Previous Article | Next Article ![]()
Journal of Bacteriology, January 1999, p. 508-520, Vol. 181, No. 2
Department of Microbiology, Harvard Medical
School, Boston, Massachusetts 02115
Received 3 August 1998/Accepted 4 November 1998
Assembly of the division septum in bacteria is mediated by several
proteins that localize to the division site. One of these, FtsI (also
called penicillin-binding protein 3) of Escherichia coli,
consists of a short cytoplasmic domain, a single membrane-spanning segment, and a large periplasmic domain that encodes a transpeptidase activity involved in synthesis of septal peptidoglycan. We have constructed a merodiploid strain with a wild-type copy of
ftsI at the normal chromosomal locus and a genetic fusion
of ftsI to the green fluorescent protein (gfp)
at the lambda attachment site. gfp-ftsI was expressed at
physiologically appropriate levels under control of a regulatable
promoter. Consistent with previous results based on immunofluorescence
microscopy GFP-FtsI localized to the division site during the later
stages of cell growth and throughout septation. Localization of
GFP-FtsI to the cell pole(s) was not observed unless the protein was
overproduced about 10-fold. Membrane anchor alterations shown
previously to impair division but not membrane insertion or
transpeptidase activity were found to interfere with localization of
GFP-FtsI to the division site. In contrast, GFP-FtsI localized well in
the presence of How the division septum is formed
and how its formation is spatially and temporally regulated are among
the most fundamental unanswered questions in prokaryotic cell biology.
Studies with Escherichia coli and Bacillus
subtilis indicate that septum assembly is mediated by a large
number of proteins that localize to the division site, where they are
postulated to form a multiprotein complex sometimes referred to as the
septalsome or divisome (for recent reviews, see references 12,
37, and 43). Among the proteins known to
localize to this site in E. coli are FtsZ, FtsA, FtsI,
FtsN, FtsK, FtsW, and ZipA (3, 5, 8, 29, 38, 53, 57, 59). In
B. subtilis, three division proteins have been shown to
localize to the division site: FtsZ, the FtsQ-homologue DivIB, and
DivIC, which has no obvious homologue in E. coli
(30, 34, 35, 55). These findings allow us to rephrase the
questions raised at the start of this paragraph: how do the division
proteins localize to the division site? And what do they do once they
get there?
In this article, we identify some of the requirements for septal
localization of FtsI of E. coli. FtsI (also called
penicillin-binding protein 3 [PBP3]) is a bitopic membrane protein
with a large periplasmic domain that encodes an enzymatic activity
(transpeptidase) involved in peptidoglycan synthesis (1, 10,
42). Genetic and biochemical evidence indicate that FtsI is
required specifically for synthesis of peptidoglycan at the division
septum, while penicillin-binding protein 2 (PBP2), a homologue of FtsI,
appears to be the primary transpeptidase for cell elongation (9,
50, 51, 58).
Previously, we used immunofluorescence microscopy (IFM) to show that
FtsI is localized to the division site during the later stages of cell
growth and throughout septation (57). In these studies, FtsI
was at the division site in about 50% of the cells. We also observed
polar localization in 10 to 20% of the cells. Polar FtsI was not
expected, and we offered several potential explanations, including that
it might be an artifact. In our hands, FtsI proved very difficult to
detect consistently by IFM, presumably owing to its low abundance
(~100 molecules/cell) (19, 57). Obtaining strong FtsI
signals required high concentrations of primary antibody, inviting
problems with spurious cross-reaction. In addition, detection of FtsI
was very sensitive to the level of fixation and degree to which cells
had been digested with lysozyme as part of the permeabilization
procedure necessary for antibodies to gain access to FtsI. These
problems, which were discussed in our initial report and which we have
encountered to a lesser but still significant degree with other Fts
proteins, prevented us from extending our studies to look at
localization of FtsI in various fts mutants.
