in panels A to C but coelectrophoreses with another band in
panel D. Ecoli, E. coli; Mmorg,
M. morganii; Hinf, H. influenzae;
Vibrio, V. cholerae; Pseudo, P. aeruginosa.
|
|
Since L4 regulates both transcription and translation of the E. coli S10 operon (7, 47), inhibition of S10'/
-Gal'
synthesis in the E. coli version of the construct analyzed
in Fig. 4 is the product of both levels of control. We have previously
described a fusion plasmid containing the E. coli S10 leader
upstream of an intact lacZ gene with its own Shine-Dalgarno
sequence: synthesis of the
-Gal protein from this plasmid is subject
to only transcriptional control (7). Therefore, to analyze
the level of L4 control mediated by the heterologous leaders, we
constructed a similar plasmid containing the
Ptrc-regulated S10 leader upstream of the
SDlac-lacZ sequence (Fig. 1D). The results, shown in Fig. 5, indicate that both M. morganii and H. influenzae leaders are sensitive to
transcription control by E. coli L4. Note that we have not
directly assayed the response of these foreign leaders to L4-mediated
translation control, because we have no facile way to monitor
translation regulation in the absence of transcription regulation.

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 5.
Effect of L4 on in vivo synthesis of -Gal from
plasmids carrying foreign S10 leaders. Cells carrying a
Para-L4 plasmid and a
Ptrc-leader-lacZ fusion plasmid (Fig.
1D) with the indicated heterologous leader sequence were labeled as
described in the legend to Fig. 4. The protein band corresponding to
-Gal is indicated by the horizontal arrows. The smaller band that is
induced by IPTG ( ) is the product of the F'
lacZ M15 gene. Mmorg, M. morganii; Hinf, H. influenzae; ara,
arabinose.
|
|
In vitro transcription regulation with heterologous S10
leaders.
We also tested the ability of the heterologous leaders to
support L4-mediated transcription termination in a cell-free
transcription reaction with purified E. coli RNA polymerase
and NusA protein. We have previously shown that RNA polymerase pauses
transiently in vitro at the site in the E. coli leader of in
vivo transcription termination (51). Purified L4 stabilizes
the paused transcription complex, facilitating termination, but only if
NusA is also included in the transcription reaction (36,
49-51). We constructed DNA templates consisting of the E. coli S10 promoter followed by either the E. coli or a
heterologous leader, upstream of a strong transcription terminator from
the E. coli rrnC operon (Fig.
6A).

View larger version (56K):
[in this window]
[in a new window]
|
FIG. 6.
In vitro transcription of E. coli and
M. morganii leaders. (A) The general structure of the DNA
template, pLL226 or its heterologous derivatives, is shown. The
position of the substituted DNA from M. morganii is
indicated by the solid bar. PS10, E. coli
promoter for the S10 operon; att, site of L4-stimulated transcription
termination; trrnC, terminator from rRNA rrnC
operon. (B) Transcription reactions were performed in the presence of
NusA, and, where indicated, L4. Aliquots were removed at the indicated
times after the start of transcription, fractionated on an 8%
urea-polyacrylamide gel, and analyzed by autoradiography. Relevant
portions of the gel are shown. The RT band contains readthrough
transcripts terminated at trrnC; the ATT bands contain
attenuated transcripts reflecting RNA polymerases paused or terminated
at the attenuation site. Ecoli, E. coli;
Mmorg, M. morganii.
|
|
E. coli RNA polymerase in the presence of E. coli
NusA responded to the foreign templates in a similar way to its
response to the native leader. Results with the M. morganii
template are shown in Fig. 6B; we observed similar results with
C. freundii, S. typhimurium, Y. enterocolitica, and H. influenzae templates (not
shown). In the absence of L4 (Fig. 6B, lanes 13-16), the enzyme paused
only transiently at the attenuation site (corresponding to the cluster
of U's at the base of the HE hairpin, at nucleotides 140 to 150 in
Fig. 3F). In the presence of E. coli L4 (Fig. 6B, lanes 9 to
12), the stability of the paused transcription complex was
significantly enhanced. The addition of NusA was required for the L4
effect (not shown).
