Previous Article | Next Article ![]()
Journal of Bacteriology, January 1999, p. 368-374, Vol. 181, No. 2
Department of Bacteriology, University of
Wisconsin
Received 3 August 1998/Accepted 3 November 1998
The eutF locus of Salmonella typhimurium
LT2 was identified as a locus necessary for the utilization of
ethanolamine as a sole carbon source. Initial models suggested that
EutF was involved in either ethanolamine transport or was a
transcriptional regulator of an ethanolamine transporter. Phenotypic
characterization of eutF mutants suggested EutF was somehow
involved in 1,2-propanediol, propionate, and succinate utilization.
Here we provide evidence that two alleles defining the eutF
locus, Salmonella typhimurium
and Escherichia coli can use the nonfermentable amino
alcohol ethanolamine as the sole carbon and/or nitrogen source (8,
21). The initial step in the catabolism of ethanolamine involves
the cleavage of ethanolamine into acetaldehyde and ammonia by the
adenosylcobalamin (AdoCbl)-dependent enzyme ethanolamine ammonia-lyase
(5, 7, 8). In addition to the requirement of AdoCbl for the
enzymatic degradation of ethanolamine, work with S. typhimurium has shown that AdoCbl is also required for the
induction of the genetically defined eut operon (35, 36, 45). This operon encodes proteins involved in ethanolamine catabolism in this bacterium and E. coli (5, 6, 37,
48). The requirement of AdoCbl for both ethanolamine catabolism
and eut operon expression presents a challenge to these
organisms growing aerobically, since S. typhimurium can
synthesize AdoCbl de novo only under anaerobic conditions and E. coli is unable to synthesize the complete coenzyme de novo
(20, 24). Both organisms meet this challenge by using
transport systems to acquire exogenous complete and incomplete
corrinoids under aerobic conditions.
Transport of exogenous cobalamin (Cbl) and other corrinoids from the
environment into the cytoplasm of S. typhimurium or E. coli requires two independently functioning transport systems; the
first actively transports Cbl across the outer membrane, while the
second transports Cbl across the cytoplasmic membrane (10). Transport across the outer membrane involves BtuB, a high-affinity outer membrane receptor for Cbl, and the TonB-dependent
energy-transducing complex consisting of the cytoplasmic membrane
proteins TonB, ExbB, ExbD, and other, yet to be identified proteins
(4, 18, 32, 46). TonB is anchored in the cytoplasmic
membrane and spans the periplasm to interact directly with a number of
outer membrane receptors involved in Cbl or ferric siderophore
transport (32). The TonB-dependent energy-transducing
complex couples electrochemical potential from the cytoplasmic membrane
to the active transport of Cbl and ferric siderophores across the outer membrane. In the absence of a functional transport system, aerobically growing cells become starved for iron and respond by hypersecreting siderophores in a futile attempt to access iron. More relevant to
ethanolamine utilization, these cells cannot access exogenous Cbl
unless Cbl is present in a concentration high enough to overcome the
transport defect (4, 34). Transport across the cytoplasmic membrane is carried out by the ABC transport system of BtuB, BtuC, and
BtuD and functions independently of the TonB-dependent system (10).
eutF mutants were originally identified by the inability to
grow on ethanolamine as a sole source of carbon, and EutF was proposed
to play a role in ethanolamine transport or regulation of an
ethanolamine transporter (28). Since then, we have also observed other phenotypes associated with eutF mutations
which included the inability to grow on 1,2-propanediol as a sole
carbon source and reduced growth rates on the nonfermentable carbon
sources propionate and succinate (30). Here we present
evidence that these phenotypes are the result of
partial-loss-of-function tonB alleles and are not due to a
new gene locus.
Bacteria, media, and growth conditions.
The bacterial
strains and plasmids used in this study are listed in Table
1. Carbon source utilization was tested
on no-carbon medium E (NCE) (9, 49) supplemented with 1 mM
MgSO4, 0.3 mM methionine, 0.1 mM tryptophan, 15 nM
cyanocobalamin (CNCbl), and, as a carbon source, 30 mM ethanolamine,
1,2-propanediol, propionate, succinate, or glycerol. Concentrations
were the same regardless of whether growth was tested on solid or
liquid medium. The final concentrations of antibiotics in complex
medium were 20 (tetracycline), 50 (kanamycin), 20 (chloramphenicol),
and 100 (ampicillin) µg/ml. In NCE medium, the final concentrations
used were 10, 100, 10, and 50 µg/ml, respectively. Growth of cultures at 37°C was monitored with a Spectronic 20D spectrophotometer (Milton
Roy Co., Rochester, N.Y.) at 650 nm. CAS medium was a gift from
Michelle R. Rondon. All experiments were done under aerobic conditions.