Wang et al. (53) have also studied FtsI localization using
IFM. These authors reported that FtsI localizes to the division site in
an FtsZ- and FtsA-dependent manner. Interestingly, localization of FtsI
was not observed when cells were treated with furazlocillin, a
We have now achieved both high sensitivity and high specificity by
fusing FtsI to a bright variant of the green fluorescent protein (GFP)
of Aequorea victoria (14, 16). To express
gfp-ftsI at physiologically appropriate levels and to avoid
potential problems arising from the high and variable copy number of
plasmids, we placed gfp-ftsI under control of an
isopropyl- Bacterial strains, plasmids, and phage.
Bacterial strains
and plasmids used in this study are listed in Table
1. Strain
construction was by generalized transduction with P1 (40) or
specialized transduction with lambda InCh (11).
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Localization of FtsI (PBP3) to the Septal Ring
Requires Its Membrane Anchor, the Z Ring, FtsA, FtsQ, and
FtsL

![]()
ABSTRACT
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References
-lactam antibiotics that inhibit the transpeptidase
activity of FtsI. Septal localization depended upon every other
division protein tested (FtsZ, FtsA, FtsQ, and FtsL). We conclude that
FtsI is a late recruit to the division site, and that its localization
depends on an intact membrane anchor.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References
-lactam antibiotic that inactivates the transpeptidase activity of
FtsI. This observation implies that FtsI requires its catalytic activity to localize to potential division sites. Wang et al. (53) did not observe polar localization of FtsI. One caveat that pertains to the studies of Wang et al. (53) is that the FtsI signals reported were extremely weak under conditions when the
protein localizes well, suggesting that FtsI could have been overlooked
in filaments or at the poles even if were present.
-D-thiogalactoside (IPTG)-regulatable promoter
and recombined the fusion into the E. coli chromosome
at the lambda attachment site (attB). These genetic
manipulations were facilitated by two new tools that we think will be
generally useful for applying GFP to the study of protein localization
in E. coli. The first tool is a set of plasmid vectors
that allow one to make N-terminal or C-terminal fusions of a target
protein to GFP and to express those fusions under the control of an
IPTG-regulatable promoter of weak or moderate strength. The second and
more unusual tool is a lambda phage that we call lambda InCh for
in chromosome. This phage, which will be
described elsewhere (11), is similar to a lambda vector used previously in our lab (21). Lambda InCh can be used to pick up plasmid-borne gene(s) in vivo by homologous recombination and to put
them onto the chromosome by specialized transduction. The resulting
strain is a merodiploid, which has a wild-type copy of the target gene
at the normal chromosomal locus and a gfp fusion copy at
attB. The power of these tools is that all of the molecular biology can be done in plasmids, while all of the steps involving lambda are done in vivo by growing the appropriate strains under the
appropriate conditions of temperature and antibiotic selection. Using
this system, we made chromosomal gfp fusions to several essential division genes and mutant derivatives thereof. Here we use
some of these fusions to study localization of FtsI to the division site.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References
TABLE 1.
Strains and plasmids
Media. Media were NZY, Luria broth (LB), and LB with 0% NaCl. L-Arabinose or D-glucose was added as indicated to modulate expression of genes under control of the PBAD promoter (27). For localization studies, IPTG was used as follows to modulate expression of gfp fusions under control of modified trc promoters: 2.5 µM for P208-ftsZ-gfp and P207-gfp-ftsI; 100 µM for P210-ftsA-gfp; and 50 µM for P208-zipA-gfp. Antibiotics were used for selection at the following concentrations: ampicillin at 200 µg/ml for plasmids and 25 µg/ml for chromosomal alleles; kanamycin at 40 µg/ml; chloramphenicol at 30 µg/ml; tetracycline at 15 µg/ml. FtsI-specific antibiotics were used to induce filamentation at the following concentrations: cephalexin, 10 µg/ml; piperacillin, 2 µg/ml; furazlocillin, 1 µg/ml.