While pausing occurred at a site in the M. morganii leader
that corresponds to the E. coli attenuation site, the
pattern of paused transcripts was slightly different, probably a result
of the different distribution of U's around the pause site. Another difference was that, with or without L4, the pause was not as stable
with the M. morganii leader as with the E. coli
leader (Fig. 6B; compare lanes 1 to 4 with lanes 9 to 12 or lanes 5 to 8 with lanes 13 to 16). Nevertheless, our in vitro studies confirm our
conclusion from in vivo experiments that the heterologous S10 leaders
contain the determinants sufficient for NusA-dependent, L4-stimulated
transcription termination.
L4-mediated autogenous control in S. typhimurium.
Although we could not readily analyze the regulation of the S10 operons
within most of the proteobacteria whose leaders we had analyzed, we
were able to characterize the response in S. typhimurium to
the oversynthesis of L4. Our source of L4 was a previously constructed
plasmid, pLL235 (20), which contains the L4 gene from
E. coli under control of the lac promoter. Since the Salmonella L4 gene encodes a protein with the same amino
acid sequence as the E. coli protein (32), it was
not necessary to construct a plasmid carrying the S. typhimurium L4 gene. Similarly, we used target plasmids containing
the E. coli leader, since the S. typhimurium
leader is nearly identical.
Using the target plasmid pLF1 (PS10-E. coli S10
leader-S10'/lacZ') (45), we observed that the
synthesis of S10'/
-Gal' was inhibited by oversynthesis of L4 (Fig.
7A) to about the same extent as we
observe in E. coli. Plasmid pLF1 is subject to both
transcription and translation control by L4. To look specifically at
transcription control, we repeated the experiment with pSma2R
(PS10-E. coli S10 leader-lacZ)
(48). Again, the extent of inhibition by L4 was equal to the
inhibition that we observe in E. coli (Fig. 7B). We conclude
that S. typhimurium is capable of L4-mediated attenuation control.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 7.
Autogenous regulation by L4 in S. typhimurium. S. typhimurium (Styph) or E. coli
(Ecoli) cells carrying the indicated plasmids were
pulse-labeled with [35S]methionine before ( ) or 10 min
after (+) addition of IPTG to induce oversynthesis of E. coli L4. See Materials and Methods for details. Total protein
extracts were fractionated by PAGE and analyzed by autoradiography. The
protein band corresponding to S10'/ -Gal' (A) or -Gal (B) is
indicated by the horizontal arrows. The band just below the -Gal
band in the E. coli lanes (B) is the product of the F'
lacZ M15 gene. In panel A, "target" refers
to the absence ( ) or presence (+) of the PS10-E.
coli S10 leader-S10'/lacZ' target plasmid.
|
|
 |
DISCUSSION |
Because about 75% of a cell's mass is made of protein, protein
synthesis is a major drain on the cell's resources during growth. This
cost includes the biogenesis of ribosomes and auxiliary proteins such
as translation initiation, elongation, and termination factors. Not
surprisingly, all organisms have evolved mechanisms to regulate the
formation of the protein synthesis apparatus. We are interested in
understanding the evolution of the regulatory mechanisms for control of
ribosome formation. Since the major r-protein gene cluster
corresponding to the S10, spc, and alpha operons of E. coli is preserved in many bacteria, archaea, and plastids
(16, 42, 43), one might have expected that gene order and
regulation have coevolved. Indeed, autogenous regulation, a major
principle for control of r-protein production in E. coli,
has been observed in diverse microorganisms, including the
gram-positive bacterium B. subtilis (11) and the
archaeum Methanococcus vannielii (13). Nevertheless, the molecular mechanisms of this regulation are different
from the mechanisms described for E. coli.