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Molecular Characterization of eutF Mutants of
Salmonella typhimurium LT2 Identifies eutF
Lesions as Partial-Loss-of-Function tonB Alleles
and
Madison, Madison, Wisconsin 53706-1567
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References
903 and eutF1115, are partial-loss-of-function tonB alleles. Both mutations were
complemented by plasmids containing a wild-type allele of the
Escherichia coli tonB gene. Immunoblot analysis using TonB
monoclonal antibodies detected a TonB fusion protein in strains
carrying eutF alleles. Molecular analysis of the
903 allele identified a deletion that resulted in the
fusion of the 3' end of tonB with the 3' end of trpA. In-frame translation of the tonB-trpA
fusion resulted in the final 9 amino acids of TonB being replaced by a
45-amino-acid addition. We isolated a derivative of a strain carrying
allele
903 that regained the ability to grow on
ethanolamine as a carbon and energy source. The molecular
characterization of the mutation that corrected the Eut
phenotype caused by allele
903 showed that the new
mutation was a deletion of two nucleotides at the tonB-trpA
fusion site. This deletion resulted in a frameshift that replaced the
45-amino-acid addition with a 5-amino-acid addition. This change
resulted in a TonB protein with sufficient activity to restore growth
on ethanolamine and eut operon expression to nearly
wild-type levels. It was concluded that the observed EutF phenotypes
were due to the partial loss of TonB function, which is proposed to
result in reduced cobalamin and ferric siderophore transport in an
aerobic environment; thus, the eutF locus does not exist.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References
TABLE 1.
S. typhimurium LT2 strains and plasmids used
Genetic techniques. (i) Transductions. All transductional crosses were performed with mutant phage P22 HT105 int-201 (42, 43), and all phage manipulations were performed as previously described (9).
(ii) Isolation of allele
1235.
The derivative of
strain JE1418 capable of growing on ethanolamine as a carbon and energy
source was isolated by plating JE1418 on NCE minimal medium
supplemented with ethanolamine as a carbon source. Portions of 10 independent cultures (~109 cells) were plated
individually. After incubation for 3 days, we recovered a single colony
with a reversion rate estimated to be 10
9. The mutant
strain JE4386 was reconstructed by growing phage P22 on the revertant,
using the phage lysate as the donor to transduce strain JE1418 to
Eut+, and then further characterized. A Tn10
16
17 element (50) [referred to as
Tn10d(Tc)] located near
1235 was isolated by genetic means as described elsewhere (12). This transposon
[zde-6396::Tn10d(Tc)] was ca. 30%
cotransducible with
1235 by phage P22.
Recombinant DNA techniques. (i) Plasmid constructions. To make pTONB1, pRZ526 was digested to completion with HpaI and the ~4.9-kb fragment containing the original insert was gel purified by the QIAquick gel extraction protocol as instructed by the manufacturer (Qiagen Inc., Valencia, Calif.). This fragment was digested to completion with BglII; the ca. 3,100-bp fragment containing tonB, yciC, yciB, and yciA was gel purified by QIAquick gel extraction and cloned into the BamHI/HincII site of vector pSU19, resulting in plasmid pTONB1.
To make pYCIBC, pTONB1 was digested to completion with SnaB1 and SmaI. Digested DNA was religated, and resulting plasmids were screened for the loss of the SnaB1/SmaI fragment containing tonB and yciA. The resulting plasmid, pYCIBC, contained yciB and yciC cloned in the direction of the lac promoter of pSU19.(ii) PCR amplification of tonB from TR6583 and JE1291. tonB was PCR amplified from chromosomal DNA of boiled whole cells of TR6583 and JE1291. An 860-bp amplified product was generated by using the following primers in a standard PCR mixture: 5'tonB (5' TTCAGCTCTGGTTTTTCA 3', corresponding to bases 82 to 99 of the published tonB sequence [16]) and 3'tonB (5' TCCGACGGTAAACCTCGC 3'; corresponding to bases 941 to 924 of the published tonB sequence [16]). The amplification profile was as follows: 94°C for 5 min; 30 cycles of 94°C for 1 min, 50°C for 1 min, and 72°C for 1 min; 72°C for 10 min; 4°C for 12 h. All primers used in this study were obtained from Integrated DNA Technology, Inc. (Coralville, Iowa).
(iii) PCR amplification of tonB from strain JE1418
(
903).
tonB was amplified from strain JE1418
chromosomal DNA by using boiled whole cells as the template. The
universal Tn10 primer (2) was used in conjunction
with the 5'tonB primer described above to amplify the DNA
between
trpC3480::Tn10d(Cmr) to the
5' end of tonB. The amplification profile was as follows: 94°C for 5 min; 30 cycles of 94°C for 1 min, 50°C for 1 min, and 72°C for 3 min; 72°C for 10 min; 4°C for 12 h.
(iv) PCR amplification of tonB from strain JE2123
(
1235).
tonB was amplified from JE2123
chromosomal DNA by using boiled whole cells as the template. The
trpA primer 5' AGCTTAAAGAGTACCATGCC 3'
(corresponding to bp 665 to 685 of the trpA sequence
[26]) was used in amplifications with the
5'tonB primer described above to amplify from the
trpA coding region, across the deletion, to the 5' end of
tonB. The amplification protocol was the same as for the
universal Tn10 and 5'tonB primers discussed above.
