Previous Article | Next Article 
Journal of Bacteriology, January 1999, p. 469-476, Vol. 181, No. 2
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Transcription of Two Sigma 70 Homologue Genes,
sigA and sigB, in Stationary-Phase
Mycobacterium tuberculosis
Yanmin
Hu and
Anthony R. M.
Coates*
Department of Medical Microbiology, St.
George's Hospital Medical School, London SW17 ORE, United Kingdom
Received 26 August 1998/Accepted 6 November 1998
 |
ABSTRACT |
The sigA and sigB genes of
Mycobacterium tuberculosis encode two sigma 70-like sigma
factors of RNA polymerase. While transcription of the sigA
gene is growth rate independent, sigB transcription is
increased during entry into stationary phase. The sigA gene transcription is unresponsive to environmental stress but that of
sigB is very responsive, more so in stationary-phase growth than in log-phase cultures. These data suggest that SigA is a primary
sigma factor which, like
70, controls the transcription
of the housekeeping type of promoters. In contrast, SigB, although
showing some overlap in function with SigA, is more like the
alternative sigma factor,
S, which controls the
transcription of the gearbox type of promoters. Primer extension
analysis identified the RNA start sites for both genes as 129 nucleotides upstream to the GTG start codon of sigA and 27 nucleotides from the ATG start codon of sigB. The
10
promoter of sigA but not that of sigB was
similar to the
70 promoter. The half-life of the
sigA transcript was very long, and this is likely to play
an important part in its regulation. In contrast, the half-life of the
sigB transcript was short, about 2 min. These results
demonstrate that the sigB gene may control the regulons of
stationary phase and general stress resistance, while sigA
may be involved in the housekeeping regulons.
 |
INTRODUCTION |
Mycobacterium
tuberculosis causes tuberculosis, which is the most important
infectious disease in the world (because it kills more people than any
other single infection) and leads to 8% of all deaths (22).
Although the disease can be cured by antimicrobial therapy and can be
prevented by a vaccine, the total number of cases worldwide is
increasing (36). The underlying problem with efforts to
control the disease is the inability of antimicrobial agents or the
immune system to eradicate dormant M. tuberculosis. As a
result of this characteristic, the necessity for 6 months of
chemotherapy to treat the disease leads to major problems with compliance (38). Furthermore, about one third of the
world's population have dormant bacteria (39), which live
in infected people for the rest of their lives, and this provides a
huge pool of potential disease since 1 of 10 of those infected
will suffer from active disease in the future (32).
An understanding of the molecular mechanisms of M. tuberculosis dormancy is needed, and the genes which control
dormancy are of particular interest. Sigma factors (15, 20,
25) are global regulators of gene transcription and contribute
specificity to transcription initiation by the recognition of
specific promoter sequences of different genes. In log-phase growth,
primary sigma factors in the RNA polymerase holoenzyme recognize
housekeeping genes (20). Changes in environmental factors
lead to the replacement of sigma factors in the holoenzyme and the
transcriptional regulation of different genes (20). In
M. tuberculosis there are at least 14 different sigma
factors (8), and the role of most of them in dormancy is
unknown. The transcription of one of the genes encoding these factors,
sigF, is enhanced during entry into the stationary phase,
suggesting that it is involved in the regulation of dormancy
(9).
Here we describe the transcription of two sigma 70 homologue genes,
sigA and sigB (11). We use an in vitro
model of M. tuberculosis dormancy (42, 43)
in which the organisms are grown in culture without agitation and
slowly fall to the bottom of the culture where the low oxygen
concentration limits growth. After about 30 days, the
bacteria enter a stationary growth phase, which is similar to the
stationary growth phase in animals (31).
sigA and sigB genes were first identified in
M. tuberculosis by Doukhan et al. (11). The
deduced amino acid sequences of SigA and SigB are very similar to
those in Brevibacterium lactofermentum (29), also
to the HrdB protein, the major sigma factor of Streptomyces coelicolor (40), and to those of other members of the
sigma 70 family (25). The sigA and
sigB genes of M. tuberculosis are located in
the same region of the genome, and the predicted amino acid sequences
of the encoded proteins show 62.9% identity in the 315-amino-acid
overlap. SigA is considered to be a primary sigma factor based on
evidence of gene homology with sigma 70 (11) and because it
contains region 1, a common feature in sigma 70 (25). Also,
sigA cannot be inactivated by gene replacement (14) because the primary sigma factor is essential for cell survival (25). Although SigB is a sigma 70 homologue, the
sigma 70 region 1 is absent (11) and the sigB
gene can be insertionally inactivated in Mycobacterium
smegmatis (an unpublished result reviewed in reference
13). So, it has been suggested that SigB may function as an alternative sigma factor
(13). Here we successfully characterized the transcription
of the two sigma factors by Northern blotting and primer extension
analysis. The results show that transcription of sigA is
constant in log-phase- and stationary-phase-growth cultures and in a
variety of stress conditions. In contrast, transcription of
sigB is induced during transition from log-phase to
stationary-phase growth and under certain stress conditions. The
patterns of the gene expression suggest possible roles for each of the
two sigma factors in controlling gene expression in M. tuberculosis.
 |
MATERIALS AND METHODS |
Bacteria and culture.
M. tuberculosis, strain
H37Rv, was grown at 37°C in Middlebrook 7H9 medium containing 0.05%
Tween 80 supplemented with 10% albumin dextrose complex (ADC) (Difco
Laboratories). Samples of 10-day mid-log-phase cultures were stored at
70°C. They were thawed and subcultured once for 10 days before
being inoculated 1:10 into fresh medium to form the experimental
cultures. Microaerophilic growth was achieved by incubating 10 ml of
the cultures in 28-ml screw-capped bottles without disturbance for up
to 60 days. CFU were counted as described previously (19).
DNA manipulations, sequencing, and analysis.
DNA isolation,
ethanol precipitation of DNA, electrophoresis of DNA in agarose, and
transformation were performed by standard procedures (34).
The TOPO TA Cloning kit (Invitrogen) was used to clone the PCR
products. DNA for sequencing was isolated with a plasmid mini-prep kit
(Qiagen). Sequencing reactions were carried out with DNA with the T7
Sequenase version 2.0 sequencing kit (U.S. Biochemicals) in accordance
with the manufacturer's instructions, based on the dideoxy chain
termination method (35) with
-35S-dATP
(specific activity, >1,000 Ci/mmol; Amersham) as the radioactive label. Computer-aided analysis of the DNA sequences was performed by
using the Genetics Computer Group sequence analysis software package
(University of Wisconsin Biotechnology Center, Madison).