Since our earlier studies had suggested that the E. coli-like L4-mediated autogenous control mechanism is not the
mechanism for regulating the S10 cluster in B. subtilis
(19), we investigated the regulation of the S10 operon in
bacteria more closely related to E. coli, focusing on the
gamma branch of the proteobacteria. All of the enterobacteria we
analyzed, including S. typhimurium, S. marcescens, C. freundii, M. morganii, and
Y. enterocolitica, contain S10 leaders that apparently form
secondary structures that are strikingly similar to the structure that
we have described for E. coli (37). In
particular, the 3' region of the S10 leaders contains highly conserved
structures corresponding to hairpins HD and HE that we have shown are
involved in L4-mediated transcription and translation control (7,
35, 37, 48). Not surprisingly, these leaders all respond to
E. coli L4.
Two more distantly related members of the gamma subdivision of the
purple bacteria, H. influenzae and V. cholerae,
also contain leaders that can form E. coli-like HD and HE
hairpins. Furthermore, these leaders also respond in E. coli
to r-protein L4. Taken together with the finding that heterologous L4
proteins from M. morganii, Y. pseudotuberculosis,
H. influenzae, and B. stearothermophilus can
substitute for E. coli L4 in the regulation of the E. coli S10 operon (53), our results suggest that the
L4-mediated regulatory mechanism that we have described for E. coli might also govern the regulation of the S10 operons of other
enterobacteria and of other closely related members of the gamma
subdivision of the proteobacteria such as H. influenzae and
V. cholerae.
Interestingly, it appears that not all members of the gamma subdivision
utilize an E. coli-type mechanism for regulating the S10
gene cluster. P. aeruginosa has a much shorter untranslated sequence upstream of its S10 gene, and neither the primary sequence nor
the computer-predicted secondary structure of the leader suggests any
homology with the E. coli leader. Indeed, the P. aeruginosa leader is not sensitive to autogenous control by
E. coli L4. Since its leader is also not regulated by the
homologous P. aeruginosa L4 (data not shown), it is likely
that P. aeruginosa utilizes a very different mechanism for
regulating expression of its S10 operon.
We have also surveyed the available sequences of S10 regions of other
members of the proteobacteria, using the NCBI BLAST algorithm
(26). So far, we have found no other examples of leader sequences that form an E. coli-like structure. Indeed, for
most of these proteobacteria (including Rickettsia
prowazekii, Neisseria gonorrhoeae, and
Thiobacillus cuprinus), the S10 gene is located less than
100 nucleotides downstream of tufA and often appears to be
cotranscribed with the tufA gene. A phylogenetic tree based on the rRNA sequences of relevant proteobacteria and summarizing our
S10 leader studies is shown in Fig. 8.
Although we are still exploring the S10 operon structures of other
members of the proteobacterial branch, our current data suggest that
L4-mediated autogenous control was established during the evolution of
the gamma subdivision of proteobacteria. Our studies indicate that this
control involves L4-stimulated transcription termination. Whether
translation control by L4 is also conserved in these other bacteria is
under investigation.
As already mentioned, previous studies of B. subtilis
(11, 15, 19, 38) had suggested that the highly conserved
gene order of the major r-protein gene cluster in gram-negative and gram-positive bacteria does not ensure that they utilize the same mechanisms for autogenously regulating the expression of those genes.
The present study reveals that this dichotomy between gene order and
regulatory mechanism exists even within a more restricted group of the
bacterial kingdom.
The evolutionary preservation of r-protein gene order in eubacteria and
the archaea is especially remarkable, since in general no other major
gene clusters are preserved among the bacteria whose genomes have been
sequenced (see, for example, references 25 and
42). The similarities in r-protein gene organization imply that the last common eubacterial/archaebacterial ancestor had
already established this gene order (4, 42) and that selective pressure maintained this order despite continual
rearrangements of other genes during evolution (42). We do
not yet understand the forces behind either the original clustering of
the r-protein genes or the subsequent preservation of the gene order.
The selfish-operon model (18) accounts for clustering of
nonessential genes but cannot explain the formation of clusters of
essential genes like those encoding r-proteins. Indeed, the primordial
history of these r-protein clusters precludes reliable speculation
about their formation (18).