(v) DNA sequencing of PCR products. All PCR products used for sequencing were purified by using a QIAquick gel extraction kit as instructed by the manufacturer. All sequencing was done by nonradioactive sequencing at the Nucleic Acid and Protein Facility at the University of Wisconsin Biotechnology Center. Primers used for sequencing include those described above in addition to the primer tonB DEL (5' GCATCGGCGACCAGCAAG 3', corresponding to bases 538 to 555 of the S. typhimurium tonB sequence [16]).
Biochemical procedures. (i)
-Galactosidase assays.
-Galactosidase activity assays were performed by a modification of
the method of Miller (25) as described elsewhere
(14).
(ii) Immunoblot analysis of TonB. Immunoblot analysis of TonB was done as previously described (23), with minor modifications. Briefly, cells were grown in NCE medium supplemented with glycerol (30 mM), MgSO4 (1 mM), methionine (0.3 mM), and tryptophan 0.1 mM, in the presence or absence of FeSO4 (45 µM). Cells were grown to A650 of 0.5 in 5 ml of NCE medium. A 1-ml sample of culture was removed, diluted with 0.5 ml of 15% trichloroacetic acid, and incubated on ice for 30 min. The acid-precipitated material was pelleted, washed once with 1.0 M Tris-Cl (pH 8.0) at 25°C, resuspended in 50 µl of 2× sample buffer, and boiled for 5 min. Samples were then resolved by sodium dodecyl sulfate-12% polyacrylamide gel electrophoresis (SDS-PAGE) (22) and transferred to an Immobilon-P membrane (Millipore, Bedford, Mass.) by means of a Mini Trans-Blot apparatus (Bio-Rad, Richmond, Calif.) at 100 V for 1 h according to the manufacturer's specifications. Immunoblot analyses were performed according to the Phototope-horseradish peroxidase Western blot detection kit (New England Biolabs, Inc., Beverly, Mass.) protocol, with minor modifications. Membranes were blocked at 25°C overnight, and 1× Tris-buffered saline-0.1% Tween 20-5% dry milk was used for all incubations. Mouse monoclonal antibody 4H4 (a gift from Kathleen Postle) was used at a 1:5,000 dilution. The secondary antibody was horseradish peroxidase-conjugated donkey anti-mouse immunoglobulin G (a gift from Heidi Goodrich-Blair) diluted 1:20,000. X-ray film (XAR-50; Kodak) was used to detect signal.
| |
RESULTS |
|---|
|
|
|---|
eutF mutants were identified by the inability to grow on ethanolamine as source of carbon (28). Two of the mutants, one putative point mutant (strain JE1690) and a deletion mutant (strain JE1418), are characterized in this study.
The strain carrying allele
903 (JE1418) was reported to
be able to use ethanolamine as a sole nitrogen source but not as a sole
carbon source, suggesting the eutF locus was only partially affected by this mutation. Characterization of strain JE1418 revealed that the eutF locus mapped between the trp operon
and tonB. Strain JE1418 was found to be a tryptophan
auxotroph, thus defining one end of the deletion somewhere within the
trp operon. The other end of the deletion was determined
based on the following tests for TonB protein function. First, strain
JE1418 was sensitive to infection by bacteriophage ES18, which requires
a functional TonB protein for infection (47). Second, strain
JE1418 could use CNCbl or AdoCbl for the synthesis of methionine at a
concentration of 15 nM. tonB mutants require micromolar
concentrations of Cbl to overcome the transport defect (4).
The putative point mutant showed TonB function as defined by these two
criteria (data not shown). Further phenotypic analysis of the
eutF locus determined that eutF mutants were
unable to grow on 1,2-propanediol as the sole carbon source and had
reduced growth rates on the nonfermentable carbon sources propionate
and succinate (30).
Complementation of eutF mutants.
Attempts to
isolate a complementing clone from an S. typhimurium library
were unsuccessful. However, complementation of the EutF phenotypes was
achieved with a plasmid carrying an ~4,900-bp fragment containing the
E. coli tonB locus and surrounding loci. This plasmid,
pRZ526, also contained a fragment of bacteriophage
80 DNA
(33). Plasmid pRZ526 complemented strains JE1418 and JE1690
for growth on ethanolamine, suggesting that pRZ526 contained the
eutF locus (Fig. 1). This
finding suggested that the eutF locus was complemented by
one (or more) of five possible E. coli genes or
possibly by a
80 gene. To narrow the possibilities, complementation
was tested with plasmid pRZ531 (Fig. 1). pRZ531 complemented both
JE1418 and JE1690, suggesting eutF was not yciA, yciC, or
80 DNA. Previous minicell analysis of protein
expression from pRZ531 determined that only two proteins were
synthesized from this cloned region of E. coli DNA
(33). The apparent molecular weights of the products, based
on SDS-PAGE analysis, suggested these proteins were TonB and
YciB. To address whether yciB was eutF,
yciB and yciC were subcloned from pRZ526
resulting in plasmid pYCIBC (Fig. 1). Plasmid pYCIBC failed to
complement strain JE1418 or JE1690, suggesting that yciB was
not eutF. These results supported the previous finding that
yciC was not involved in the complementation of EutF
phenotypes.