RNA extraction.
Total RNA extraction from cultures was
carried out by using the method of Mangan et al. (27). After
isopropanol precipitation, RNA was treated with RNase-free DNase I
(Life Technologies), phenol extracted, and reprecipitated. The RNA
concentration was determined spectrophotometrically at 260 nm.
PCR amplification of DNA.
The probes for Northern blot
hybridization were prepared by PCR. PCR amplification was performed
with 5 ng of M. tuberculosis chromosomal DNA in a final
volume of 50 µl containing 1 µM (each) primer; 200 µM (each)
dATP, dCTP, dGTP, and dTTP; 1 U of Taq polymerase (Promega);
and a buffer supplied with the enzyme. Amplification was carried out
for 30 cycles as follows: denaturation for 1 min at 94°C, primer
annealing for 2 min at 58°C, and primer extension at 72°C for 3 min. The primers used for generating the probes for Northern blot
analysis were 5'-CCAGCACGAAGCCGCAAC-3' and
5'-TCATCCCAGACGAAATCACC-3' for sigA,
5'-AGATCAACGACCTGCTGGAA-3' and
5'-GGGACAGCCCGAATAGTTTG-3' for sigB and
5'-GCCTGGGAAACTGGGTCTAA-3' and
5'-TCTCCACCTACCGTCAATCC-3' for 16S rRNA
(EMBL/GenBank accession no. for 16S rRNA, mtu16srn). A 0.833-kb 16S
rRNA gene-specific DNA fragment for Southern hybridization was
generated with primers AGCACCGGCCAACTACGTGC
and ACGGGGTCGAGTTGCAGACC. These primers were
designed to be in the coding regions of the transcripts.
Probes.
The sequences of the PCR products were determined
with a DNA sequencer (ABI 377; Applied Biosystem, Perkin Elmer) by
using the AmpliTaq fluorescent sequencing (FS) enzyme for
cycle sequencing with deoxy-rhodamine dye terminators (Cambridge
BioScience Ltd, Cambridge, United Kingdom). The sequences were
identical to those of sigA and sigB genes in the
EMBL/GenBank database (accession no. Z96072). The probes were labelled
with [
-32P]dCTP (specific activity, >1,000 Ci/mmol;
Amersham) by the random priming method according to the instructions of
the manufacturer (Amersham). Generally, 1 × 105 to
5 × 105 cpm/ml was used in hybridization from probes
with a specific activity of more than 108 cpm/µg.
Northern (RNA) blot analysis.
Northern blot analysis was
performed by fractionation of RNA samples on a 1.2% agarose gel
containing 6.5% formaldehyde, transfer to a nylon membrane (Hybond-N;
Amersham) by capillary blotting in 10× SSC (1× SSC is 0.15 M NaCl
plus 0.015 M sodium citrate), and by cross-linking by UV irradiation
(34). The same amount of total RNA (20 to 30 µg) was
loaded into each well of the gel. Sizes were determined with an RNA
ladder (0.2 to 10 kb; Sigma) as the molecular size standard.
Hybridization with probes and washing of the membranes at high
stringency were performed by standard procedures (34).
Northern hybridization was standardized by using a 16S rRNA gene probe
after the same filter was stripped.
The filters were exposed to X-ray films. The films, exposed for various
periods of time, were scanned with a high-resolution laser Personal
Densitometer SI (Molecular Dynamics) linked to ImageQuaNT software
(Molecular Dynamics).
Primer extension.
The synthetic oligonucleotides, Prsiga1
(5'-GTCGCCGTGCTTGCTTTGGT-3', complementary to nucleotide
[nt] positions 7 to 26 downstream of start codon in sigA
gene), Prsiga2 (5'-TGGTGGCGGTGCGTTTTACC-3', nt positions 36 to 55 downstream of start codon in sigA gene), Prsigb1
(5'-GTGGTGGCCCTTGTGGGTG-3', complementary to nt positions 8 to 26 downstream of start codon in sigB gene), and Prsigb2
(5'-CATCCAGATCGCTGTCAACC-3', nt positions 33 to 52 downstream of the start codon in the sigB gene) were 5' end
labelled with [
-32P]ATP (3,000 Ci/mmol; Amersham) and
the Ready-To-Go T4 polynucleotide kinase (PNK) (Pharmacia). Total RNA
(40 µg) from different growth phases of microaerophilic cultures was
annealed with 5 ng of 5'-end-labeled primer in 5× reverse
transcriptase buffer (Life Technologies) at primer melting temperatures
for 20 min and then slowly cooled to room temperature for 30 min.
Primer extension was performed in the same solution for 1 h at
42°C containing 500 µM (each) dATP, dCTP, dGTP and dTTP; 40 U
of RNAsin (Promega); 5 mM dithiothreitol; and 200 U of
SuperScriptII transcriptase (Life Technologies). The primer extension
products were precipitated with ethanol and sodium acetate at
70°C,
washed with 70% of ethanol, and dried. The pellets were
resuspended in an appropriate amount of formamide dye solution (U.S.
Biochemicals) and then separated in a 6% polyacrylamide sequencing gel
containing 8 M urea adjacent to a DNA sequence ladder which was
generated by using a standard sequencing primer with single-strand
M13 bacteriophage DNA.
Chemical half-life determination.
Chemical half-lives of the
RNA were determined by using log-phase (4 days) and stationary-phase
(40 days) microaerophilic cultures. RNA was isolated from the cell
samples taken at selected intervals after transcription initiation was
inhibited by the addition of 100 µg of rifampin (Sigma) per ml, and
the half-lives were determined by Northern blot analysis. The
incorporation of [3H]uridine (Amersham) into
trichloroacetic acid-precipitated RNA was rapidly reduced by 98% (data
not shown) after the addition of 100 µg of rifampin per ml, showing
that transcription initiation was blocked with this concentration of rifampin.
Analysis of RNA accumulation during stress conditions.
