Previous Article | Next Article ![]()
Journal of Bacteriology, October 1999, p. 6133-6141, Vol. 181, No. 19
Department of Microbiology-Immunology,
Northwestern University Medical School, Chicago, Illinois 60611
Received 17 May 1999/Accepted 26 July 1999
Pilus antigenic variation in Neisseria gonorrhoeae
occurs by the high-frequency, unidirectional transfer of DNA sequences from one of several silent pilin loci (pilS) into the
expressed pilin gene (pilE), resulting in a change in the
primary pilin protein sequence. Previously, we investigated the effects
of large or small heterologous insertions in conserved and variable
portions of a pilS copy on antigenic variation. We observed
differential effects on pilin recombination by the various insertions,
and the severity of the defect correlated with the disruption or
displacement of a conserved pilin DNA sequence called cys2.
In this study, we show that disruption or displacement of the
pilE cys2 sequence by the same insertions or a deletion
also affects pilin recombination. However, in contrast to the
insertions in pilS, the analogous insertions in
pilE impaired, but did not block, recombination of the
flanking pilin sequences. These results, the change in the spectrum of
donor silent copies used during variation, and our previous results
with pilS mutations show that the donor pilS and recipient pilE play different roles in antigenic
variation. We conclude that when high-frequency recombination
mechanisms are blocked, alternative mechanisms are operative.
Neisseria gonorrhoeae
(the gonococcus [Gc]) is the causative agent of the sexually
transmitted disease gonorrhea. Gc pili, filamentous appendages that
emanate from the cell surface, are comprised mainly of the pilin
protein (5). Pili undergo antigenic variation through
alteration of pilin primary amino acid sequences (10, 26).
Pili are critical for the initial attachment of the bacterium to the
host mucosal epithelia (19, 33) and are one of several
factors required for natural DNA transformation competency (7, 29,
31).
Pilin is encoded by the pilE gene present at each of two
pilE expression loci in laboratory strain MS11 variant A
(pilE1 and pilE2) and at a single expression
locus in all other isolates (34). In addition to the
pilE gene, four to seven transcriptionally inactive, silent
loci (pilS) contain from one to six partial copies of
potential pilin coding sequences (8). Present at the 3' end
of the pilE locus and at each pilS locus is a
conserved DNA sequence called the Sma/Cla repeat (SCR) (21,
23). The pilE SCR is required for efficient pilin
antigenic variation (34) and is specifically bound by at
least three proteins detected in partially fractionated Gc lysates
(36, 37). There are one or two silent pilin copies
immediately upstream of pilE (upstream silent copies), and
each upstream silent pilin copy carries a partial SCR (37).
The silent pilin copies lack a promoter, a ribosome binding site, and
the 5' portion of conserved pilin sequences (21). The
variable pilin sequences, present in the expressed and silent copies,
consist of short lengths of conserved pilin sequences interspersed
between regions of semivariable (SV) and hypervariable (HV) sequences
(8, 10, 26). Near the 3' end of the coding region are two
conserved sequences called cys1 and cys2
(26) (see Fig. 1). Each encodes approximately 10 amino
acids, including a cysteine residue, and both are conserved at the
protein and DNA levels (8, 23). The cysteine residues form a
disulfide bond and surround the 45- to 66-bp HV loop sequence
(HVL) (see Fig. 1) (also designated mc2
[8]). The HVL region comprises the major
portion of the HV domain, which is also the most divergent region of
the pilin gene family (8, 9, 26). The portion of the HV
region that is downstream of cys2 is also highly divergent and encodes the C terminus of the protein we have designated the HV
tail (HVT) (11) (also called mc1
[8]).
Pilin antigenic variation occurs when a portion of a silent copy
replaces the respective sequence in the expressed gene. The transfer of
a portion of a pilS copy into pilE is gene
conversion, since the donor pilS sequence remains unchanged
(8, 26). This RecA-dependent (16), RecO-dependent
and RecQ-dependent (20) unidirectional flow of information
can be achieved through two routes, intracellular recombination
(1, 8, 10, 26) and recombination with extrachromosomal DNA
taken up from autolyzed neighbors during transformation (7, 22,
28). The majority of in vitro pilin recombination reactions occur
through intracellular reactions (30a, 35, 39).
Recombination of pilS sequences into pilE can
also alter the level of pilus expression via introduction of nonsense
codons (1), codon combinations that result in the secretion
of truncated, soluble pilin proteins (9) or duplicated pilin
sequences creating nonfunctional over-long pilin (L-pilin) (7,
9). Change from a highly piliated state (P+) to an
underpiliated or nonpiliated state (P We previously attempted to measure the frequency of antigenic variation
using a promoterless chloramphenicol acetyltransferase gene
('cat) inserted into pilS1 copy 3 (a copy that is
unlinked to the SCR) as a surrogate marker for pilin variation. The
transfer of 'cat from pilS1 copy 3 into
pilE was never observed (11). Instead,
chloramphenicol-resistant (Cmr) variants each contained a
new hybrid pilin locus consisting of pilE sequences linked
to one of three pilS1 copies upstream of 'cat,
with recombination junctions occurring in small regions of homology
between the pilE gene and the target pilS copy.
The structure of the hybrid pilin loci and surrounding sequences
allowed the formulation of models for the movement of DNA during
antigenic variation (11). Some of the predictions of these
models have been supported experimentally (reference
10a and see Discussion).