|
eutF alleles result in a TonB phenotype. To show that strains JE1418 and JE1690 contained lesions that affected tonB function, we tested both strains for the hypersecretion of siderophores. Disruption of TonB function causes a hypersecretion of siderophores due to iron starvation, and the presence of the secreted siderophores can be indirectly detected by the use of CAS medium (44). Both strains (JE1418 and JE1690) grown on CAS medium resulted in large orange-yellow zones around the colonies, diagnostic of siderophore hypersecretion. tonB+ control strains TR6583 and JE1291 showed no significant zones (data not shown).
Taken together, the complementation of EutF phenotypes by wild-type tonB+ and siderophore hypersecretion by strains JE1418 and JE1690 strongly suggested eutF and tonB were allelic.Altered TonB proteins in eutF mutants. To analyze directly whether TonB was altered in eutF mutants, immunoblotting using an anti-TonB monoclonal antibody was performed to detect chromosomally expressed TonB protein in wild-type and mutant strains (Fig. 2).
|
Iron-dependent regulation of tonB expression in eutF mutants. TonB protein levels in S. typhimurium and E. coli are reduced in the presence of high concentrations of iron due to Fur regulation of tonB expression (31, 51). To ensure that iron regulation of tonB was still functional, we grew strains JE1418 and JE1690, along with the wild-type controls, in the presence or absence of 45 µM FeSO4 and detected TonB by immunoblotting as discussed above. Since we routinely use NCE medium without iron supplementation, all strains were expected to express TonB at some increased level to scavenge residual iron in the medium, as seen in studies of tonB regulation in E. coli (51). Upon addition of FeSO4 to the medium, and assuming that the promoter region of tonB is intact, there should be a reduction in the level of TonB. All strains showed iron regulation of TonB levels (Fig. 2), consistent with the promoter region of tonB being unaffected in both eutF mutants.
The analysis of our data was initially complicated by the confusion in the literature regarding the orientation of the tonB gene in S. typhimurium. The S. typhimurium genetic maps published after 1988 all show tonB expression in the same direction as the trp operon (39, 40). However, the original publication discussing the orientation of tonB (19) and the S. typhimurium genetic map published in 1988 (41) showed tonB and the trp operon as convergently transcribed. The results shown here are consistent with the proposal for convergent transcription (discussed further below). Therefore, the TonB fusion protein detected in JE1418 was concluded to be the result of a fusion to the carboxy terminus of TonB.Physical characterization of tonB in strains JE1418 and JE1690. To show that tonB was eutF, we attempted amplification and sequencing of chromosomal tonB alleles in strains JE1418 and 1690. Primers flanking tonB allowed amplification and sequencing of the complete coding region of tonB. For both of the tonB+ strains TR6583 and JE1291, an 860-bp product was amplified as expected from the published sequence (16) (data not shown). The product from TR6583 was sequenced, and the results were consistent with the amplified product being tonB (data not shown). In a control experiment, the cobU gene of S. typhimurium was amplified in a parallel reaction and always resulted in successful amplification from both wild-type and mutant DNAs (data not shown).
(i) DNA sequence analysis of the tonB allele in strain
JE1418.
Reactions using DNA from strain JE1418 failed to produce
an amplified tonB product. These results supported the
hypothesis that tonB was affected by the
903
allele in this strain. To characterize the
903 allele in
strain JE1418, the transposition-deficient element
trpC3480::Tn10d(Cm) (>90%
cotransducible with allele
903) was recombined into the
chromosome of JE1418, with retention of the
903 mutation
(strain JE4163). The DNA between the insertion and the 5' end of
tonB was amplified by using a primer specific for the end of
the insertion and the 5'tonB primer. The amplification product (ca. 3,000 bp) was sequenced by using the transposon primer. DNA sequence information determined the trpC sequence on one
side of the PCR product, while the 5'tonB primer determined
the tonB sequence as expected (data not shown). Primer
walking from the tonB side of the PCR product identified the
deletion site of strain JE4163 (Fig. 3A). Sequence data demonstrated
that the fusion of tonB with trpA resulted in the
removal of the last nine codons of tonB. In-frame
translation across the tonB-trpA junction predicted the
removal of the final 9 amino acids of TonB and the addition of 45 amino
acids after amino acid 231 of wild-type TonB (Fig. 3B). These data
confirmed that tonB was disrupted in strains carrying the
903 allele and that the orientation of tonB
transcription was toward the trp operon as originally
proposed (19).
80 infectivity or growth response to ferrichrome or vitamin
B12 (3). Therefore, we believe that the
phenotype of JE1418 is not due to the rapid degradation of the TonB
fusion protein but instead is due to the addition of 45 amino acids to the C-terminus causing a partial-loss-of-function TonB fusion protein.