A
series of 10-ml cultures were used for the determination of stress
responses. For heat shock, the cultures were shifted to 45°C for 30 min. For oxidative stress and alcohol shock,
H2O2 (10 mM) or alcohol (5%) was added to the
cultures for 30 min. For starvation stress, the cultures were
thoroughly washed with phosphate-buffered saline, resuspended in 10 ml
of H2O, and then kept at 37°C for 2 h. For cold
shock, the cultures were left at 4°C for 1 h. RNA was extracted
after exposure to various stresses and analyzed by Northern blotting.
Nucleotide sequence accession number.
The nucleotide
sequence data shown in Fig. 3. has been assigned EMBL/GenBank accession
no. Z96072 (coding sequence 21,200 to 22,786 nucleotides for
sigA and coding sequence 25,826 to 26,797 nucleotides for
sigB).
 |
RESULTS |
Transcriptional analysis of sigA and sigB
genes.
In order to examine the steady-state levels of the
sigA and sigB mRNAs, total RNA was extracted from
the cultures at different growth phases in the growth curve (Fig.
1A) and was subjected to Northern blot
analysis. As shown in Fig. 1B (left-hand panel), after hybridization
with a sigA gene-specific probe (see Materials and Methods),
two transcripts with sizes of approximately 2.2 and 1.7 kb were
detected. The sizes of 1.7- and 2.2-kb transcripts were sufficient to
include the sigA mRNA. In order to determine whether the
1.7-kb transcript was an artifact due to cross-hybridization of the
sigA probe with 16S rRNA, Southern blot analysis was
performed by hybridizing the sigA gene probe with the 16S
gene probe (0.38 kb) and a 0.833-kb 16S gene-specific DNA fragment,
which together almost cover the entire 16S rRNA gene. No bands were
detected by Southern blot analysis (data not shown), indicating that
the 1.7-kb transcript was probably not the result of
cross-hybridization with 16S rRNA. The level of transcription of
sigA during the different growth phases was constant (Fig.
1B), suggesting that the sigA gene is constitutively
expressed and is growth rate independent.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 1.
Northern blot analysis of steady-state levels of
sigA and sigB transcripts. (A) Growth curve of
M. tuberculosis H37Rv. The bacilli were grown for 60 days in 7H9 medium containing 0.05% of Tween 80 supplemented with 10%
ADC without disturbance. Viability was estimated as log CFU per
milliliter at 0, 4, 10, 20, 30, 40, 50, and 60 days of incubation.
Times at which RNA was isolated are marked by arrows. The values shown
are the averages of three independent experiments. (B) Northern
hybridization of total RNA with sigA-, sigB-, and
16S rRNA gene-specific probes. The RNA ladder indicated on the left was
used as a molecular size marker. These results have been independently
confirmed in two additional experiments. (C) Densitometric analysis of
steady-state levels of sigA and sigB mRNAs. For
each time, the measurement was repeated at least three times, and the
values of sigA (2.2 kb [ ] and 1.7 kb [ ]) and
sigB (1.1 kb [ ]) shown are the averages of three
determinations.
|
|
The same blot was stripped and reprobed to detect sigB mRNA
by using a sigB gene-specific probe (see Materials and
Methods). As shown in Fig. 1B (middle panel), the sigB
transcript was approximately 1.1 kb in length, and this length
matched the sigB mRNA length prediction based on the
sigB gene. sigB was transcribed in early log phase when the bacilli were 4 days old, but unlike that of sigA, transcription increased during entry into the
stationary phase at 10 days of incubation followed by a decrease
during the rest of stationary-phase growth. The blot was stripped and
reprobed to detect 16S rRNA. As shown in Fig. 1B (right-hand
panel), the relatively equal intensities of the bands ensured that the
same amount of the RNA was loaded into each well of the gel. The levels of the sigA and sigB mRNAs were calculated
by linear regression analysis of the corrected data with 16S rRNA.
Densitometric analysis revealed that there was about 1.4 (±0.04)-fold
increase in the sigB mRNA at 10 days compared to the
value observed in log-phase growth (Fig. 1C). The levels of the
sigA 2.2- and 1.7-kb mRNAs were relatively stable during 50 days of incubation.
Primer extension analysis of sigA and sigB
genes.
In order to identify the transcription start sites of the
sigA and sigB genes during log-phase and
stationary-phase growth, total RNA was extracted from the cell samples
at the same time as those that were extracted for Northern blot
analysis (Fig. 1A). Primer extension analysis located the 5' end of the
sigA mRNA by using Prsiga1, which corresponds to nucleotides
7 to 26 upstream of the GTG start codon. As shown in Fig.
2A, a 166-nt primer extension product was
identified, indicating that there is a single transcription start site
which corresponds to nucleotide C, position 129 upstream of the GTG
start codon. This result was independently confirmed by extension of
the primer Prsiga2 (Materials and Methods) (data not shown). So, a
129-nt internal nontranslated sequence was found between the
transcription start site and the translation start codon.
The primer extension results further confirmed the Northern
blot data, which suggest that the 1.7-kb transcript provides the right
size to include the sigA mRNA beginning 129 nt upstream of
the start codon and ending after the stop codon of sigA
gene. This result indicates that the 1.7-kb transcript is a
monocistronic message. Our data do not explain the size of the larger
transcript. As shown in Fig. 3A, a
potential Shine-Dalgarno (SD) sequence GAAG was located 8 nt upstream
of the GTG start codon. Putative promoter sequences of
10 and
35 were found upstream of the sigA transcription
start site. The
10 sequence TACAAT is identical in 5 of 6 nt to the consensus sequence TATAAT of
70-recognized promoters (15), but the
35
sequence TGTACT has low identity to the sequence TTGACA
in
70 promoters.

View larger version (96K):
[in this window]
[in a new window]
|
FIG. 2.
Primer extension analysis of sigA and
sigB transcripts. The sizes of the primer extension products
were determined by comparison with an unrelated DNA sequencing ladder
generated by sequencing single-strand M13 bacteriophage DNA shown in
the lanes labelled G, A, T, and C. (A) Mapping of the 5' end of
sigA mRNA. Lanes: 1 to 5, RNA isolated at 4, 10, 20, 30, and
50 days of cultures, respectively; 6, negative control without RNA. The
transcription start site is indicated by the arrow and corresponds to
nucleotide C shown in Fig. 3A. (B) Mapping of the 5' end of
sigB mRNA. Lanes: 1, no RNA (negative control); 2 to 6, RNA
extracted on days 4, 10, 20, 30, and 50 of culture. The transcription
start site is indicated by an arrow and corresponds to nucleotide A
shown in Fig. 3B.
|
|

View larger version (71K):
[in this window]
[in a new window]
|
FIG. 3.