In any case, once formed, the r-protein clusters clearly offered a
strong evolutionary advantage. Given that these genes encode proteins
that must interact physically, there may have been selective pressure
to ensure that modules of r-protein genes were exchanged during a
recombination event; a similar argument has been used to explain the
functional clusters of bacteriophage genes (6). Moreover,
once the r-protein genes had been gathered during evolution, the
extremely short intragenic regions in the cluster would make it very
difficult to survive transpositions disrupting the cluster, since such
events would have a high probability of inactivating these essential
genes (although such events clearly occurred in some species, since
there are examples of extra or missing genes within the
S10-spc-alpha cluster [16, 42]). Finally,
the clustering of r-protein genes into operons provides a mechanism for
cotranscriptional and coupled translational control. The latter
advantage, however, presumably evolved after the primordial
organization of the genes, resulting in a plethora of regulatory
schemes that remain virtually unexplored.
We thank Mike Noorani for technical assistance, Xiao Li and
Yizhong Sha for technical advice, and Knud Nierhaus for purified L4 and
S7 proteins.
This work was supported by grants AI-15286 and GM-54876 from the
National Institutes of Health.
| 1.
|
Altschul, S. F.,
T. L. Madden,
A. A. Schaffer,
J. Zhang,
Z. Zhang,
W. Miller, and D. J. Lipman.
1997.
Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res.
25:3389-3402[Abstract/Free Full Text].
|
| 2.
|
Beck, C.,
J. Ingraham,
O. Maaløe, and J. Neuhard.
1973.
Relationship between the concentration of nucleoside triphosphates and the rate of synthesis of RNA.
J. Mol. Biol.
78:117-121[Medline].
|
| 3.
|
Clark, D. J., and O. Maaløe.
1967.
DNA replication and the division cycle in Escherichia coli.
J. Mol. Biol.
23:99-112.
|
| 4.
|
Doolittle, W. F., and J. R. Brown.
1994.
Tempo, mode, the progenote, and the universal root.
Proc. Natl. Acad. Sci. USA
91:6721-6728[Abstract/Free Full Text].
|
| 5.
|
Fleischmann, R. D.,
M. D. Adams,
O. White,
R. A. Clayton,
E. F. Kirkness,
A. R. Kerlavage,
C. J. Bult,
J.-F. Tomb,
B. A. Dougherty,
J. M. Merrick,
K. McKenney,
G. Sutton,
W. FitzHugh,
C. Fields,
J. D. Gocayne,
J. Scott,
R. Shirley,
L.-I. Liu,
A. Glodek,
J. M. Kelley,
J. F. Weidman,
C. A. Phillips,
T. Spriggs, and E. Hedblom.
1995.
Whole-genome random sequencing and assembly of Haemophilus influenzae Rd.
Science
269:496-512[Abstract/Free Full Text].
|
| 6.
|
Ford, M. E.,
G. J. Sarkis,
A. E. Belanger,
R. W. Hendrix, and G. F. Hatfull.
1998.
Genome structure of mycobacteriophage D29: implications for phage evolution.
J. Mol. Biol.
279:143-164[Medline].
|
| 7.
|
Freedman, L. P.,
J. M. Zengel,
R. H. Archer, and L. Lindahl.
1987.
Autogenous control of the S10 ribosomal protein operon of Escherichia coli: genetic dissection of transcriptional and post-transcriptional regulation.
Proc. Natl. Acad. Sci. USA
84:6516-6520[Abstract/Free Full Text].
|
| 8.
|
Freedman, L. P.,
J. M. Zengel, and L. Lindahl.
1985.
Genetic dissection of stringent control and nutritional shift-up response of the Escherichia coli S10 ribosomal protein operon.
J. Mol. Biol.
185:701-712[Medline].
|
| 9.
|
Gaal, T.,
M. S. Bartlett,
W. Ross,
C. L. Turnbaugh, Jr., and R. L. Gourse.
1997.