Analysis of antigenic variation and pilin hybrid locus formation in
other gonococcal mutants containing either the large 780-bp 'cat or a small 10-bp NotI linker in the
conserved cys2 or HVL regions of
pilS1 copy 3 allowed us to conclude that both the size and
the position of heterologous insertions in a pilS copy
differentially affected recombination of the mutated pilS
copy with pilE. Specifically, the small 10-bp
NotI linker efficiently transferred from pilS1 copy 3 into pilE when it was inserted in the HVL
region of copy 3 but not when it was present in the cys2
region of copy 3. Moreover, the 'cat gene present in the
HVL or cys2 region of pilS1 copy 3 was never found to transfer into pilE. The effect of these
insertions on hybrid-locus formation was somewhat different. Hybrid
loci were formed by recombination between pilE and
pilS1 copy 3 when 'cat was in the cys2
region of copy 3 but were never found when 'cat was in the
HVL region of pilS1 copy 3.
In this study, we have extended this analysis of the effect of
'cat and NotI linker mutations in the recipient
pilE gene. These matched pilE insertion mutations
exhibited effects on pilin recombination that were different from the
effects of the previously described pilS mutations. The
divergent effects show that donor and recipient pilin sequences act
differently during pilin antigenic variation. Moreover, the altered
spectrum of silent copies used when antigenic variation is inhibited by
these mutations indicates that more than one recombination mechanism
can mediate pilin variation. These data further confirm that insertion
in or displacement of cys2 impairs or blocks normal pilin
recombination. We report the first data showing that recombination
through the pilE SCR can occur during a subset of pilin
recombination reactions. Finally, we present updated models that
explain how pilin sequences move during pilin variation.
Bacterial strains, plasmids, and media.
All Gc strains were
derived from VD300recA6 (27), a variant of strain
MS11 (14). Table 1 describes
the plasmids used in this study. Gc organisms were grown on GC Medium
Base (GCB) (Difco) with Kellogg Supplements (13) at 37°C
in 5% CO2. For antibiotic selection of Gc, chloramphenicol
(10 µg ml
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Insertion Mutations in pilE
Differentially Alter Gonococcal Pilin Antigenic Variation
and
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
) can be visually
observed under a stereomicroscope as a change in the colony morphology.
Some P
colony variants are able to revert to a more
piliated phenotype. Revertible and nonrevertible P
colony
variants are also generated by several mechanisms that are different
from the RecA-dependent unidirectional recombination that produces
pilin antigenic variants (7, 9, 12, 15, 18, 21, 25).
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
1), nalidixic acid (1.5 µg
ml
1), and erythromycin (8.0 µg ml
1) (all
from Sigma) were used.
TABLE 1.
Plasmids used in this study
Generation of pilE and pilS mutations. Restriction enzymes and linkers were obtained from New England Biolabs and were used under the manufacturer's recommended conditions. DNA extraction from agarose gels was performed with GeneClean (Bio 101). PCR products used in cloning were generated with Native Pfu DNA polymerase (Stratagene). Unless specified, PCR primers are as previously described (11).
To create pNG1100-2, pNG1100-1 was digested with StuI and ligated to a 'cat PCR product [CATF (ATCGAGATTTTCAGGAGCTAAG)-GCUCATREV (GCCGTCTGAATTTCTGCCATTCATCCGC)]. Escherichia coli transformants were selected on chloramphenicol to ensure that only clones containing 'cat expressed from the pilin promoter were isolated. To create pNG1100-3, the pilE::'cat of pNG1100-2 was amplified in two PCRs with the oligonucleotide probes PILSTART and HVPEDELREV (GACGGCAGGTGCTTGGTGTCGATGCCGCCCTGT) for the 5' end and HVPEDELF (GTTCGGTAAAATGGTTCTGCGGACAGGGCGGCATCGACACCA) and SP3A for the 3' end. The two PCR products were mixed, and a third PCR with PILSTART and SP3A was performed. A PCR product of approximately 1,500 bp was gel isolated, cut with Bsu361 and SmaI, and ligated into Bsu361- and SmaI-cut pNG1100-1. Transformants were selected on chloramphenicol, and their pilE genes were sequenced. A clone containing the desired 60-bp deletion of the HVL was identified. The pilE nucleotide sequence of pNG1100-1 (beginning with amino acid Cys 121 and ending with amino acid Thr 144) is TGCGGACAGCCGGTTACGCGCACCGGCGACAACGACGACACCGTTGCCGACGCCAAAGACGCCAAAGAAA TCGAC. The pNG1100-3 clone had a deletion (indicated by the underline) and a 6-bp replacement (GGCGGC) encoding a Gly-Gly linker in the HVL. This pilE deletion was introduced into VD300recA6 by selection for a 'cat cassette located between the stop codon and the SCR of pilE to make strain BHA-HV (see Fig. 1). A similar cat insertion in the 3' untranslated region of pilE was previously shown to support wild-type levels of pilin variation in MS11 (39).Generation of Gc mutants and a Gc pilE variant.
BHAcat3 and BHANot5, a P
antigenic
variant of BHANot2 containing the pilS1 copy 3 HVL::NotI sequence in pilE,
and BHAC5, a P
antigenic variant of BHANot3
with the entire pilS1 copy 5 HVL in
pilE, were described previously (11). DNA
transformation generated the following Gc strains: BHAcat4
(generated with pNG1312cat4), BHA-HV (generated with
pNG1100-3), BHANot4 (generated with pNG1100-5). PCR and
Southern blot analyses were used to verify the presence of the desired
insertions and to confirm that all other pilin loci were normal. DNA
sequence analysis confirmed the desired deletion in the pilE
gene of BHA-HV.
transformant was isolated and checked by PCR and Southern blot analyses
(BHAcat5).
Isolation and quantitation of Cmr variants.
BHAcat1 and BHAcat4 were induced for 18 to
24 h on 2 mM IPTG
(isopropyl-
-D-thiogalactopyranoside) plates. Gc
organisms were swabbed into GCB liquid medium (GCBL), and dilutions
were plated onto GCB plates to determine the total number of CFU per ml
and onto GCB with chloramphenicol to determine the number of
Cmr CFU per ml.