DNA sequences of sigA and sigB
regulation regions. (A) Partial sequence of the regions encoding the
sigA gene and a 200-bp upstream sequence. (B) Regions
encoding sigB, a 100-bp upstream sequence, and an 85-bp
downstream sequence. The transcription start sites are indicated as
asterisks. The putative promoter sequences are marked by boxed
sequences and labelled 10 and 35. The putative ribosome-binding
sites are indicated with double underlining. The start and stop codons
are in boldface. The inverted sequence downstream of the
sigB gene is marked by paired arrows.
|
|
The transcription start site of sigB was mapped by using
primer Prsigb1, which is complementary to nucleotide positions 8 to 26 downstream of the ATG start codon. As shown in Fig. 2B, one primer
extension product, which corresponds to nucleotide A, 27 nt upstream of
the ATG start codon, was detected (Fig. 3B). This result was confirmed
by using a second primer (Prsigb2, Materials and Methods) (data not
shown). The predicted size of the sigB transcript is 1.1 kb
and begins 27 nt upstream of the ATG start codon and ends at the
inverted repeat sequence (Fig. 3B), which is found 28 to 61 bp
downstream of the stop codon, forming a stem-loop structure that
probably acts as a transcriptional terminator. This size is in good
agreement with the size of the transcript detected by Northern blot
analysis, indicating that the sigB gene was transcribed as a
monocistronic message. As shown in Fig. 3B, a highly conserved SD
sequence, GGAGG, is centered 8 nt upstream of the ATG
initiation codon. When promoter-like sequences around the
10
and
35 regions upstream of the transcription start site were
examined, the putative
10 sequence TTAAAC was found to
have high similarity to the TTGAAC of the sigB
promoter in B. lactofermentum (30) but low
similarity to the
10 sequence of sigA promoter and the
consensus sequence of
70 promoters. The
35 sequences
of both sigA and sigB genes showed poor identity
to the consensus sequence of promoters in other bacteria including
Mycobacterium spp., in agreement with previous findings
(3).
The temporal pattern of transcription of sigA and
sigB genes examined by primer extension analysis correlated
well with that found by Northern blot analysis.
Half-life determination of sigA and sigB
mRNA.
Since a steady-state level of a mRNA is mirrored by the rate
of transcriptional initiation and the rate of mRNA decay, we measured
the mRNA half-lives of the sigA and sigB mRNA by
using log-phase (4 days) and stationary-phase (40 days) cultures. After transcription initiation was inhibited with 100 µg of rifampin per
ml, RNA was extracted at various times and analyzed by Northern blotting. As shown in Fig. 4A, the
chemical half-lives of the 2.2 and 1.7 kb of the sigA mRNA
were very stable with no significant decay 40 min after the addition of
rifampin, regardless of growth-phase changes. The blots were stripped
and reprobed with the sigB gene-specific probe. The chemical
decay rates of the sigB mRNA (Fig. 4B) showed no significant
difference between log-phase and stationary-phase bacilli. The average
half-lives were 2.4 ± 0.4 min for log-phase and 2.9 ± 0.2 min in stationary-phase bacilli, indicating that the chemical stability
of sigB mRNA appeared to be growth rate independent (Fig.
4D). The blots shown in Fig. 4C after stripping and reprobing with the
16S rRNA probe demonstrate that equal amounts of total RNA were loaded
in the lanes. The density of the sigB at time 0 in the
right-hand panel of Fig. 4B appears to be higher than that at time 0 in
the left-hand panel. This is due to the difference in the time of
exposure. When the densitometric readings were corrected to take into
account the loading of the 16S rRNA at an equivalent exposure time, no
difference was observed between the time 0 readings in the two panels
in Fig. 4B. Similarly, the different densities of the two panels in
Fig. 4A are due to differences in exposure time.

View larger version (43K):
[in this window]
[in a new window]
|
FIG. 4.
Northern blot analysis of decay of sigA (A)
and sigB (B) transcripts. Total cellular RNA was extracted
from the cells in log-phase bacilli (4 days; left-hand panels) and
stationary-phase bacilli (40 days; right-hand panels) at 0, 3, 5, 10, 20, and 40 min after the addition of 100 µg of rifampin per ml.
Analysis of the mRNA decay was performed as described in Materials and
Methods. (C) The same blots were stripped and hybridized with the 16S
rRNA-specific probe. (D) Densitometric analysis of the autoradiographs
shown in panel B and two other independent experiments showing the
decay rate of 1.1-kb sigB mRNA in log-phase (open circle)
and stationary-phase bacilli (filled circle). The signals of the bands
were plotted against the time of the RNA isolation and expressed as the
percentage of the initial value. The values shown are the averages of
three independent experiments. Rifampicin, rifampin.
|
|
Regulation of mRNA accumulation by environmental stress.
To
determine whether the sigA and sigB mRNA
accumulation was associated with environmental stress, we used cells
taken from log-phase (4 days) and stationary-phase (40 days) cultures
and measured changes in relative levels of the mRNA after exposure to
various stresses. As shown in Fig. 5A and
D, compared with the steady-state level of the mRNA (control),
transcription of sigB was strongly expressed after hydrogen
peroxide stress; 3.41 (±0.05)-fold and 5.33 (±0.06)-fold induction of
the mRNA in log-phase and stationary-phase bacilli, respectively, was
observed. Starvation induced a 1.82 (±0.045)-fold increase in the mRNA
in log phase and a 2.25 (±0.07)-fold increase in stationary phase.
Heat shock also induced the transcription of the sigB mRNA,
showing 1.61 (±0.03)-fold and 1.87 (±0.03)-fold increases in the mRNA
in log phase and stationary phase, respectively. Interestingly, there was a significant difference in response to environmental stress between log-phase and stationary-phase bacilli, particularly after hydrogen peroxide treatment (P < 0.01, determined by
student's t test; n = 3), which revealed,
surprisingly, a higher response in stationary-phase bacteria than in
log-phase bacteria. The same blots were stripped and rehybridized with
the sigA gene probe. The transcription of the
sigA gene was not affected by any of the stresses
irrespective of different growth phases (Fig. 5B), suggesting that SigA
may not be involved in the regulation of the gene expression in
response to environmental stress. The blots were stripped and reprobed
with the 16S rRNA probe and showed equal loading of total RNA in
each lane (Fig. 5C).