Molecular biological procedures. Standard procedures for cloning and analysis of DNA, PCR, electroporation, and transformation were used (48). Enzymes used to manipulate DNA were from New England Biolabs (Beverly, Mass.). Oligonucleotides were from Genosys Biotechnologies (Woodlands, Tex.) or Gibco BRL (Gaithersburg, Md.). DNA sequencing was performed by the Micro Core Facility in the Department of Microbiology and Molecular Genetics at Harvard Medical School.
Construction of plasmids for making gene fusions to gfp. Plasmids for making gene fusions to gfp were based on pTrc99A (Pharmacia, Piscataway, N.J.), a pBR-related vector that confers ampicillin resistance and allows for protein overproduction under control of a strong trc promoter. Transcription from Ptrc is regulated by the Lac repressor, supplied by a copy of lacIq on the plasmid. Downstream of Ptrc is a Shine-Dalgarno sequence and a polylinker embedded in an open reading frame to facilitate making translational fusions.
To achieve physiologically appropriate levels of expression, we used site-directed mutagenesis to weaken the trc promoter. One promoter variant, in pDSW204, has a base change in the
35 region:
TTGACA
TTTACA. The other variant,
in pDSW206, has the mutation in the
35 region and two changes into
the
10 region: TATAAT
CATTAT.
These mutations were made using the QuikChange site-directed
mutagenesis method (Stratagene, La Jolla, Calif.) and the following
oligonucleotides (5'
3'; mutations underlined):
35
(top), GGCAAATATTCTGAAATGAGCTGTTTACAATTAATCATCCGG;
35
(bottom), CCGGATGATTAATTGTAAACAGCTCATTTCAGAATATTTG CC;
10 (top),
CATCCGGCTCGCATTATGTGTGGAATTGTGAGCG;
10 (bottom), CGCTCACAATTCCACACATAATGCGAGCCGGATG.
To make plasmids that allow fusion of gfp to the N termini
of target proteins, a bright allele of gfp was amplified by
PCR with pGFPmt2 (16) as template and
ACGATCATGAGTAAAGGAGAAGAACTTTTCAC plus
CGTGAATTCTTTGTATAGTTCATCCATGCC as primers. The
first primer hybridizes to the 5' end of gfp and contains a
BspHI restriction site (underlined) overlapping the start
codon. The second primer hybridizes to the 3' end of gfp and
contains an EcoRI site (underlined) immediately in front of
the stop codon which is not encoded by the primer. The amplified DNA
was digested with BspHI and EcoRI and ligated
into pDSW204 and pDSW206 that had been cut with NcoI (compatible with BspHI) and EcoRI to create
plasmids pDSW207 and pDSW209.
Plasmids that allow fusion of gfp to the C termini of target
proteins were constructed similarly. The primers used to amplify gfp were CCAGCTGCAGATGAGTAAAGGAGAAGAACTTTTC
plus CCTGAAGCTTATTTGTATAGTTCATCCATGCC. The
first primer hybridizes to the 5' end of gfp and contains a
PstI site immediately preceding the start codon. The second primer hybridizes to the 3' end of gfp and contains a
HindIII site (underlined) directly after the stop codon.
The amplified DNA was digested with PstI and
HindIII and ligated into the same sites of pDSW204 and
pDSW206 to create pDSW208 and pDSW210, respectively.
Construction of gfp fusions. (i) ftsZ-gfp. First, ftsZ was amplified by PCR with pZAQ (56) as template and CAGACCATGGCAGAACCAATGGAACTTACCAAT and TGGTCTGCAGGTTGTTGTTGTTATCAGCTTGCTTACGCAGGAATG as primers. The amplified product was digested with NcoI and PstI (sites underlined) and ligated into the same sites of pDSW204 to create pDSW228. Second, gfp was obtained on a PstI-HindIII restriction fragment from pDSW208 and ligated into the same sites of pDSW228 to create pDSW230. Inclusion of the NcoI site changes the N terminus of FtsZ from MFE to MAE. The linker sequence is ADNNNLQMS, where AD are the last two residues of FtsZ and MS are the first two residues of GFP.