Southern hybridization analysis.
Chromosomal DNA was
extracted as described previously (2). ClaI- and
ClaI- plus HpaI-digested DNAs were separated by
agarose gel electrophoresis and blotted to nylon membrane as described by Sambrook et al. (24). The blots were probed with the
oligonucleotides PILSTART (to identify the pilE locus) and
CYS2R (to identify all pilin loci). Blots were often stripped and
probed with the appropriate oligonucleotides used in PCR amplification
(listed above). All oligonucleotide probes were end labeled with
[
-32P]ATP (Amersham) with T4 polynucleotide kinase
(New England Biolabs). Blots were hybridized and were washed at 15 to
20°C below the melting temperature of the oligonucleotide probe as
recommended previously (24). Blots were exposed to X-Omat AR
film (Kodak), either with or without an intensifying screen.
DNA sequence analysis. For DNA sequence analysis of the pilE variants, 3 to 5 µl of the PCR product was treated with 1 µl of shrimp alkaline phosphatase (U.S. Biochemicals) and 1 µl of exonuclease I at 37°C for 15 min followed by heat inactivation at 85°C for 15 min. Eight milliliters of sequencing mix (from either an ABI PRISM Dye Terminator Cycle Sequencing Ready Reaction Kit or an ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit [Perkin-Elmer]), 3.2 pmol of primer, and H2O to equal a total reaction mixture of 20 µl were added. All cycle sequencing was performed in an MJ Research PTC-1000 thermocycler retrofitted with a gold block and a hot bonnet. Reaction mixtures were run on either an ABI 373 or an ABI 377 sequencing apparatus as specified by the manufacturer. Single-stranded DNA sequences of the SV and HV regions with primer CONSTF2 (38) was sufficient to determine the pilS copy(s) that contributed to the observed sequence changes.
Transformation assay to enrich for P+ variants from
P
mutant strains.
Plasmid pSY6 DNA was used at a
subsaturating level (60 ng) to minimize transformation of
P
Gc organisms via the pilus-independent transformation
route (3). Each P
strain was induced for 18 to
22 h before Gc colonies were collected with a sterile Dacron swab
into GCBL-5 mM MgSO4-2 mM IPTG at a density of
approximately 2 × 109 cells per ml. Cells (20 µl)
were added to 200 µl of GCBL-MgSO4-IPTG that contained 60 ng of pSY6. After 30 min at 37°C in a CO2 incubator, the
transformation mix was diluted into 800 µl of GCBL and incubated another 4 to 5 h. Serial dilutions were performed, and 20 µl
from each dilution was spotted on plain GCB and on GCB containing
nalidixic acid to determine numbers of total and nalidixic
acid-resistant (Nalr) CFU.
Analysis of Nalr transformants to determine the proportion of pilE variants. Nalr transformants from BHAcat3 and BHAcat5 were plated onto GCB containing chloramphenicol to screen for loss of 'cat from pilE. Amplification of a wild-type-sized pilE PCR product with PILSTART-CYS2R and the failure to amplify with PILSTART-CATREV confirmed the loss of 'cat from pilE. The pilE genes from Nalr transformants of BHANot4 and BHANot5 were amplified by the oligonucleotides PILSTART and SP3A, and the products were digested with NotI to determine whether the NotI linker was lost from pilE. The extents of sequence changes in Nalr pilE variants of BHANot4 were determined by Southern blot analysis of chromosomal DNAs and by PacI restriction digests of PILSTART-OPAE2REV PCR products. The pilE genes from BHA-HV were amplified with PILSTART-HVPEDELREV to determine whether the 60-bp deletion was retained or lost. Amplification with PILSTART and CYS2R served as a positive control. Growth on medium containing chloramphenicol and PCR with PILSTART and CATREV detected the presence of 'cat in the 3' untranslated region of pilE. Nalr transformants of BHAC5 were tested for retention of the pilS1 copy 5 HVL in pilE by amplification with PILSTART and PS1C5HVR, a primer specific for the pilS1 copy 5 HVL region. Control amplifications of these same variants were performed with PILSTART and SP3A.
Analysis of Cmr variants of BHAcat4. To determine whether variants contained a hybrid locus or whether they were created by insertion of pilS1::'cat sequences into pilE, two separate PCRs were used. PCR with the primers PILSTART and CATREV established the linkage of pilE to 'cat. PCR with CATF and OPAEREV2 was diagnostic for 'cat sequences in the pilE locus. Variants that had 'cat 3' of the pilin promoter but failed to amplify with CATF and OPAEREV2 contained a new hybrid locus where pilE sequence was linked to the pilS1::'cat sequence, which lacks the downstream OPAEREV2 sequence.
| |
RESULTS |
|---|
|
|
|---|
Description of strains.
In our previous study, we examined
strains containing a large 780-bp 'cat gene or a small 10-bp
NotI linker in either the conserved cys2 region
or the HVL region of pilS1 copy 3. Only the
NotI linker in the HVL region of copy 3 was
efficiently transferred into pilE (11). In this
study, the equivalent 'cat and NotI linker
mutations were introduced into pilE to determine whether a
large or a small insertion in the conserved cys2 or the
HVL region of pilE could be replaced by any
pilS copy. The relevant features of the four pilE
mutant strains corresponding to the previously described
pilS1 mutants are shown Fig.