View larger version (43K):
[in this window]
[in a new window]
|
FIG. 5.
Northern blot analysis of sigA (A) and
sigB (B) transcripts in response to stress. RNA was
extracted from log-phase (4 days) (left-hand panels) and
stationary-phase (40 days) (right-hand panels) bacilli after exposure
to different stress conditions described in Materials and Methods and
subjected to Northern blot analysis. (C) The same blots were stripped
and hybridized with the 16S rRNA-specific probe. (D) Densitometric
analysis of sigB mRNA. Open bars, RNA from log-phase
bacilli; filled bars, RNA from stationary-phase bacilli. The values
shown are the averages of three independent experiments. Ctrl, control;
EtOH, ethanol.
|
|
 |
DISCUSSION |
SigA mRNA remained at the same constant level
during log-phase and stationary-phase growth and under a variety of
stress conditions. This result suggests that the SigA protein of
M. tuberculosis may be a primary sigma factor, similar
to the
70 protein of Escherichia coli, whose
cellular concentration is also maintained at a constant level during
the transition between log-phase and stationary-phase growth (21,
41) and under stress conditions such as heat shock and osmotic
stress (21). This mRNA has a long half-life of more than 40 min in both log-phase and stationary-phase organisms. The stability of
this mRNA might be a key factor in the maintenance of a constant level
of the transcript, particularly in stationary-phase growth. Stable mRNA (half-life, 150 min) has been found in another microbe,
Myxococcus xanthus, and plays an important role in the
control of the gene expression during fruiting body formation
(33), although the molecular mechanism which underlies the
long half-life of this message is unknown.
The transcription of sigB differs in a number of ways from
that of sigA. Northern blot analysis showed that
transcription of the sigB gene was significantly increased
when the bacilli entered stationary phase at 10 days of microaerophilic
incubation and under various stress conditions. This finding suggests
that the SigB protein may be an alternative or secondary sigma factor which controls a large stationary-phase regulon. The expression of the
sigB gene is very similar to that of the sigF
gene in M. tuberculosis (9), the
sigB gene in Bacillus subtilis (4-6), and the rpoS gene in E. coli (21, 41),
which control stationary phase and stress regulons (5, 6, 16, 17,
23, 28). In contrast to that of sigA, the half-life of
the sigB transcript is very short and is highly unstable in
both log phase and stationary phase. These results are consistent with
previous findings that the chemical half-life of rpoS mRNA
in E. coli is about 2 min regardless of the different growth
phases (44).
Primer extension analysis indicates that the sigA gene is
transcribed from a single promoter residing 129 nt upstream of the GTG
start codon. However, Northern blotting identified two transcripts. Since the primer extension analysis clearly shows only one 5' end,
there may be heterogeneity at the 3' end, giving rise to the 1.7-kb
transcript, which is compatible with a monocistronic mRNA, and to the
2.2-kb transcript, a size which is larger than the size predicted from
the DNA sequence. It is likely that the 2.2-kb transcript overlaps the
5' end of a predicted gene which is downstream of the sigA
gene. In other bacteria such as Corynebacterium spp. and
Streptomyces spp., it has been suggested that an inefficient transcriptional terminator leads to incomplete termination of transcription which results in transcript lengths longer than predicted
(24, 30, 37). These data raise the possibility that the mRNA
may not be monocistronic. The long nontranslated leader at the
5' end of the sigA mRNA is not uncommon in other bacteria (1, 2, 7, 12, 26), but its role is unknown. An
examination of the secondary structure of the leader sequence by
computer analysis (Foldrna, Genetics Computer Group sequence analysis software package) showed a stem-loop (data not
shown) which might be involved in stabilization of the mRNA. In
other organisms, 5' end secondary structures stabilize mRNA
by shielding the mRNA from attack by RNase (1, 12).
Whether a similar situation exists in M. tuberculosis is unknown.
The putative
10 region (TACAAT) of the sigA
gene possesses a striking homology to the
10 sequence (TATAAT)
of the consensus sequence of
70-recognized
promoters (15), but the
35 region does not match the
consensus sequence of promoters in E. coli and the known
35 sequences in mycobacteria (3). The presence of the
similar
70 consensus sequence in the
sigA promoter of M. tuberculosis suggests that the transcription of sigA may be controlled by a sigma
70-like factor. The promoter regions of the sigB gene are
different in a number of ways from those of the sigA gene.
Primer extension identified a short nontranslated leader at the 5' end
of the gene which contains an RNA start site 27 nt upstream of the ATG
start codon, giving rise to monocistronic sigB mRNA. A
potential
10 promoter site, TTAAAC, is present
but, unlike the
10 of the sigA gene, has low
homology only to the
70 promoter consensus sequence.
This finding suggests that sigB transcription requires a
sigma factor different from that needed by sigA.
The transcriptional responses of the sigA and the
sigB genes to environmental stress are also different. The
sigA gene is unresponsive, while sigB is highly
responsive, particularly to hydrogen peroxide, starvation, and heat.
The sigB response is similar to that of the sigma factors in
other organisms when they are exposed to environmental stress (4,
6, 17, 21). The increase in sigB transcription was
most marked in stationary phase and might explain why stationary-phase
M. tuberculosis is more resistant to stress than
log-phase bacteria (10, 18, 19, 42, 43). Future work will be
aimed at investigating the regulators of sigma factors under different
growth conditions.
 |
ACKNOWLEDGMENTS |
We thank Philip Butcher and Joseph Mangan for advice.
This study was supported by financial support from the Medical Research
Council to A.R.M.C.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Medical Microbiology, St. George's Hospital Medical School, London
SW17 ORE, United Kingdom. Phone: 44 (181) 725 5725. Fax: 44 (181) 672 0234. E-mail: acoates{at}sghms.ac.uk.
 |
REFERENCES |
| 1.
|
Arnold, T. E.,
J. Yu, and J. G. Belasco.
1998.
mRNA stabilization by the ompA 5' untranslated region: two protective elements hinder distinct pathways for mRNA degradation.