Transcription regulation by initiating NTP concentration: rRNA synthesis in bacteria.
Science
278:2092-2097[Abstract/Free Full Text].
|
| 10.
|
Grundy, F. J., and T. M. Henkin.
1990.
Cloning and analysis of the Bacillus subtilis rpsD gene, encoding ribosomal protein S4.
J. Bacteriol.
172:6372-6379[Abstract/Free Full Text].
|
| 11.
|
Grundy, F. J., and T. M. Henkin.
1991.
The rpsD gene, encoding ribosomal protein S4, is autogenously regulated in Bacillus subtilis.
J. Bacteriol.
173:4595-4602[Abstract/Free Full Text].
|
| 12.
|
Guzman, L.-M.,
D. Belin,
M. J. Carson, and J. Beckwith.
1995.
Tight regulation, modulation, and high level expression by vectors containing the arabinose PBAD promoter.
J. Bacteriol.
177:4121-4130[Abstract/Free Full Text].
|
| 13.
|
Hanner, M.,
C. Mayer,
C. Köhrer,
G. Golderer,
P. Grobner, and W. Piendl.
1994.
Autogenous translational regulation of the ribosomal MvaL1 operon in the archaebacterium Methanococcus vannielii.
J. Bacteriol.
176:409-418[Abstract/Free Full Text].
|
| 14.
|
Henkin, T. M., and G. H. Chambliss.
1984.
Genetic mapping of a mutation causing an alteration in Bacillus subtilis ribosomal protein S4.
Mol. Gen. Genet.
193:364-369[Medline].
|
| 15.
|
Henkin, T. M.,
S. H. Moon,
L. C. Mattheakis, and M. Nomura.
1989.
Cloning and analysis of the spc ribosomal protein operon of Bacillus subtilis: comparison with the spc operon of Escherichia coli.
Nucleic Acids Res.
17:7469-7486[Abstract/Free Full Text].
|
| 16.
|
Koonin, E. V., and M. Y. Galperin.
1997.
Prokaryotic genomes: the emerging paradigm of genome-based microbiology.
Curr. Opin. Genet. Dev.
7:757-763[Medline].
|
| 17.
|
Laemmli, U. K.
1970.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
227:680-685[Medline].
|
| 18.
|
Lawrence, J. G., and J. R. Roth.
1996.
Selfish operons: horizontal transfer may drive the evolution of gene clusters.
Genetics
143:1843-1860[Abstract].
|
| 19.
|
Li, X.,
L. Lindahl,
Y. Sha, and J. M. Zengel.
1997.
Analysis of the Bacillus subtilis S10 ribosomal protein gene cluster identifies two promoters that may be responsible for transcription of the entire 15-kilobase S10-spc-alpha cluster.
J. Bacteriol.
179:7046-7054[Abstract/Free Full Text].
|
| 20.
|
Li, X.,
L. Lindahl, and J. M. Zengel.
1996.
Ribosomal protein L4 from Escherichia coli utilizes different determinants for its structural and regulatory functions.
RNA
2:24-37[Abstract].
|
| 21.
|
Lindahl, L.,
F. Sor,
R. H. Archer,
M. Nomura, and J. M. Zengel.
1990.
Transcriptional organization of the S10, spc and operons of Escherichia coli.
Biochim. Biophys. Acta Gene Struct. Expr.
1050:337-342[Medline].
|
| 22.
|
Lindahl, L., and J. M. Zengel.
1990.
Autogenous control is not sufficient to ensure steady-state growth rate-dependent regulation of the S10 ribosomal protein operon in Escherichia coli.
J. Bacteriol.
172:305-309[Abstract/Free Full Text].
|
| 23.
|
Lindahl, L., and J. M. Zengel.
1979.
Operon-specific regulation of ribosomal protein synthesis in Escherichia coli.