1. All four of the strains used in this
work also contain the IPTG-regulatable recA6 allele to
control when homologous recombination, including pilin antigenic
variation, occurs (27). Strain BHAcat3
(11) has the 'cat fragment inserted into the
cys2 region of pilE
(pilE-cys2::'cat). Strain
BHANot4 has a NotI linker in the
cys2 region of pilE
(pilE-cys2::NotI). BHANot4
also has a PacI linker in place of the ClaI site
of the SCR. It was previously shown that replacement of the
ClaI site by a PacI linker did not affect
antigenic variation as measured by a reverse transcriptase-PCR assay
(37). Strain BHAcat5 has the 'cat
fragment in the HVL region of pilE
(pilE HVL::'cat). Finally,
we isolated a P
variant of BHANot2
(pilS1 copy 3 HVL::NotI)
that had transferred the NotI linker from the
HVL region of copy 3 into pilE
(BHANot5 [11]). All four of these strains
expressed a P
colony morphology and were over 1,000-fold
less competent for DNA transformation than a P+
VD300recA6 variant after transient RecA induction (data not
shown).
|
colony morphology, did not express detectable pili by transmission electron microscopy, and was incompetent for DNA transformation (data
not shown).
In addition to the five pilE mutant strains described above,
a control strain that expressed a P
colony morphology due
to normal sequence changes in pilE (BHAC5) was included.
This colony variant of VD300recA6 carries pilS1 copy 5 sequences in pilE. We have previously shown that
pilS1 copy 5 produces a predominance of P
colony variants of this strain (11). BHAC5 was over 100-fold less competent for DNA transformation than the P+
VD300recA6 parental strain during transient RecA induction
(data not shown). BHAC5 served as a control strain for the rate of
P
-to-P+ colony morphology variation when
wild-type pilE was present.
Quantifying pilE variation by a transformation
enrichment assay.
pilE variation, producing a
P
-to-P+ colony phase transition, was
detectable by visible inspection of colony morphology changes in two of
the six variants, BHANot5 and BHAC5 (data not shown). Therefore, a more sensitive assay to detect pilE variants of
each pilE mutant strain was used. Fully piliated
(P+) organisms are 100- to 10,000-fold more competent for
DNA transformation than nonpiliated organisms (7, 29, 31,
39). Moreover, P+ organisms are 5- to 1,000-fold more
competent for DNA transformation than P
colony variants
(7, 17). Therefore, the higher transformation competency of
P+ variants than that of P
variants was used
to enrich for P+ pilE variants. After induction
of RecA with IPTG, the strains were transformed with pSY6 DNA, which
confers Nalr. Many of the transformants expressed a
P+ colony phase morphology, showing that transformation
enrichment is effective. This result is similar to that of a previous
study (39) where 60 to 80% of transformants arising from
pilE point mutants had a P+ colony morphology.
While the transformation frequency could be used to estimate the
P
-to-P+ variation frequency, the different
levels of residual transformation competence of the P
mutants prevent an accurate comparison between mutants. Therefore, sequence analysis of the pilE gene in randomly selected
transformants from each strain was performed. Thirty to 90% of all
transformants from each P
strain had sequence changes in
pilE. Since variants with sequence changes in
pilE that do not increase transformation competence are not
detected by this assay, the frequency of production of Nalr
pilE variants does not directly measure the total frequency
of pilE variation. However, by correcting the transformation
frequency for the proportion of transformants that have a changed
pilE, a relative measure of pilE variation can be
obtained. We used this relative variation frequency to compare the
effects of pilE mutations on pilin variation.
Analysis of pilin variation in mutant strains.
Analysis of the
cys2 mutant stains BHAcat3 and BHANot4
showed that insertions in the pilE cys2 region did not block
recombination from all pilS copies (Table
2). This finding is in contrast to the
finding that with the same insertions in the pilS1 copy 3 cys2 region, recombination of 'cat or
NotI into pilE was never detected (frequency,
<10
9 or <10
4, respectively
[11]). However, the frequency of pilE
variation in BHAcat3 and BHANot4 was reduced
26- and 15-fold (3.8 and 6.7%, respectively) (Table 2) relative to
that of the P
control strain BHAC5. Therefore, insertions
in the cys2 region of pilE interfere with
recombination that can remove the insertion but do not block it.
|
control strain BHAC5 (pilS1 copy 5 HVL in
pilE) (Table 2). Therefore, a small insertion in the
pilE HVL does not affect the frequency of
antigenic variation. This result confirms the observation that a
pilS1 copy 3 HVL::NotI
mutation is efficiently transferred into pilE
(11) and shows that the HVL region can accept
minor changes in sequence without disrupting antigenic variation.
The 'cat insertion into the HVL region of
pilE (BHAcat5) demonstrated the most drastic
reduction in pilE variation: 0.2% or an average 511-fold
decrease relative to the level of variation in BHAC5 (Table 2). This
effect is consistent with the inability of the strain with
'cat in the HVL region of pilS1 copy
3 to create hybrid loci between pilE and pilS1
copy 3 (11). Southern blot and PCR analyses showed that 50 to 66% of the P+-enriched transformants of
BHAcat5 retained 'cat in pilE. These variants had either a pilE::'cat locus
that was larger than the parental
pilE::'cat locus or a wild-type-sized
pilE locus in addition to the original
pilE::'cat locus (data not shown).
Induction of RecA expression with IPTG resulted in a high-frequency
loss of the P+ phenotype (20 to 22% P
per
total CFU), suggesting that these enriched variants carried tandem
pilE sequences. The remaining 44 to 50% of P+
transformants of BHAcat5 were pilE variants that
had lost the 'cat insertion by recombination with a silent
copy (data not shown).
Finally, BHA-HV (pilE-
HVL) showed a decrease
in transformation-enriched pilE variation of 54-fold
relative to that of BHAC5 (01.9%) (Table 2), showing that deletion of
the HVL interferes with pilE variation.
Sequence analyses of independent P+ variants derived
from P
mutants.