RNA
4:319-330[Abstract].
|
| 2.
|
Barnett, M. J.,
B. G. Rushing,
R. F. Fisher, and S. R. Long.
1996.
Transcription start sites for syrM and nodD3 flank an insertion sequence relic in Rhizobium meliloti.
J. Bacteriol.
187:1782-1787.
|
| 3.
|
Bashyam, M. D.,
D. Kaushal,
S. K. Dasgupta, and A. K. Tyagi.
1996.
A study of mycobacterial transcriptional apparatus: identification of novel features in promoter elements.
J. Bacteriol.
178:4847-4853[Abstract/Free Full Text].
|
| 4.
|
Benson, A. K., and W. G. Haldenwang.
1993.
The B-dependent promoter of the Bacillus subtilis sigB operon is induced by heat shock.
J. Bacteriol.
175:1929-1935[Abstract/Free Full Text].
|
| 5.
|
Boylan, S. A.,
A. R. Redfield, and C. W. Price.
1993.
Transcription factor B of Bacillus subtilis control a large stationary-phase regulon.
J. Bacteriol.
175:3957-3963[Abstract/Free Full Text].
|
| 6.
|
Boylan, S. A.,
A. R. Redfield,
M. S. Brody, and C. W. Price.
1993.
Stress-induced activation of the B transcription factor of Bacillus subtilis.
J. Bacteriol.
175:7931-7937[Abstract/Free Full Text].
|
| 7.
|
Caslake, L. F., and D. A. Bryant.
1996.
The sigA gene encoding the major factor of RNA polymerase from the marine cyanbacterium Synechococcus sp. strain PCC 7002: cloning and characterization.
Microbiology
142:247-357.
|
| 8.
|
Cole, S. T.,
R. Brosch,
J. Parkhill,
T. Garnier,
C. Churcher,
D. Harris,
S. V. Gordon,
K. Eiglmeier,
S. Gas,
C. E. Barry III,
F. Tekaia,
K. Badcock,
D. Basham,
D. Brown,
T. Chillingworth,
R. Connor,
R. Davies,
K. Devlin,
T. Feltwell,
S. Gentles,
N. Hamlin,
S. Holroyd,
T. Hornsby,
K. Jagels,
A. Krogh,
J. McLean,
S. Moule,
L. Murphy,
K. Oliver,
J. Osborne,
M.-A. Rajandream,
J. Rogers,
S. Rutter,
K. Seeger,
J. Skelton,
R. Squares,
S. Squares,
J. E. Sulston,
K. Taylor,
S. Whitehead, and B. G. Barrell.
1998.
Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
Nature
393:537-544[Medline].
|
| 9.
|
DeMaio, J.,
Y. Zhang,
C. Ko,
D. B. Young, and W. R. Bishai.
1996.
A stationary-phase stress-response sigma factor from Mycobacterium tuberculosis.
Proc. Natl. Acad. Sci. USA
93:2790-2794[Abstract/Free Full Text].
|
| 10.
|
Dickinson, J. M., and D. A. Mitchison.
1981.
Experimental models to explain the high sterilizing activity of rifampin in the chemotherapy of tuberculosis.
Am. Rev. Respir. Dis.
123:367-371[Medline].
|
| 11.
|
Doukhan, L.,
M. Predich,
G. Nair,
O. Dussurget,
I. Mandic-Mulec,
S. T. Cole,
D. R. Smith, and I. Smith.
1995.
Genomic organization of the mycobacterial sigma gene cluster.
Gene
165:67-70[Medline].
|
| 12.
|
Emory, S. A.,
P. Bouvet, and J. G. Belasco.
1992.
A 5'-terminal stem-loop structure can stabilize mRNA in Escherichia coli.
Gene Dev.
6:135-148[Abstract/Free Full Text].
|
| 13.
|
Gomez, J. E.,
J.-M. Chen, and W. R. Bishai.
1997.
Sigma factors of Mycobacterium tuberculosis.
Tubercle Lung Dis.
78:175-183[Medline].
|
| 14.
|
Gomez, M.,
L. Doukhan,
G. Nair, and I. Smith.
1998.
sigA is an essential gene in Mycobacterium smegmatis.
Mol. Microbiol.
29:617-628[Medline].
|
| 15.
|
Helmann, J. D., and M. J. Chamberlin.
1988.
Structure and function of bacterial sigma factors.
Annu. Rev. Biochem.
57:839-872[Medline].
|
| 16.
|
Hengge-Aronis, R.,
R. Lange,
N. Hennebery, and D. Fischer.
1993.
Osmotic regulation of rpoS-dependent genes in Escherichia coli.
J. Bacteriol.
175:259-265[Abstract/Free Full Text].
|
| 17.
|
Hengge-Aronis, R.
1993.
Survival of hunger and stress: the role of rpoS in stationary phase gene regulation in Escherichia coli.
Cell
72:165-168[Medline].
|
| 18.
|
Hobby, G. L., and T. F. Lenert.
1957.
The in vitro action of antituberculous agents against multiplying and the nonmultiplying microbial.
Am. Rev. Tuberc. Pulm. Dis.
76:1031-1048.
|
| 19.
|
Hu, Y. M.,
P. D. Butcher,
K. Sole,
D. A. Mitchison, and A. R. M. Coates.
1998.
Protein synthesis is shutdown in dormant Mycobacterium tuberculosis and is reversed by oxygen or heat shock.
FEMS Microbiol. Lett.
158:139-145[Medline].
|
| 20.
|
Ishihama, A.
1988.
Promoter selectivity of prokaryotic RNA polymerase.
Trends Genet.
4:282-286[Medline].
|
| 21.
|
Jishage, M., and A. Ishihama.
1995.
Regulation of RNA polymerase sigma subunit synthesis in Escherichia coli: intracellular levels of 70 and 38.
J. Bacteriol.
177:6832-6835[Abstract/Free Full Text].
|
| 22.
|
Kochi, A.
1991.
The global tuberculosis situation and the new control strategy of the World Health Organization.
Tubercle
72:1-6[Medline].
|
| 23.
|
Lange, R., and R. Hengge-Aronis.
1991.
Identification of a central regulator of stationary-phase gene expression in Escherichia coli.
Mol. Microbiol.