Proc. Natl. Acad. Sci. USA
76:6542-6546[Abstract/Free Full Text].
|
| 24.
|
Maidak, B. L.,
G. J. Olsen,
N. Larsen,
R. Overbeek,
M. J. McCaughey, and C. R. Woese.
1997.
The RDP (Ribosomal Database Project).
Nucleic Acids Res.
25:109-111[Abstract/Free Full Text].
|
| 25.
|
Mushegian, A. R., and E. V. Koonin.
1996.
Gene order is not conserved in bacterial evolution.
Trends Genet.
12:289-290[Medline].
|
| 26.
|
NCBI Blast server.
15 March 1999.
revision date.
http://www.ncbi.nlm.nih.gov/BLAST/. [Online.] [27 April, last date accessed.]
|
| 27.
|
Olins, P. O., and M. Nomura.
1981.
Regulation of the S10 ribosomal protein operon in E. coli: nucleotide sequence at the start of the operon.
Cell
26:205-211[Medline].
|
| 28.
|
Post, L. E.,
A. E. Arfsten,
G. R. Davis, and M. Nomura.
1980.
DNA sequence of the promoter region for the ribosomal protein operon in Escherichia coli.
J. Biol. Chem.
255:4653-4659[Abstract/Free Full Text].
|
| 29.
|
Post, L. E.,
A. E. Arfsten,
F. Reusser, and M. Nomura.
1978.
DNA sequences of promoter regions for the str and spc ribosomal protein operons in Escherichia coli.
Cell
15:215-229[Medline].
|
| 30.
| Pseudomonas Genome Project. 12/15/1998,
release date. Contig 65. http://www.pseudomonas.com/. [Online.]
[3/2/1999, last date accessed.]
|
| 31.
| Ribosomal Database Project.
http://www.cme.msu.edu/RDP. [Online.] [13 August 1998, last date accessed.]
|
| 32.
| Salmonella typhi Genome Project.
2/22/1999, posting date. Contig 510. The Sanger Center.
http://www.sanger.ac.uk/Projects/S_typhi/. [Online] [3/2/1999,
last date accessed.]
|
| 33.
|
Sanger, F.,
S. Nicklen, and A. R. Coulsen.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467[Abstract/Free Full Text].
|
| 34.
|
Sha, Y.
1997.
Ph.D. thesis.
University of Rochester, Rochester, N.Y.
|
| 35.
|
Sha, Y.,
L. Lindahl, and J. M. Zengel.
1995.
RNA determinants required for L4-mediated attenuation control of the S10 r-protein operon of Escherichia coli.
J. Mol. Biol.
245:486-498[Medline].
|
| 36.
|
Sha, Y.,
L. Lindahl, and J. M. Zengel.
1995.
Role of NusA in L4-mediated attenuation control of the S10 r-protein operon of Escherichia coli.
J. Mol. Biol.
245:474-485[Medline].
|
| 37.
|
Shen, P.,
J. M. Zengel, and L. Lindahl.
1988.
Secondary structure of the leader transcript from the Escherichia coli S10 ribosomal protein operon.
Nucleic Acids Res.
16:8905-8924[Abstract/Free Full Text].
|
| 38.
|
Suh, J. W.,
S. A. Boylan,
S. H. Oh, and C. W. Price.
1996.
Genetic and transcriptional organization of the Bacillus subtilis spc- region.
Gene
169:17-23[Medline].
|
| 39.
|
Thompson, J. D.,
D. G. Higgins, and T. J. Gibson.
1994.
CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice.
Nucleic Acids Res.
22:4673-4680[Abstract/Free Full Text].
|
| 40.
| Vibrio cholerae Genome Project.
2/11/1999, posting date. Contig asm970. The Institute for Genome
Research. http://www.tigr.org:Vibrio cholerae. [Online.] [3/2/1999,
last date accessed.]
|
| 41.
|
Walter, A. E.,
D. H. Turner,
J. Kim,
M. H. Lyttle,
P. Müller,
D. H. Mathews, and M. Zuker.
1994.
Coaxial stacking of helixes enhances binding of oligoribonucleotides and improves predictions of RNA folding.