(ii) ftsA-gfp. ftsA was amplified by PCR with pZAQ as template and ATGGAATTCATCAAGGCGACGGACAGAAAACTG plus TGGTCTGCAGGTTGTTGTTAAACTCTTTTCGCAGCCAACT as primers. The amplified DNA fragment was digested with EcoRI and PstI (sites underlined), and ligated into the same sites of pDSW210 to create pDSW233. The EcoRI site changes the N terminus of FtsA from MIK to MEFIK. The linker sequence is EFNNNLQMS, where EF are the last two residues of FtsA and MS are the first two residues of GFP.
(iii) zipA-gfp. zipA was amplified by PCR with pJC3 as template and GACGAATTCTAGTAGTGGCAAGGTGTTAGAACAACAG and CCATATGCATGTTGTTGTTGGCGTTGGCGTCTTTGACTTC as primers. The amplified DNA fragment was digested with EcoRI and NsiI (sites underlined) and ligated into pDSW208 that had been cut with EcoRI and PstI, which is compatible with NsiI, to create pDSW242. Because the 3'-most base of the first primer hybridizes 9 bp upstream of the start codon for zipA, the translational start used in pDSW242 is the native start site for zipA and no amino acid changes have been introduced into the protein. The linker sequence is NANNNMHMS, where NA are the last two residues of ZipA and MS are the first two residues of GFP.
(iv) gfp-ftsI.
ftsI was amplified by PCR with
pLMG173 as template and
GC ACCATGgaattcAACAACAACAAAGCAGCGGCGAAAACGCAG and pBAD3'-alt
(28) as primers. The amplified DNA was digested with
NcoI (site underlined) and HindIII (site
present downstream of ftsI in pLMG173) and ligated into the
same sites of pBAD24 to create pDSW172. The FtsI protein encoded by
pDSW172 has an altered N terminus owing to the incorporation of
restriction sites for NcoI, EcoRI (lower case in
primer sequence), and three asn residues (MKA
MEFNNNKA). After
verifying that this ftsI allele complemented an
ftsI23(Ts) mutant, it was obtained from pDSW172 on an
EcoRI-HindIII restriction fragment and
ligated into the same sites of pDSW207 to create pDSW234. The fusion
protein encoded by pDSW234 has the linker sequence YKEFNNNKA, where YK are the last two residues of GFP and KA are the second and third residues of FtsI (i.e., the initiating methionine of FtsI is absent in
the fusion protein). Plasmid pDSW254, a kanamycin-resistant derivative
of pDSW207, was made as follows. A PstI fragment carrying the kan gene from pUC-4K (Pharmacia) was made blunt ended
with T4 DNA polymerase in the presence of all four dNTPs and then
ligated into pDSW207 that had been digested with FspI and
ScaI. These restriction enzymes each cut pDSW207 once within
the bla gene, so the cloning procedure results in replacing
most of bla with kan.
(v) Fusions to FtsI swap proteins. To make gfp-III, the III gene was amplified by PCR with pLD30 as template and GCACCATGgaattcAACAACAACAAAGCAGCGGCGAAAACGCAG and pBAD3'-alt (28) as primers. The amplified DNA was digested with EcoRI (site in lower case) and HindIII (site present downstream of III in pLD30) and ligated into the same sites of pDSW207 to create pDSW246. The fusion protein encoded by pDSW246 has the same linker sequence as that in GFP-FtsI. gfp-IFI, on plasmid pDSW249, also has this linker sequence and was constructed similarly, except that the template for PCR was pLD118. To make gfp-FFI, the FFI gene was amplified by PCR with pLD43 as template and CGAGAATTCAACAACAACATGGATGTCATTAAAAAGAAACATTGGTGGC and pBAD3'-alt as primers. The amplified DNA was digested with EcoRI (site underlined) and HindIII (site present downstream of FFI in pLD43) and ligated into the same sites of pDSW207 to create pDSW247. The fusion protein encoded by pDSW247 has the linker sequence YKEFNNNMD, where YK are the last two residues of GFP and MD are the first two residues of FFI, whose amino terminus is derived from malF. gfp-FII, on plasmid pDSW248, also has this linker sequence and was made similarly, except that the template for PCR was pLD57.