The transformation efficiencies of
P+-enriched pilE variants showed that all
mutations in pilE, except for the
HVL::NotI mutation, reduced the
frequency of pilE variation relative to that of BHAC5. To
examine whether the mutations in pilE also altered the
spectrum of donor pilS copies available for recombination,
the pilE genes of 10 independently derived P+
variants from each P
strain were sequenced (Table
3). Analysis of the pilE gene
sequences from the P+ revertants of the P
control strain BHAC5 showed that six different pilE variants were isolated, with five different donor pilS copies. Two of
the P+ variants of BHAC5 had extensive sequence changes in
pilE, where most of the SV, HVL, and
HVT regions were replaced by pilS sequences. Three variants had changes in the HVL and HVT
regions, and three variants had changes solely in the HVL
region. We conclude that replacement of the pilE copy 5 HVL sequences is sufficient to produce a P+
variant in this strain and that the different amounts of
pilS sequence brought into pilE represent the
inherent variability of this system. Four of the five donor
pilS copies used to produce the P+ variants were
located adjacent to an SCR in the donor silent locus (SCR linked).
Therefore, while both SCR-linked and non-SCR-linked copies were used,
there was a preference for SCR-linked copies. We cannot determine
whether this preference was due to the proximity of these silent copies
to the SCR, a high affinity of these copies for the resident
pilE sequence during recombination, or an enhanced ability
of these particular HVLs to produce piliated, highly
competent variants of BHAC5.
|
HVL) strain was severely impaired
in its ability to undergo variation, both the spectrum of
pilS copies used and the different amounts of sequence
transferred during variation suggest that the mechanism(s) used for
variation in this strain is similar to that of BHAC5. However, 6 of 10 P+ variants were generated by recombination with a
pilS copy not linked to an SCR, which is in contrast to what
occurred with the other strains. It is notable that a majority of the
sequence changes in these variants ended at cys2, but the
basis for this is not known.
An SCR-linked silent copy can transfer a 'cat gene into
pilE.
Since the 'cat in the cys2 of
pilE could be replaced by sequence from an SCR-linked
pilS copy, albeit at a frequency 26-fold less than that of
the P
control, it was possible that the presence of the
SCR homology 3' of 'cat facilitated the recombination of
'cat from a pilS copy into pilE. To
test whether cys2::'cat could recombine
from an SCR-linked pilS copy into pilE, a strain
(BHAcat4) with 'cat in the cys2 region
of an SCR-linked copy was constructed (pilS1 copy 1::'cat). Cmr variants arose at a
frequency of about 10
5 per CFU, about 10-fold more
frequently than Cmr variants of BHAcat1
(pilS1 copy 3 cys2::'cat)
arose in a direct comparison (data not shown). Cmr variants
from four trials were analyzed by both PCR and Southern blot analyses
(data not shown). A majority of these Cmr variants of
BHAcat4 (66 to 83%) carried a pilE-pilS1 copy 2 hybrid locus in addition to all other normal pilin loci (class II)
(Fig. 2). Zero to 17% had a
pilE-copy 1 hybrid locus as well as all other normal pilin
loci (class I) (Fig. 2). Interestingly, 0 to 8.3% had copy
1::'cat sequences in pilE (they were
analogous to normal pilE antigenic variants) and 0 to 25%
had copy 2-copy 1::'cat sequences in
pilE (they were analogous to long pilin [L-pilin] variants). These results show that 'cat can recombine from
pilS into pilE as long as it is in an SCR-linked
pilS copy, but even with the more extensive homology
provided by the SCR, recombination of pilS copy
1::'cat with pilE usually resulted in
hybrid locus formation.
|
Recombination between pilin sequences can occur beyond the SCR. During construction of strain BHANot4 (cys2::NotI), a PacI linker replaced the ClaI site in the pilE SCR. This replacement increased the size of the pilE ClaI fragment. Southern blot analysis of Nalr transformants derived from BHANot4 revealed two differently sized fragments carrying pilE (Fig. 3). Several P+ variants of BHANot4 had the pilE locus on a larger ClaI fragment, identical in size to that of the parental strain, BHANot4. In these variants, recombination at pilE occurred upstream of the PacI site. The remaining 44% of P+ variants now had a pilE ClaI fragment that was the same size as that of VD300recA6. In these variants, recombination occurred through the SCR, restoring the ClaI site. This result is the first evidence that recombination during pilin variation can extend into the SCR but also shows that it does not have to extend past the ClaI site of the SCR.
|
| |
DISCUSSION |
|---|
|
|
|---|
Our previous study of mutations in pilS provided insights into which pilin sequences are required for antigenic variation (11). The present study of analogous mutations in pilE provides the first direct evidence that the donor and recipient genes act differently during variation, shows that correct spacing of conserved elements is required for efficient recombination, clarifies the role of conserved and variable pilin sequences during recombination, and supports the hypothesis that there are multiple recombination mechanisms that allow recombination between silent copies and the expression locus.
pilE variation, resulting in a
P
-to-P+ colony morphology switch, occurs in
wild-type Gc organisms at a frequency of about 1% and can be
quantified by observing changes in colony morphology in a
stereomicroscope. Since this method cannot detect lower frequencies of
colony variation, DNA transformation was used to enrich for P+ pilE variants from P
strains.
The relative frequency of pilE variants detected by this
method from the P
mutants does not directly measure
variation, since not all pilE variants provide a selectable
increase in transformation competence. Moreover, this method does not
correct for the differences in transformation efficiencies among the
spectrum of pilE variants generated from each strain
(17). However, this method does enrich for P+
pilE variants from each preinduced P
strain,
since 50 to 90% of all Nal transformants expressed a P+
colony morphology and/or sequence changes in pilE. It should be noted that, in the absence of recA preinduction,
transformation frequencies were low in each strain and that the few
transformants that were obtained did not show sequence changes in
pilE (data not shown). These findings show that these
mutants retain residual transformation competence (29) but
that the residual transformation competence is too low to influence the
selection for variants by transformation. Since pilE
variants made up similar percentages of the total numbers of
transformants from individual strains and increased transformation
efficiency was dependent on pilE variation, the
transformation enrichment method provides a reasonably accurate
assessment of the relative level of pilE variation in each strain.