5:49-59[Medline].
|
| 24.
|
Li, Y.,
D. C. Dosch,
W. R. Strohl, and H. G. Floss.
1990.
Nucleotide sequence and transcriptional analysis of the nosiheptide-resistance gene from Streptomyces actousus.
Gene
91:9-17[Medline].
|
| 25.
|
Lonetto, M.,
M. Gribskov, and C. A. Gross.
1992.
The 70 family: sequence conservation and evolutionary relationships.
J. Bacteriol.
174:3843-3849[Free Full Text].
|
| 26.
|
Luka, S.,
E. J. Patriarca,
A. Riccio,
M. Iaccarino, and R. Defez.
1996.
Cloning of the rpoD analog from Rhizobium etli: sigA of R. etli is growth-phase regulated.
J. Bacteriol.
178:7138-7143[Abstract/Free Full Text].
|
| 27.
|
Mangan, J. A.,
K. M. Sole,
D. A. Mitchison, and P. D. Butcher.
1997.
An effective method of RNA extraction from bacteria refractory to disruption, including mycobacteria.
Nucleic Acids Res.
25:675-676[Abstract/Free Full Text].
|
| 28.
|
McCann, M. P.,
J. P. Kidwell, and A. Matin.
1991.
The putative factor KatF has a central role in development of starvation-mediated general resistance in Escherichia coli.
J. Bacteriol.
173:4188-4194[Abstract/Free Full Text].
|
| 29.
|
Oguiza, J. A.,
A. T. Marcos,
M. Malumbres, and J. F. Martín.
1996.
Multiple sigma factor genes in Brevibacterium lactofermentum: characterization of sigA and sigB.
J. Bacteriol.
178:550-553[Abstract/Free Full Text].
|
| 30.
|
Oguiza, J. A.,
A. T. Marcos, and J. F. Martín.
1997.
Transcriptional analysis of the sigA and sigB genes of Brevibacterium lactofermentum.
FEMS Microbiol. Lett.
153:111-117[Medline].
|
| 31.
|
Orme, I. M.
1988.
A mouse model of the recrudescence of latent tuberculosis in the elderly.
Am. Rev. Respir. Dis.
137:716-718[Medline].
|
| 32.
|
Parrish, N. M.,
J. D. Dick, and W. R. Bishai.
1998.
Mechanisms of latency in Mycobacterium tuberculosis.
Trends Microbiol.
6:107-112[Medline].
|
| 33.
|
Romeo, J. M., and D. R. Zusman.
1992.
Determinants of an unusually stable mRNA in the bacterium Myxococcus xanthus.
Mol. Microbiol.
6:2975-2988[Medline].
|
| 34.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 35.
|
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467[Abstract/Free Full Text].
|
| 36.
|
Schweinle, J. E.
1990.
Evolving concepts of the epidemiology diagnosis, and therapy of Mycobacterium tuberculosis infection.
Yale J. Biol. Med.
117:191-196.
|
| 37.
|
Schwinde, J. W.,
N. Thum-Schmitz,
B. J. Eikmanns, and H. Sahm.
1993.
Transcriptional analysis of the gap-pgk-tpi-ppc gene cluster of Corynebacterium glutamicum.
J. Bacteriol.
175:3905-3908[Abstract/Free Full Text].
|
| 38.
|
Stanford, J. L.,
J. M. Grange, and A. Pozniak.
1991.
Is Africa lost?
Lancet
338:557-558[Medline].
|
| 39.
|
Sudre, P.,
G. ten Dam, and A. Kochi.
1992.
Tuberculosis: a global overview of the situation today.
Bull. W. H. O.
70:149-159[Medline].
|
| 40.
|
Tanaka, K.,
T. Shiina, and H. Takahashi.
1991.
Nucleotide sequence of genes hrdA, hrdC, and hrdD from Streptomyces coelicolor A3(2) having similarity to rpoD genes.
Mol. Gen. Genet.
229:334-340[Medline].
|
| 41.
|
Tanaka, K.,
Y. Takayanagi,
N. Fujita,
A. Ishihama, and H. Takahashi.
1993.
Heterogeneity of the principal factor in Escherichia coli: the rpoS gene product 38 is a second principal factor of RNA polymerase in stationary-phase Escherichia coli.
Proc. Natl. Acad. Sci. USA
90:3511-3515[Abstract/Free Full Text].
|
| 42.
|
Wayne, L. G.
1976.
Dynamics of submerged growth of Mycobacterium tuberculosis under aerobic and microaerophilic conditions.
Am. Rev. Respir. Dis.
114:807-811[Medline].
|
| 43.
|
Wayne, L. G., and K. Y. Lin.
1982.
Glyoxylate metabolism and adaptation of Mycobacterium tuberculosis to survival under anaerobic conditions.
Infect. Immun.
37:1042-1049[Abstract/Free Full Text].
|
| 44.
|
Zgurskaya, H. I.,
M. Keyhan, and A. Matin.
1997.
The S level in starving Escherichia coli cells increases solely as a result of its increased stability, despite decreased synthesis.
Mol. Microbiol.
24:643-651[Medline].
|
Journal of Bacteriology, January 1999, p. 469-476, Vol. 181, No. 2
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Ehira, S., Shirai, T., Teramoto, H., Inui, M., Yukawa, H.
(2008). Group 2 Sigma Factor SigB of Corynebacterium glutamicum Positively Regulates Glucose Metabolism under Conditions of Oxygen Deprivation. Appl. Environ. Microbiol.
74: 5146-5152
[Abstract]
[Full Text]
-
Hu, Y., Henderson, B., Lund, P. A., Tormay, P., Ahmed, M. T., Gurcha, S. S., Besra, G. S., Coates, A. R. M.
(2008). A Mycobacterium tuberculosis Mutant Lacking the groEL Homologue cpn60.1 Is Viable but Fails To Induce an Inflammatory Response in Animal Models of Infection. Infect. Immun.
76: 1535-1546
[Abstract]
[Full Text]
-
Lee, J.-H., Karakousis, P. C., Bishai, W. R.
(2008). Roles of SigB and SigF in the Mycobacterium tuberculosis Sigma Factor Network. J. Bacteriol.
190: 699-707
[Abstract]
[Full Text]
-
Pang, X., Howard, S. T.
(2007). Regulation of the {alpha}-Crystallin Gene acr2 by the MprAB Two-Component System of Mycobacterium tuberculosis. J. Bacteriol.