Complementation. (i) Complementation of Ts mutations. GFP fusion constructs and control plasmids were transformed into a strain carrying a Ts allele of ftsI, selecting for ampicillin resistance on NZY plates at 30°C. Isolates were tested for complementation by streaking onto NZY-ampicillin with 0 to 50 µM IPTG (to modulate expression of the plasmid-borne gfp fusions being tested), and growth was scored after 18 h at 42°C. Identical control plates were incubated at 30°C.
(ii) Complementation of null mutations. These tests were done in an FtsI depletion strain that has a transposon insertion in the chromosomal ftsI gene and a wild-type copy of ftsI on a plasmid. The transposon confers kanamycin resistance, while the plasmid confers chloramphenicol resistance. GFP fusion constructs in single copies at the lambda att site were transduced with P1 into the depletion strain, selecting for resistance to 25 µg of ampicillin/ml on NZY-kanamycin-chloramphenicol plates that contained 0.2% arabinose to induce the plasmid borne wild-type ftsI. Transductants were made phage free and were tested for complementation by streaking onto NZY-ampicillin-kanamycin-chloramphenicol with 0.2% glucose (to repress the plasmid-borne ftsI) and 0 to 50 µM IPTG (to induce the chromosomal gfp fusion). Plates were incubated at 30, 37, and 42°C, and growth was scored after 18 to 24 h. Control plates contained 0.2% arabinose rather than glucose.
Generation and affinity purification of polyclonal antibodies against FtsI. Polyclonal antibodies against the periplasmic domain of FtsI were raised in New Zealand White rabbits (Covance, Denver, Pa.). The protein used as antigen was obtained as follows. The periplasmic domain of ftsI (residues 41 to 577) was amplified by PCR with pLMG173 as template and GAGACCATGGCACGCGTAGCGTGGTTACAAG and TTCCGCTCGAGTGCCACAAATTCATTTTTATC as primers. The amplified DNA was digested with NcoI and XhoI (sites underlined) and ligated into the same sites of pET-26b(+) (Novagen, Madison, Wis.) to create pDSW163. This plasmid directs synthesis of cloned inserts under control of a T7lac promoter. In addition, it provides a pelB leader sequence to promote protein export and a C-terminal hexa-histidine tag to facilitate protein purification. Plasmid pDSW163 was transformed into BL21(DE3). After a 2-h induction with 1 mM IPTG, FtsI(peri)-His6 was overproduced to ~3% of total cell protein and was found almost exclusively in cytoplasmic inclusion bodies despite the presence of the leader sequence. The insoluble FtsI(peri)-His6 was purified under denaturing conditions (6 M urea) by nickel affinity chromatography according to instructions in the pET system manual (Novagen). The final preparation was ~95% pure, and the yield was ~5 mg/liter of culture. Protein to be used for raising antibodies was dialyzed against water to remove urea, and the precipitated FtsI(peri)-His6 was recovered and concentrated by centrifugation.