(ii) DNA sequence analysis of the tonB allele in strain
JE1690.
Surprisingly, tonB could not be amplified from
the putative point mutant, strain JE1690, which suggested that the
inability to amplify tonB from JE1690 was probably due to
the deletion of one of the tonB primer sites. We
hypothesized that the 3' end of tonB in this strain was
affected since the 5'tonB primer was designed to hybridize
immediately downstream of the
10 region, and hence a deletion that
removed this site would abolish tonB expression.
903 allele in JE1418, since the
two strains are phenotypically distinct (28).
Isolation and characterization of a mutation that restores growth
of strain JE1418 on ethanolamine.
Before determining that
tonB was disrupted in strain JE1418, we isolated a
derivative of it capable of growing on ethanolamine as a sole carbon
source. This revertant strain displayed eut operon expression to ca. 60% of the level measured in a wild-type strain in
the presence of ethanolamine and Cbl (Table
2). A Tn10d(Tc) insertion
linked to the mutation causing this reversion was isolated and found to
be ca. 30% cotransducible with the
903 allele by phage
P22. This result raised the possibility that the mutation causing the
reversion was in tonB.
|
1235). Analysis of DNA sequence data
determined that the revertant strain carried a deletion of two bases at
the junction site of tonB and trpA (Fig.
3A). This deletion (
1235)
resulted in a frameshift in the coding region of the tonB
allele generated by
903. The net result was a replacement
of the 45-amino-acid addition seen in strain with the
903
allele by 5 amino acids in strain JE2123 (Fig. 3B). The restored
ability of strain JE2123 to grow on ethanolamine, and the
near-wild-type eut operon expression observed in this strain
clearly showed that the observed EutF phenotypes were due to mutations
in tonB and not to the deletion of an unidentified gene.
|
| |
DISCUSSION |
|---|
|
|
|---|
Data presented herein show that the mutations initially defining
the eutF locus are partial-loss-of-function tonB
alleles. This conclusion is based on the following findings: (i)
mutations in the eutF locus can be complemented by a plasmid
containing only the wild-type allele of the tonB gene from
E. coli; (ii) eutF mutant strains hypersecrete
siderophores, consistent with lesions in tonB; (iii)
immunoblot analyses of TonB from both mutant strains suggest the
synthesis of an unstable TonB fusion protein; (iv) sequencing of
tonB from a eutF mutant, JE1418
(
903), showed that the mutation resulted in the
replacement of the final 9 amino acids of TonB with 45 amino acids from
a tonB-trpA gene fusion; and (v) a 2-bp deletion
(
1235) in the coding region of the tonB-trpA gene fusion of strain JE1418 removed the bulky addition to the carboxy
terminus of TonB, resulting in a partially functional TonB protein.
Why were eutF mutants not identified as mutants partially defective in tonB function? The initial characterization of eutF mutants originally eliminated tonB from consideration for two reasons. First, eutF strains were still sensitive to infection by bacteriophage ES18, which requires a functional tonB locus for infection (47). Second, both strains were able to grow in the presence of CNCbl or AdoCbl at a concentration of 15 nM. tonB mutants require micromolar concentrations of Cbl to overcome the TonB transport mutation (4). We now believe that the original phenotypic screen for eutF alleles led to the isolation of partial-loss-of-function tonB alleles. Strain JE1418 was isolated in a screen for deletions of cobA, a gene encoding the adenosyltransferase enzyme involved in AdoCbl biosynthesis. cobA mutants do not grow on ethanolamine as a sole carbon source because (i) ethanolamine ammonia-lyase requires AdoCbl as a coenzyme and (ii) cobA mutants cannot synthesize AdoCbl (15). Strain JE1418 did not grow on ethanolamine but was found to be wild type for cobA, which suggested that an alternative locus was responsible for the phenotype; this locus was named eutF (28).