189: 6213-6221
[Abstract]
[Full Text]
-
Rodrigue, S., Brodeur, J., Jacques, P.-E., Gervais, A. L., Brzezinski, R., Gaudreau, L.
(2007). Identification of Mycobacterial {sigma} Factor Binding Sites by Chromatin Immunoprecipitation Assays. J. Bacteriol.
189: 1505-1513
[Abstract]
[Full Text]
-
Agarwal, N., Woolwine, S. C., Tyagi, S., Bishai, W. R.
(2007). Characterization of the Mycobacterium tuberculosis Sigma Factor SigM by Assessment of Virulence and Identification of SigM-Dependent Genes. Infect. Immun.
75: 452-461
[Abstract]
[Full Text]
-
Ferreira, N. L., Labbe, D., Monot, F., Fayolle-Guichard, F., Greer, C. W.
(2006). Genes involved in the methyl tert-butyl ether (MTBE) metabolic pathway of Mycobacterium austroafricanum IFP 2012.. Microbiology
152: 1361-1374
[Abstract]
[Full Text]
-
Oram, D. M., Jacobson, A. D., Holmes, R. K.
(2006). Transcription of the Contiguous sigB, dtxR, and galE Genes in Corynebacterium diphtheriae: Evidence for Multiple Transcripts and Regulation by Environmental Factors.. J. Bacteriol.
188: 2959-2973
[Abstract]
[Full Text]
-
Kazmierczak, M. J., Wiedmann, M., Boor, K. J.
(2005). Alternative Sigma Factors and Their Roles in Bacterial Virulence. Microbiol. Mol. Biol. Rev.
69: 527-543
[Abstract]
[Full Text]
-
Hahn, M.-Y., Raman, S., Anaya, M., Husson, R. N.
(2005). The Mycobacterium tuberculosis Extracytoplasmic-Function Sigma Factor SigL Regulates Polyketide Synthases and Secreted or Membrane Proteins and Is Required for Virulence. J. Bacteriol.
187: 7062-7071
[Abstract]
[Full Text]
-
He, H., Zahrt, T. C.
(2005). Identification and Characterization of a Regulatory Sequence Recognized by Mycobacterium tuberculosis Persistence Regulator MprA. J. Bacteriol.
187: 202-212
[Abstract]
[Full Text]
-
Starck, J., Kallenius, G., Marklund, B.-I., Andersson, D. I., Akerlund, T.
(2004). Comparative proteome analysis of Mycobacterium tuberculosis grown under aerobic and anaerobic conditions. Microbiology
150: 3821-3829
[Abstract]
[Full Text]
-
Dawes, S. S., Warner, D. F., Tsenova, L., Timm, J., McKinney, J. D., Kaplan, G., Rubin, H., Mizrahi, V.
(2003). Ribonucleotide Reduction in Mycobacterium tuberculosis: Function and Expression of Genes Encoding Class Ib and Class II Ribonucleotide Reductases. Infect. Immun.
71: 6124-6131
[Abstract]
[Full Text]
-
Haile, Y., Bjune, G., Wiker, H. G.
(2002). Expression of the mceA, esat-6 and hspX genes in Mycobacterium tuberculosis and their responses to aerobic conditions and to restricted oxygen supply. Microbiology
148: 3881-3886
[Abstract]
[Full Text]
-
Cappelli, G., Volpe, P., Sanduzzi, A., Sacchi, A., Colizzi, V., Mariani, F.
(2001). Human Macrophage Gamma Interferon Decreases Gene Expression but Not Replication of Mycobacterium tuberculosis: Analysis of the Host-Pathogen Reciprocal Influence on Transcription in a Comparison of Strains H37Rv and CMT97. Infect. Immun.
69: 7262-7270
[Abstract]
[Full Text]
-
Raman, S., Song, T., Puyang, X., Bardarov, S., Jacobs, W. R. Jr., Husson, R. N.
(2001). The Alternative Sigma Factor SigH Regulates Major Components of Oxidative and Heat Stress Responses in Mycobacterium tuberculosis. J. Bacteriol.
183: 6119-6125
[Abstract]
[Full Text]
-
Boon, C., Li, R., Qi, R., Dick, T.
(2001). Proteins of Mycobacterium bovis BCG Induced in the Wayne Dormancy Model. J. Bacteriol.
183: 2672-2676
[Abstract]
[Full Text]
-
Keer, J., Smeulders, M. J., Williams, H. D.
(2001). A purF mutant of Mycobacterium smegmatis has impaired survival during oxygen-starved stationary phase. Microbiology
147: 473-481
[Abstract]
[Full Text]
-
Hu, Y., Mangan, J. A., Dhillon, J., Sole, K. M., Mitchison, D. A., Butcher, P. D., Coates, A. R. M.
(2000). Detection of mRNA Transcripts and Active Transcription in Persistent Mycobacterium tuberculosis Induced by Exposure to Rifampin or Pyrazinamide. J. Bacteriol.
182: 6358-6365
[Abstract]
[Full Text]
-
Primm, T. P., Andersen, S. J., Mizrahi, V., Avarbock, D., Rubin, H., Barry, C. E. III
(2000). The Stringent Response of Mycobacterium tuberculosis Is Required for Long-Term Survival. J. Bacteriol.
182: 4889-4898
[Abstract]
[Full Text]
-
Keer, J., Smeulders, M. J., Gray, K. M., Williams, H. D.
(2000). Mutants of Mycobacterium smegmatis impaired in stationary-phase survival. Microbiology
146: 2209-2217
[Abstract]
[Full Text]
-
Alland, D., Steyn, A. J., Weisbrod, T., Aldrich, K., Jacobs, W. R. Jr.
(2000). Characterization of the Mycobacterium tuberculosis iniBAC Promoter, a Promoter That Responds to Cell Wall Biosynthesis Inhibition. J. Bacteriol.
182: 1802-1811
[Abstract]
[Full Text]
-
Hu, Y., Butcher, P. D., Mangan, J. A., Rajandream, M.-A., Coates, A. R. M.
(1999). Regulation of hmp Gene Transcription in Mycobacterium tuberculosis: Effects of Oxygen Limitation and Nitrosative and Oxidative Stress. J. Bacteriol.
181: 3486-3493
[Abstract]
[Full Text]