For affinity purification of anti-FtsI antibodies, FtsI(peri)-His6 was dialyzed into coupling buffer (100 mM NaPO4 [pH 7.0], 400 mM NaCl, 3 M guanidine), and 2 mg of protein was coupled to 1 ml of AminoLink resin (Pierce Chemical Co., Rockford, Ill.) according to the manufacturer's instructions. The coupling efficiency was >90%. The column was then equilibrated with Tris-buffered saline (TBS) (25 mM Tris [pH 7.4], 150 mM NaCl, 3 mM KCl). Anti-FtsI antiserum (5 ml) was diluted with 10 ml of TBS and passed three times over the column to allow binding of anti-FtsI antibodies. The column was washed with 10 ml of TBS containing 500 mM NaCl. Bound antibodies were then eluted with 0.1 M glycine (pH 2.5), and 1-ml fractions were collected into tubes containing 0.1 ml of 1 M Tris-HCl (pH 8.0). Peak fractions were identified by immunoblots against purified FtsI(peri)-His6 that had been spotted onto nitrocellulose. Most of the anti-FtsI activity eluted in fraction 2. This fraction was then passed over a 1-ml column of immobilized E. coli lysate (Pierce Chemical Co.) to remove antibodies that recognize soluble E. coli proteins. Fractions of 0.5 ml were collected and analyzed for protein by Bradford assay (Bio-Rad, Hercules, Calif.). Fractions 2 and 3 contained 75% of the input protein and were pooled and dialyzed against 10 mM NaPO4 (pH 7.0)-250 mM NaCl. Anti-FtsI antibodies were then concentrated threefold to a volume of ~300 µl by ultrafiltration in a Centricon 30 (Amicon, Beverly, Mass.). Purified anti-FtsI was stored at
20°C at a concentration of 0.7 mg of immunoglobulin G (IgG)/ml
in 10 mM NaPO4 (pH 7.0), 250 mM NaCl, 10 mg of bovine serum
albumin/ml, and 50% glycerol.
Growth and processing of cells for protein localization
experiments.
To prepare cells for protein localization using GFP,
an overnight culture grown in NZY containing 25 µg of ampicillin/ml
was diluted 1:2,000 into a 250-ml flask containing 20 ml of LB plus IPTG at the concentrations indicated above to induce expression of
gfp fusions. When the optical density at 600 nm
(OD600) reached ~0.2 (3 to 4 h), cells were fixed
directly in growth medium and processed for microscopy as described
below. For experiments involving temperature-sensitive mutants, the
cultures were grown at 30°C to an OD600 of ~0.2, at
which time a sample was fixed (T = 0), and 4 ml was transferred to
a flask containing 16 ml of LB (with 0% NaCl) and IPTG at 42°C.
Additional samples were fixed after 30, 45, and 60 min of incubation at
42°C. For experiments involving the FtsI-specific
-lactam
antibiotics cephalexin, piperacillin, and furazlocillin, the overnight
culture was grown in NZY containing 40 µg of kanamycin/ml. This
culture was diluted 1:2,000 into LB and IPTG and was grown at 37°C to
an OD600 of ~0.2. A sample was fixed (no drug control),
and 4 ml was transferred to a flask containing 16 ml of LB plus IPTG
and the desired antibiotic. Samples were fixed after 30, 45, 60, and 75 min of incubation. For experiments involving induction of
sfiA, an inhibitor of FtsZ ring formation, the overnight
culture was grown in NZY containing 40 µg of kanamycin/ml. This
culture was diluted 1:4,000 into LB containing kanamycin and IPTG and
was grown to an OD600 of ~0.05 (2.5 h) at which time arabinose or glucose was added to a final concentration of 0.2% to
induce or repress expression of sfiA, respectively. Samples were fixed 60 min after addition of the sugar. For experiments involving depletion strains, the overnight culture was grown in NZY
containing 40 µg of kanamycin/ml, 30 µg of chloramphenicol/ml, 25 µg of ampicillin/ml, and 0.04% arabinose. This culture was diluted
1:50 into 20 ml of NZY containing the same antibiotics, 0.01%
arabinose, and IPTG and was grown at 30°C to an OD600 of ~0.2 (3 h). Cells were washed once with NZY and inoculated 1:100 into
the same medium with either 0.01% arabinose or 0.2% glucose. Samples were fixed when the OD600 reached ~0.1
(4 h).
20°C for >1 week without loss of GFP signal.