Similar to results of our earlier studies, disruption of the pilE cys2 by either 'cat or a NotI linker did not prevent recombination upstream of cys2 but prevented recombination within the 3' end of cys2 or the HVT. In contrast to results of our previous studies, insertions in cys2 of pilE could be replaced by pilS sequences, albeit at a reduced frequency. However, all P+ variants derived from pilE cys2 mutants contained extensive sequence changes originating from a subset of SCR-linked pilS copies. The reduced frequency of recombination, extended recombination tracts, and limited repertoire of donor pilS sequences all point to the inhibition of a high-frequency recombination mechanism and an uncovering of a lower-frequency mechanism(s).
When 'cat was in the cys2 gene of
pilS1 copy 3, it was never found to transfer into
pilE even with chloramphenicol selection (11).
This result raises the question of whether the only difference between
the abilities of pilE and pilS1 copy 3 cys2 insertions to recombine is the presence of a linked
SCR. When 'cat was inserted into cys2 of an
SCR-linked pilS gene (BHAcat4 pilS1 copy
1::'cat), transfer of 'cat into
pilE was observed. However, the vast majority of
Cmr variants of BHAcat4 contained new pilin
hybrid loci comprised of sequences duplicated from portions of the
pilE and pilS1 copy 1::'cat
loci. The low-frequency transfer of 'cat from
pilS1 copy 1 into pilE resembles L-pilin
formation. First, both the frequency of L-pilin formation (1 to 2% of
P
variants [11]) and the frequency of
variants with a copy 1 cys2::'cat
sequence in pilE are much lower than the frequency of normal
pilE variation as directly measured by Serkin and Seifert (30). Second, both the transfer of
cys2::'cat and the transfer of extra
pilin sequences to create an L-pilin are dependent on SCR-linked
pilS sequence (18). Both the reduced efficiency
of transfer of a large region of heterology from pilS into
pilE and the SCR dependence of this reaction indicate that
this reaction is mechanistically different from recombination of short
pilS segments into pilE during normal pilin
antigenic variation. This putative alternate recombination mechanism
which generates L-pilin variants may also be operative in the
replacement of pilE cys2 insertions, which also occur with
reduced efficiency and involve extensive changes from an SCR-linked copy.
In our previous work, the presence of 'cat in the
HVL of pilS1 copy 3 prevented recombination
between pilE and copy 3 during hybrid-locus formation. In
strain BHAcat5, the 'cat in the HVL of pilE did not block recombination. However, recombination
at pilE in the pilE
HVL::'cat mutant was reduced over
500-fold. In addition, the only two pilS copies that
recombined with the mutant pilE were the upstream silent
copy linked to pilE and pilS2 copy 1. Both of
these copies are adjacent to a partial or full SCR, and both map just
upstream of pilE (9). Interestingly, using a
pilE
SCR mutant impaired in antigenic variation,
Wainwright et al. (37) found that only one of five
P+-to-P
colony phase variants had sequence
changes in pilE and that these variant sequences originated
from the pilS2 locus. These findings led to the hypotheses
that the recombination of pilS sequences in proximity to
pilE was not blocked by the pilE
SCR mutation and that it occurs by an alternative mechanism. Similarly, it appears
that 'cat in the HVL blocks most pilin antigenic
variation but that recombination with SCR-linked pilS copies
just upstream of pilE can still occur. We predict that
recombination of the silent copies located immediately upstream of
pilE is mechanistically distinct from recombination of
silent copies at distant loci.
In strain BHA-HV (
HVL), pilin variation was reduced
54-fold. Sequence analysis of the P+ transformants showed
that, in each case, short tracts of pilS sequence had
replaced the deletion. P+ variants had sequences from a
varied repertoire of pilS genes, including pilS
copies not linked to an SCR. Since the types of recombinants were
similar to those with wild-type pilE, we conclude that the
HVL is dispensable for antigenic variation. However, since
recombination was drastically reduced, it is clear that the alteration
in spacing between cys1 and cys2 and/or the loss of conserved sequence at the end of cys1 affects the
efficiency of recombination. Why the deletion of the HVL
sequences shifts the preference to a non-SCR-linked copy is not known.
Since recombination during pilin variation is predominantly a gene conversion event, we have assumed that the recipient gene (pilE) must be treated differently from the donor pilS copy. The data presented here provide the first experimental support for this assumption. We also conclude from the effects of both insertions in pilE and different pilS copies and the deletion in pilE that the spacing of conserved elements in the interacting DNAs is crucial for efficient recombination. We have previously proposed a model for the movement of DNA during pilin variation that invokes an initiating recombination reaction between a donor pilS copy and a donor pilE at a region of identity (8 to 40 bp) to produce a circular hybrid intermediate and that circular pilE-pilS hybrid intermediates can recombine with a recipient pilE to mediate pilin variation (10a, 11). This model is consistent with the data presented herein, since it incorporates different roles for pilS copies, which act only as donors, and the pilE locus, which acts as both a donor and a recipient. However, this model does not explain why the correct spacing of conserved elements would be required for efficient variation. Moreover, we have found that the proposed covalently closed, circular intermediates carrying hybrid loci (11) are not formed frequently enough in Gc organisms to be the predominate intermediate of pilin variation (10a). We have indirect evidence that a majority of hybrid intermediates formed are in a recombinogenic form and that when a pilE-pilS hybrid intermediate is produced, it is very efficient at mediating recombination with a recipient pilE (10a). Therefore, pilE-pilS hybrid intermediates remain a central feature of our working model. Based on all our data, we postulate that the majority of variation intermediates are partially single stranded and that multiple conserved portions of the recombining genes need to base pair to enable recombination (Fig. 4). This base pairing would require a synaptase and/or the action of an exonuclease. The effect of 'cat insertions in the HVL show that the relative spacing between cys1 and cys2 in the donor pilE gene and pilS copy is required for hybrid-locus formation (11). We have not examined whether this spacing is also required for recombination of a pilE-pilS hybrid intermediate into the recipient pilE. This revised model accounts for the requirement for maintaining spacing between conserved elements for efficient pilin variation. Proof of this model awaits the isolation of the true intermediates of pilin variation but takes into account all of the observed features of antigenic variation.