The strain used in our laboratory to study cobalamin biosynthesis is TR6583, which contains a metE205 mutation that disrupts the Cbl-independent methionine synthase gene. Strain TR6583, therefore, is dependent on exogenous methionine or must use the Cbl-dependent methionine synthase, which requires the addition of exogenous Cbl in an aerobic environment. All strains in this and the original eutF study are TR6583 derivatives, and exogenous Cbl was added in all media for complementation of the metE205 allele. In the phenotypic screen that isolated strain JE1418, a positive control was used to screen out unwanted auxotrophs. This positive control was growth on minimal medium containing glucose as a carbon source, plus 15 nM Cbl to complement the metE205 mutation. Therefore, the screen required a functional Cbl transport system for growth on the positive control plate. This growth requirement would therefore eliminate all tonB mutations that completely abolished TonB function. Unexpectedly, however, this would allow partial-loss-of-function tonB mutants to grow as long as enough Cbl was transported for the methionine requirements. The amount of Cbl needed to meet the methionine requirement is approximately 25-fold less than the amount required for growth on ethanolamine (13). Therefore, it was possible to isolate tonB mutants that meet the Cbl requirement for methionine synthesis but do not meet the increased demand for Cbl for growth on ethanolamine. The sensitivity to ES18 infection would still occur because of the much higher sensitivity of phage infection as a TonB function assay (1). This would explain the isolation of strain JE1418, and we believe that a similar type of selection was the reason for the isolation of strain JE1690.Explaining EutF phenotypes in terms of partially functional TonB proteins. Based on the conclusion that eutF mutants were actually partial-loss-of-function tonB alleles, the various carbon source utilization phenotypes can be explained in the following way. As described above, ethanolamine utilization requires Cbl for breakdown of ethanolamine and the induction of the genetically defined eut operon (35, 36, 45). Recent molecular characterization of a portion of the putative eut operon identified a proposed ethanolamine permease (48). Based on the findings presented here, the expression of this permease is likely to be dependent on the genetically defined regulator eutR (35). Therefore, a strain unable to access exogenous Cbl would not fully express the ethanolamine permease and would exhibit decreased ethanolamine transport. The combination of reduced Cbl acquisition and decreased ethanolamine transport would result in decreased expression of eutR-controlled genes and reduced growth rates on ethanolamine. This phenotype is exactly what was observed in eutF mutants (28).
The first enzyme involved in 1,2-propanediol degradation, diol dehydratase, also requires AdoCbl as a coenzyme. Aerobically growing S. typhimurium, therefore, requires exogenous Cbl for growth on 1,2-propanediol. Partial-loss-of-function tonB alleles would be expected to have growth defects on 1,2-propanediol, again as seen for the eutF alleles. The final two phenotypes, reduced growth on the nonfermentable carbon sources succinate and propionate, are more difficult to explain. Growth on succinate or propionate does not require Cbl; however, mutations in fur have been shown to affect growth on succinate as a sole carbon source (17). Fur is a regulatory protein involved in controlling expression of a wide number of genes involved in iron acquisition (11). It is assumed that tonB mutations will decrease iron levels in the cell and lead to phenotypes similar to that of a fur mutant. The observed phenotypes may be caused by disruption of the Fur regulon, or, alternatively, growth on nonfermentable carbon sources may be more sensitive to iron levels in the cell due to the requirement of iron for oxidative phosphorylation.| |
ACKNOWLEDGMENTS |
|---|
This work was supported by NIH grant RO1-GM40313 to J.C.E.-S. and
by the College of Agricultural and Life Sciences of the University of
Wisconsin
Madison. We thank K. Postle for anti-TonB monoclonal
antibodies and plasmids, H. Goodrich-Blair for the secondary antibody,
and M. R. Rondon for CAS medium. We thank the anonymous reviewers
for their constructive and insightful criticism of this work.
| |
FOOTNOTES |
|---|
*
Corresponding author. Mailing address: Department of
Bacteriology, University of Wisconsin
Madison, 1550 Linden Dr.,
Madison, WI 53706-1567. Phone: (608) 262-7379. Fax: (608) 262-9865. E-mail: jcescala{at}facstaff.wisc.edu.
Present address: Department of Microbiology and Molecular Genetics,
Harvard Medical School, Boston, Mass.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Ahmer, B. M.,
M. G. Thomas,
R. A. Larson, and K. Postle.
1995.
Characterization of the exbBD operon of Escherichia coli and the role of ExbB and ExbD in TonB function and stability.
J. Bacteriol.
177:4742-4747 |
| 2. | Altman, E., J. R. Roth, A. Hessel, and K. E. Sanderson. 1996. Transposons currently in use in genetic analysis of Salmonella species, p. 2613-2626. In F. C. Neidhardt, R. Curtis III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed., vol. 2. American Society for Microbiology, Washington, D.C. |
| 3. | Anton, M., and K. J. Heller. 1991. Functional analysis of a C-terminally altered TonB protein of Escherichia coli. Gene 105:23-29[Medline]. |
| 4. |
Bassford, P. J., Jr., and R. J. Kadner.
1977.
Genetic analysis of components involved in vitamin B12 uptake in Escherichia coli.
J. Bacteriol.
132:796-805 |
| 5. | Blackwell, C. M., and J. M. Turner. 1978. Microbial metabolism of amino alcohols: formation of coenzyme B12-dependent ethanolamine ammonia-lyase and its concerted induction in Escherichia coli. Biochem. J. 176:751-757[Medline]. |
| 6. |
Blattner, F. R.,
G. Plunkett III,
C. A. Bloch,
N. T. Perna,
V. Burland,
M. Riley,
J. Collado-Vides,
J. D. Glasner,
C. K. Rode,
G. F. Mayhew,
J. Gregor,
N. W. Davis,
H. A. Kirkpatrick,
M. A. Goeden,
D. J. Rose,
B. Mau, and Y. Shao.
1997.
The complete genome sequence of Escherichia coli K-12.
Science
277:1453-1474 |
| 7. |
Bradbeer, C.
1965.