A sample of whole cells was harvested at the end of each experiment to
verify expression of the gfp fusions by Western blot analysis: cells from 2 ml of culture, typically at an OD600
of ~0.3, were pelleted by centrifugation and resuspended in 100 µl of sodium dodecyl sulfate-polyacrylamide gel electrophoresis
gel-loading buffer. Samples were boiled for 5 min prior to electrophoresis.
Growth was monitored throughout each experiment by OD600.
We observed a marked reduction in growth, apparently due to lysis, about an hour after cultures were shifted to conditions that induce filamentation (e.g., the presence of FtsI-specific
-lactams or ftsA, ftsZ, ftsI, and ftsQ
temperature-sensitive mutants at 42°C).
Cells were processed for IFM as described (57), except that
we used a new anti-FtsI antibody (described above) at a dilution of
1:4,000.
Microscopy. Fluorescence micrographs were recorded on an Olympus BX60 microscope equipped with a 100× UPlanApo objective. Three filter sets were used: a U-MWIBA filter for GFP and fluorescein, a U-MNUA filter for DAPI, and a U-MWG filter for propidium iodide. Typical exposure times were 2 to 4 sec for GFP, 10 sec for fluorescein, and 0.1 sec for DAPI and propidium iodide Images were captured using a cooled charge-couple device camera (Princeton Instruments) and a personal computer with MetaMorph software version 3.0 (Universal Imaging Corp.). Images were processed using Adobe Photoshop 4.0.
Scoring of fluorescence micrographs. Cells and filaments were measured and scored for the presence or absence of an FtsI ring(s). Rings were identified as fluorescent bands that extended at least halfway across the diameter of the cell. Small spots of fluorescence at the middle of nonconstricting cells were not scored as FtsI rings, although they probably indicate an early stage in ring formation. In highly constricted cells bands that extended across the cell appeared as a spot but were scored as FtsI rings since they extended across the diameter of the rod at that point. The length of cells and filaments was measured using NIH Image software (developed at the U.S. National Institutes of Health and available on the Internet at http://rsb.nih.gov/nih-image/) to compare fluorescence images to a calibration standard. Only cells and filaments that were entirely within the image were scored, although this introduced a slight bias against longer filaments. Finally, only filaments with regularly spaced nucleoids (as judged by DAPI staining) were scored. Severe nucleoid segregation defects were typically observed in ~10% of the filaments, although sometimes the figure was as high as 60%. None of the Fts proteins localized in such filaments, which we suspected were dead.
Western blotting. Samples typically contained the equivalent of 200 µl of culture at an OD600 of 0.3. Proteins were separated on sodium dodecyl sulfate-10% polyacrylamide gels and transferred to nitrocellulose with a semi-dry blotter (Bio-Rad). Anti-FtsI was used at a dilution of 1:80,000. The secondary antibody was goat anti-rabbit IgG conjugated to horseradish peroxidase and diluted 1:25,000, and detection was performed with SuperSignal chemiluminescent substrate (both from Pierce Chemical Co.) and exposure to X-OMAT film (Kodak, Rochester, N.Y.). Densitometry of film was done with a Fluor-S MultiImager system (Bio-Rad).
| |
RESULTS |
|---|
|
|
|---|
A fusion of gfp to ftsI.
To further our
studies of FtsI localization, we constructed a gfp-ftsI
translational fusion that places a bright variant of GFP
(16) at the amino terminus (cytoplasmic domain) of FtsI. We
then integrated the gfp-ftsI fusion into the chromosome at the
attachment site (attB). In addition to
gfp-ftsI at attB, a wild-type copy of
ftsI was present at the normal chromosomal locus. Expression
of gfp-ftsI was driven from an IPTG-inducible promoter.
|
|
|
cysteine) is a dominant
negative. Thus, the simplest interpretation of our complementation experiment is that GFP-FtsI supports division.