|
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by NIH grant AI33493.
Review of the manuscript by J. Dillard, D. Tobiason, L. Stohl, and K. Forest is greatly appreciated. Recommendations by K. Forest on the portions of the HVL to delete to retain other pilin structural motifs were very helpful.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Microbiology-Immunology, S213, Northwestern University Medical School, 303 East Chicago Ave., Chicago, IL 60611. Phone: (312) 503-9788. Fax: (312) 503-1339. E-mail: h-seifert{at}nwu.edu.
Present address: Department of Medical Microbiology and Immunology,
University of Wisconsin
Madison, Madison, WI 53706.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Bergström, S.,
K. Robbins,
J. M. Koomey, and J. Swanson.
1986.
Piliation control mechanisms in Neisseria gonorrhoeae.
Proc. Natl. Acad. Sci. USA
83:3890-3894 |
| 2. | Boyle-Vavra, S., and H. S. Seifert. 1995. Shuttle mutagenesis: a mini-transposon for producing PhoA fusions with exported proteins in Neisseria gonorrhoeae. Gene 155:101-106[Medline]. |
| 3. |
Boyle-Vavra, S., and H. S. Seifert.
1996.
Uptake-sequence-independent DNA transformation exists in Neisseria gonorrhoeae.
Microbiology
142:2839-2845 |
| 4. | Boyle-Vavra, S., M. So, and H. S. Seifert. 1993. Transcriptional control of gonococcal pilE expression: involvement of an alternate sigma factor. Gene 137:233-236[Medline]. |
| 5. | Brinton, C. C., J. Bryan, J.-A. Dillon, N. Guernia, L. J. Jackobson, A. Labik, S. Lee, A. Levine, S. Lim, J. McMichael, S. A. Polen, K. Rogers, A. C.-C. To, and S. C.-M. To. 1978. Uses of pili in gonorrhea control: role of bacterial pili in disease, purification, and properties of gonococcal pili and progress in the development of a gonococcal pilus vaccine for gonorrhea, p. 155-178. In G. F. Brooks, E. C. Gotschlich, K. K. Holmes, W. D. Sawyer, and F. E. Young (ed.), Immunobiology of Neisseria gonorrhoeae. American Society for Microbiology, Washington, D.C.. |
| 6. |
Elkins, C.,
C. E. Thomas,
H. S. Seifert, and P. F. Sparling.
1991.
Species-specific uptake of DNA by gonococci is mediated by a 10-base-pair sequence.
J. Bacteriol.
173:3911-3913 |
| 7. | Gibbs, C. P., B. Y. Reimann, E. Schultz, A. Kaufmann, R. Haas, and T. F. Meyer. 1989. Reassortment of pilin genes in Neisseria gonorrhoeae occurs by two distinct mechanisms. Nature 338:651-652[Medline]. |
| 8. | Haas, R., and T. F. Meyer. 1986. The repertoire of silent pilus genes in Neisseria gonorrhoeae: evidence for gene conversion. Cell 44:107-115[Medline]. |
| 9. |
Haas, R.,
H. Schwarz, and T. F. Meyer.
1987.
Release of soluble pilin antigen coupled with gene conversion in Neisseria gonorrhoeae.
Proc. Natl. Acad. Sci. USA
84:9079-9083 |
| 10. | Hagblom, P., E. Segal, E. Billyard, and M. So. 1985. Intragenic recombination leads to pilus antigenic variation in Neisseria gonorrhoeae. Nature 315:156-158[Medline]. |
| 10a. | Howell-Adams, B., and H. S. Seifert. Submitted for publication. |
| 11. | Howell-Adams, B., L. A. Wainwright, and H. S. Seifert. 1996. The size and position of heterologous insertions in a silent locus differentially affect pilin recombination in Neisseria gonorrhoeae. Mol. Microbiol. 22:509-522[Medline]. |
| 12. | Jonsson, A. B., G. Nyberg, and S. Normark. 1991. Phase variation of gonococcal pili by frameshift mutation in pilC, a novel gene for pilus assembly. EMBO J. 10:477-488[Medline]. |
| 13. |
Kellogg, D. S., Jr.,
W. L. Peacock, Jr.,
W. E. Deacon,
L. Brown, and C. I. Pirkle.
1963.
Neisseria gonorrhoeae. I. Virulence genetically linked to clonal variation.
J. Bacteriol.
85:1274-1279 |
| 14. |
Koomey, J. M., and S. Falkow.
1987.
Cloning of the recA gene of Neisseria gonorrhoeae and construction of gonococcal recA mutants.
J. Bacteriol.
169:790-795 |
| 15. |
Koomey, M.,
E. C. Gotschlich,
K. Robbins,
S. Bergström, and J. Swanson.
1987.
Effects of recA mutations on pilus antigenic variation and phase transitions in Neisseria gonorrhoeae.