The clostridial fermentation of choline and ethanolamine. II. Requirement for a cobamide coenzyme by an ethanolamine deaminase.
J. Biol. Chem.
240:4675-4681 |
| 8. | Chang, G. W., and J. T. Chang. 1975. Evidence for the B12-dependent enzyme ethanolamine deaminase in Salmonella. Nature 254:150-151[Medline]. |
| 9. | Davis, R. W., D. Botstein, and J. R. Roth. 1980. A manual for genetic engineering: advanced bacterial genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 10. |
DeVeaux, L. C.,
D. S. Clevenson,
C. Bradbeer, and R. J. Kadner.
1986.
Identification of the BtuCED polypeptides and evidence for their role in vitamin B12 transport in Escherichia coli.
J. Bacteriol.
167:920-927 |
| 11. | Earhart, C. F. 1996. Uptake and metabolism of iron and molybdenum, p. 1075-1090. In F. C. Neidhardt, R. Curtis III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed., vol. 1. American Society for Microbiology, Washington, D.C. |
| 12. | Elliott, T., and J. R. Roth. 1988. Characterization of Tn10d-Cam: a transposition-defective Tn10 specifying chloramphenicol resistance. Mol. Gen. Genet. 213:332-338[Medline]. |
| 13. | Escalante-Semerena, J. C. Unpublished results. |
| 14. |
Escalante-Semerena, J. C., and J. R. Roth.
1987.
Regulation of cobalamin biosynthetic operons in Salmonella typhimurium.
J. Bacteriol.
169:2251-2258 |
| 15. |
Escalante-Semerena, J. C.,
S.-J. Suh, and J. R. Roth.
1990.
cobA function is required for both de novo cobalamin biosynthesis and assimilation of exogenous corrinoids in Salmonella typhimurium.
J. Bacteriol.
172:273-280 |
| 16. | Hannavy, K. G., C. Barr, C. J. Dorman, J. Adamson, L. R. Mazengera, M. P. Gallagher, J. S. Evans, B. A. Levine, I. P. Trayer, and C. F. Higgins. 1990. TonB protein of Salmonella typhimurium: a model for signal transduction between membranes. J. Mol. Biol. 216:987-910. |
| 17. | Hantke, K. 1981. Regulation of ferric iron transport in Escherichia coli K12: isolation of a constitutive mutant. Mol. Gen. Genet. 182:288-292[Medline]. |
| 18. |
Heller, K., and R. J. Kadner.
1985.
Nucleotide sequence of the gene for the vitamin B12 receptor protein in the outer membrane of Escherichia coli.
J. Bacteriol.
161:904-908 |
| 19. | Hiles, I. D., L. M. Powell, and C. F. Higgins. 1987. Peptide transport in Salmonella typhimurium: molecular cloning and characterization of the oligopeptide permease genes. Mol. Gen. Genet. 206:101-109[Medline]. |
| 20. |
Jeter, R. M.,
B. M. Olivera, and J. R. Roth.
1984.
Salmonella typhimurium synthesizes cobalamin (vitamin B12) de novo under anaerobic growth conditions.
J. Bacteriol.
159:206-213 |
| 21. |
Jones, P. W., and J. M. Turner.
1984.
A model for the common control of enzymes of ethanolamine catabolism in Escherichia coli.
J. Gen. Microbiol.
130:849-860 |
| 22. | Laemmli, U. K. 1970. Cleavage and structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685[Medline]. |
| 23. |
Larsen, R. A.,
P. S. Myers,
J. T. Skare,
C. L. Seachord,
R. P. Darveau, and K. Postle.
1996.
Identification of TonB homologs in the family Enterobacteriaceae and evidence for conservation of TonB-dependent energy transduction complexes.
J. Bacteriol.
178:1363-1373 |
| 24. |
Lawrence, J., and J. R. Roth.
1995.
The cobalamin (coenzyme B12) biosynthetic genes of Escherichia coli.
J. Bacteriol.
177:6371-6380 |
| 25. | Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 26. |
Nichols, B. P., and C. Yanofsky.
1979.
Nucleotide sequences of trpA of Salmonella typhimurium and Escherichia coli: an evolutionary comparison.
Proc. Natl. Acad. Sci. USA
76:5244-5248 |
| 27. |
O'Toole, G. A., and J. C. Escalante-Semerena.
1994.
Ph.D. thesis.
University of Wisconsin Madison, Madison, Wis.
|
| 28. |
O'Toole, G. A., and J. C. Escalante-Semerena.
1991.
Identification and initial characterization of the eutF locus of Salmonella typhimurium.
J. Bacteriol.
173:5168-5172 |
| 29. | O'Toole, G. A., M. R. Rondon, J. R. Trzebiatowski, S.-J. Suh, and J. C. Escalante-Semerena. 1996. Biosynthesis and utilization of adenosyl-cobalamin (coenzyme B12), p. 710-720. In F. C. Neidhardt, R. Curtis III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed., vol. 1. American Society for Microbiology, Washington, D.C. |
| 30. | O'Toole, G. A., M. G. Thomas, and J. C. Escalante-Semerena. 1996. Unpublished results. |
| 31. |
Postle, K.