Proc. Natl. Acad. Sci. USA
91:9218-9222[Abstract/Free Full Text].
|
| 42.
|
Watanabe, H.,
H. Mori,
T. Itoh, and T. Gojobori.
1997.
Genome plasticity as a paradigm of eubacteria evolution.
J. Mol. Evol.
44(Suppl. 1):S57-S64.
|
| 43.
|
Wittmann-Liebold, B.,
A. K. E. Köpke,
E. Arndt,
W. Krömer,
T. Hatakeyama, and H.-G. Wittmann.
1990.
Sequence comparison and evolution of ribosomal proteins and their genes, p. 598-616.
In
W. E. Hill, A. Dahlberg, R. A. Garrett, P. B. Moore, D. Schlessinger, and J. R. Warner (ed.), The ribosome: structure, function and evolution. American Society for Microbiology, Washington, D.C..
|
| 44.
| Yersinia pestis Genome Project.
2/15/1999, posting date. Contig 795. 1999. The Sanger Centre
http://www.sanger.ac.uk/Projects/Y_pestis/. [Online.] [3/2/1999,
last date accessed.]
|
| 45.
|
Zengel, J. M.,
R. H. Archer,
L. P. Freedman, and L. Lindahl.
1984.
Role of attenuation in growth rate-dependent regulation of the S10 r-protein operon of E. coli.
EMBO J.
3:1561-1565[Medline].
|
| 46.
|
Zengel, J. M., and L. Lindahl.
1994.
Diverse mechanisms for regulating ribosomal protein synthesis in Escherichia coli.
Prog. Nucleic Acid Res. Mol. Biol.
47:331-370[Medline].
|
| 47.
|
Zengel, J. M., and L. Lindahl.
1990.
Escherichia coli ribosomal protein L4 stimulates transcription termination at a specific site in the leader of the S10 operon independent of L4-mediated inhibition of translation.
J. Mol. Biol.
213:67-78[Medline].
|
| 48.
|
Zengel, J. M., and L. Lindahl.
1996.
A hairpin structure upstream of the terminator hairpin required for ribosomal protein L4-mediated attenuation control of the S10 operon of Escherichia coli.
J. Bacteriol.
178:2383-2387[Abstract/Free Full Text].
|
| 49.
|
Zengel, J. M., and L. Lindahl.
1992.
Ribosomal protein L4 and transcription factor NusA have separable roles in mediating termination of transcription within the leader of the S10 operon of E. coli.
Genes Dev.
6:2655-2662[Abstract/Free Full Text].
|
| 50.
|
Zengel, J. M., and L. Lindahl.
1991.
Ribosomal protein L4 of Escherichia coli: in vitro analysis of L4-mediated attenuation control.
Biochimie
73:719-727[Medline].
|
| 51.
|
Zengel, J. M., and L. Lindahl.
1990.
Ribosomal protein L4 stimulates in vitro termination of transcription at a NusA-dependent terminator in the S10 operon leader.
Proc. Natl. Acad. Sci. USA
87:2675-2679[Abstract/Free Full Text].
|
| 52.
|
Zengel, J. M.,
D. Mueckl, and L. Lindahl.
1980.
Protein L4 of the E. coli ribosome regulates an eleven gene r-protein operon.
Cell
21:523-535[Medline].
|
| 53.
|
Zengel, J. M.,
D. Vorozheikina,
X. Li, and L. Lindahl.
1995.
Regulation of the Escherichia coli S10 ribosomal protein operon by heterologous L4 ribosomal proteins.
Biochem. Cell Biol.
73:1105-1112[Medline].
|
| 54.
|
Zuker, M.
1987.
In
M. S. Waterman (ed.), Mathematical methods for DNA sequences, p. 159-184.
CRC Press, Boca Raton, Fla.
|
| 55.
| Zuker, M. mfold mserver.
http://www.ibc.wustl.edu/~zuker/rna/form1.cgi. [Online.] [26
April 1999, last date accessed.]
|