Genetics
117:391-398 |
| 16. | Koomey, M., E. C. Gotschlich, K. Robbins, S. Bergstrom, and J. Swanson. 1987. Effects of recA mutations on pilus antigenic variation and phase transitions in Neisseria gonorrhoeae. Genetics 117:391-398. |
| 17. |
Long, C. D.,
R. N. Madraswala, and H. S. Seifert.
1998.
Comparisons between colony phase variation of Neisseria gonorrhoeae FA1090 and pilus, pilin, and S-pilin expression.
Infect. Immun.
66:1918-1927 |
| 18. | Manning, P. A., A. Kaufmann, U. Roll, J. Pohlner, T. F. Meyer, and R. Haas. 1991. L-pilin variants of Neisseria gonorrhoeae MS11. Mol. Microbiol. 5:917-926[Medline]. |
| 19. | McGee, Z. A., D. S. Stephens, L. H. Hoffman, W. F. Schlech, and R. G. Horn. 1983. Mechanisms of mucosal invasion by pathogenic Neisseria. Rev. Infect. Dis. 5(Suppl. 4):S708-S714. |
| 20. | Mehr, I. J., and H. S. Seifert. 1998. Differential roles of homologous recombination pathways in Neisseria gonorrhoeae pilin antigenic variation, DNA transformation, and DNA repair. Mol. Microbiol. 30:697-710[Medline]. |
| 21. |
Meyer, T. F.,
E. Billyard,
R. Haas,
S. Storzbach, and M. So.
1984.
Pilus genes of Neisseria gonorrhoeae: chromosomal organization and DNA sequence.
Proc. Natl. Acad. Sci. USA
81:6110-6114 |
| 22. |
Norlander, L.,
J. Davies,
A. Norqvist, and S. Normark.
1979.
Genetic basis for colonial variation in Neisseria gonorrhoeae.
J. Bacteriol.
138:762-769 |
| 23. | Perry, A. C., I. J. Nicolson, and J. R. Saunders. 1987. Structural analysis of the pilE region of Neisseria gonorrhoeae P9. Gene 60:85-92[Medline]. |
| 24. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 25. | Segal, E., E. Billyard, M. So, S. Storzbach, and T. F. Meyer. 1985. Role of chromosomal rearrangement in N. gonorrhoeae pilus phase variation. Cell 40:293-300[Medline]. |
| 26. |
Segal, E.,
P. Hagblom,
H. S. Seifert, and M. So.
1986.
Antigenic variation of gonococcal pilus involves assembly of separated silent gene segments.
Proc. Natl. Acad. Sci. USA
83:2177-2181 |
| 27. | Seifert, H. S. 1997. Insertionally inactivated and inducible recA alleles for use in Neisseria. Gene 188:215-220[Medline]. |
| 28. | Seifert, H. S., R. S. Ajioka, C. Marchal, P. F. Sparling, and M. So. 1988. DNA transformation leads to pilin antigenic variation in Neisseria gonorrhoeae. Nature 336:392-395[Medline]. |
| 29. |
Seifert, H. S.,
R. S. Ajioka,
D. Paruchuri,
F. Heffron, and M. So.
1990.
Shuttle mutagenesis of Neisseria gonorrhoeae: pilin null mutations lower DNA transformation competence.
J. Bacteriol.
172:40-46 |
| 30. |
Serkin, C. D., and H. S. Seifert.
1998.
Frequency of pilin antigenic variation in Neisseria gonorrhoeae.
J. Bacteriol.
180:1955-1958 |
| 30a. | Serkin, C. D., and H. S. Seifert. Unpublished observations. |
| 31. |
Sparling, P. F.
1966.
Genetic transformation of Neisseria gonorrhoeae to streptomycin resistance.
J. Bacteriol.
92:1364-1371 |
| 32. | Stein, D. C. 1991. Transformation of Neisseria gonorrhoeae: physical requirements of the transforming DNA. Can. J. Microbiol. 37:345-349[Medline]. |
| 33. | Swanson, J. 1973. Studies on gonococcus infection. IV. Pili: their role in attachment of gonococci to tissue culture cells. J. Exp. Med. 137:571-589[Abstract]. |
| 34. |
Swanson, J.,
S. Bergstrom,
K. Robbins,
O. Barrera,
D. Corwin, and J. M. Koomey.
1986.
Gene conversion involving the pilin structural gene correlates with pilus+ in equilibrium with pilus changes in Neisseria gonorrhoeae.
Cell
47:267-276[Medline].
|
| 35. |
Swanson, J.,
S. Morrison,
O. Barrera, and S. Hill.
1990.
Piliation changes in transformation-defective gonococci.
J. Exp. Med.
171:2131-2139 |
| 36. |
Wainwright, L. A.,
J. V. Frangipane, and H. S. Seifert.
1997.
Analysis of protein binding to the Sma/Cla DNA repeat in pathogenic neisseriae.
Nucleic Acids Res.
25:1362-1368 |
| 37. | Wainwright, L. A., K. H. Pritchard, and H. S. Seifert. 1994. A conserved DNA sequence is required for efficient gonococcal pilin antigenic variation. Mol. Microbiol. 13:75-87[Medline]. |
| 38. |
Wright, C. J.,
A. E. Jerse,
M. S. Cohen,
J. G. Cannon, and H. S. Seifert.
1994.
Nonrepresentative PCR amplification of variable gene sequences in clinical specimens containing dilute, complex mixtures of microorganisms.
J. Clin. Microbiol.
32:464-468 |
| 39. |
Zhang, Q. Y.,
D. DeRyckere,
P. Lauer, and M. Koomey.
1992.
Gene conversion in Neisseria gonorrhoeae: evidence for its role in pilus antigenic variation.
Proc. Natl. Acad. Sci. USA
89:5366-5370 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»