1990.
Aerobic regulation of the Escherichia coli tonB gene by changes in iron availability and the fur locus.
J. Bacteriol.
172:2287-2293 |
| 32. | Postle, K. 1993. TonB protein and energy transduction between membranes. J. Bioenerg. Biomembr. 25:591-601[Medline]. |
| 33. | Postle, K., and W. Reznikoff. 1979. Identification of the Escherichia coli tonB gene product in minicells containing tonB hybrid plasmids. J. Mol. Biol. 131:619-636[Medline]. |
| 34. |
Rioux, C. R.,
M. J. Friedrich, and R. J. Kadner.
1990.
Genes of the 90-kilobase plasmid of Salmonella typhimurium confer low-affinity cobalamin transport: relationship to fimbria biosynthesis genes.
J. Bacteriol.
172:6217-6222 |
| 35. |
Roof, D. M., and J. R. Roth.
1992.
Autogenous regulation of ethanolamine utilization by a transcriptional activator of the eut operon in Salmonella typhimurium.
J. Bacteriol.
174:6634-6643 |
| 36. |
Roof, D. M., and J. R. Roth.
1988.
Ethanolamine utilization in Salmonella typhimurium.
J. Bacteriol.
170:3855-3863 |
| 37. |
Roof, D. M., and J. R. Roth.
1989.
Functions required for vitamin B12-dependent ethanolamine utilization in Salmonella typhimurium.
J. Bacteriol.
171:3316-3323 |
| 38. |
Roof, S. K.,
J. D. Allard,
K. P. Bertrand, and K. Postle.
1991.
Analysis of Escherichia coli TonB membrane topology by use of PhoA fusions.
J. Bacteriol.
173:5554-5557 |
| 39. | Sanderson, K. E., A. Hessel, S.-H. Liu, and K. E. Rudd. 1996. The genetic map of Salmonella typhimurium, edition VIII, p. 1903-1999. In F. C. Neidhardt, R. Curtis III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed., vol. 2. American Society for Microbiology, Washington, D.C. |
| 40. |
Sanderson, K. E.,
A. Hessel, and K. E. Rudd.
1995.
Genetic map of Salmonella typhimurium, edition VIII.
Microbiol. Rev.
59:241-303 |
| 41. |
Sanderson, K. E., and J. R. Roth.
1988.
Linkage map of Salmonella typhimurium, edition VII.
Microbiol. Rev.
52:485-532 |
| 42. | Schmieger, H. 1971. A method for detection of phage mutants with altered transduction ability. Mol. Gen. Genet. 100:378-381. |
| 43. | Schmieger, H., and H. Bakhaus. 1973. The origin of DNA in transducing particles of P22 mutants with increased transduction frequencies (HT-mutants). Mol. Gen. Genet. 120:181-190[Medline]. |
| 44. | Schwyn, B., and J. B. Neilands. 1987. Universal assay for the detection and determination of siderophores. Anal. Biochem. 160:47-56[Medline]. |
| 45. |
Sheppard, D. E., and J. R. Roth.
1994.
A rationale for autoinduction of a transcriptional activator: ethanolamine ammonia-lyase (EutBC) and the operon activator (EutR) compete for adenosyl-cobalamin in Salmonella typhimurium.
J. Bacteriol.
176:1287-1296 |
| 46. |
Skare, J. T.,
B. M. M. Ahmer,
C. L. Seachord,
R. P. Darveau, and K. Postle.
1993.
Energy transduction between membranes. TonB, a cytoplasmic membrane protein, can be chemically cross-linked in vivo to the outer membrane receptor FepA.
J. Biol. Chem.
268:16302-16308 |
| 47. |
Stocker, B. A. D.,
M. Nurminen, and P. H. Makela.
1979.
Mutants defective in the 33K outer membrane protein of Salmonella typhimurium.
J. Bacteriol.
139:376-383 |
| 48. |
Stojiljkovic, I.,
A. J. Bäumler, and F. Heffron.
1995.
Ethanolamine utilization in Salmonella typhimurium: nucleotide sequence, protein expression, and mutational analysis of the cchA cchB eutE eutj eutH gene cluster.
J. Bacteriol.
177:1357-1366 |
| 49. |
Vogel, H. J., and D. M. Bonner.
1956.
Acetylornithase of Escherichia coli: partial purification, and some properties.
J. Biol. Chem.
218:97-106 |
| 50. | Way, J. C., M. A. Davis, D. Morisato, D. E. Roberts, and N. Kleckner. 1984. New Tn10 derivatives for transposon mutagenesis and for construction of lacZ operon fusions by transposition. Gene 32:369-379[Medline]. |
| 51. | Young, G. M., and K. Postle. 1994. Repression of tonB transcription during anaerobic growth requires Fur binding at the promoter and a second factor binding upstream. Mol. Microbiol. 11:943-954[Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»