Localization of FtsI with altered membrane anchors. FtsI consists of a small cytoplasmic domain, a single membrane-spanning segment, and a large periplasmic domain that encodes the transpeptidase activity involved in peptidoglycan synthesis (reviewed in reference 44). Replacement of the membrane anchor (i.e., cytoplasmic domain plus membrane-spanning segment) with a cleavable signal sequence from OmpA results in production of the periplasmic domain of FtsI as a soluble protein in the periplasm (22). Although this soluble form of FtsI is catalytically active, it does not complement an ftsI(Ts) mutation, indicating that the membrane anchor is important for cell division (25).
Previously, we investigated whether the cytoplasmic domain and membrane-spanning segment serve only to tether the periplasmic domain to the membrane or whether these small domains have a more sophisticated function (28). To do this, we introduced restriction sites at either end of the membrane-spanning segment and used these sites to replace the cytoplasmic domain and membrane-spanning segment with analogous parts of other membrane proteins. We found that these so-called "swap" proteins inserted into the membrane and retained transpeptidase catalytic activity as determined by a penicillin-binding assay. Nevertheless, they failed to support cell division. We speculated that the swap proteins might be defective in localization to the division site. To test this hypothesis, we fused GFP to several swap proteins: III, FFI, FII, and IFI. The three-letter names indicate the source of each domain in the swap proteins. For example, III refers to a protein in which all three domains
cytoplasmic, membrane-spanning, and
periplasmic
are derived from FtsI. This protein is encoded by the
ftsI allele that carries restriction sites flanking the membrane-spanning segment. These restriction sites introduced a single
amino acid change at each end of the membrane-spanning segment.
Although the III gene is not fully wild type, it
complemented an ftsI null mutant (transposon insertion) in
our previous study (but see below). FFI, FII, and IFI refer to proteins
which carry a cytoplasmic domain and/or membrane-spanning segment from
MalF, a maltose transport protein with no role in cell division. None of these swap alleles complemented an ftsI null mutant.
To test for localization of the swap proteins, cells expressing GFP
fusions to the swap genes were fixed and examined by fluorescence microscopy. The GFP-III protein localized, albeit poorly, while GFP-FFI, GFP-FII, and GFP-IFI did not appear to localize at all (Fig. 2
and Table 2). Western blotting indicated that the stability and
abundance of each swap protein was similar to that of GFP-FtsI (Fig.
1). Because the III protein has a localization defect, we conclude that
the sequence of the borders of the membrane spanning segment are
important for localization. Because the FII and IFI proteins have a
more severe localization defect, the cytoplasmic domain and/or membrane
spanning segment may also be important for localization (see Discussion).
The localization defect observed for GFP-III was not expected given our
previous report that the III protein supports cell division. In those
studies, we scored complementation by the III allele as
somewhat weaker than that of the wild type. Both genes were expressed
at high levels from pBR-derived plasmids with an estimated copy number
of 30 to 50 per cell. In contrast, for localization studies we
expressed gfp-III at physiological levels from a single-copy chromosomal gene. Besides expression level, the other obvious difference is the presence of the GFP tag, but this does not appear to
disturb wild-type FtsI, making it unlikely that GFP is the cause of the
defect in the GFP-III protein.
Consistent with our previous report, we found that plasmid-borne
gfp-III complemented an ftsI23(Ts) mutation
almost as well as gfp-ftsI, while gfp-FFI,
gfp-FII, and gfp-IFI did not complement at all.
To assay gfp-III for complementation under conditions similar to those used for localization, we transduced
gfp-III into the ftsI depletion strain to create
EC556. Growth of EC556 was not dependent upon arabinose,
indicating that gfp-III complements the transposon
insertion (Table 2). But complementation was poor compared to that by
gfp-ftsI, especially at 42°C. Below 50 µM IPTG, the
colonies were rough and flat. Cells from these colonies examined under
the microscope were filamentous. At 50 µM IPTG, colony morphology was
normal, and only a few of the cells were long filaments. In contrast,
EC552, which expresses gfp-ftsI, exhibited normal colony and
cell morphology throughout the range of 0 to 50 µM IPTG. These
observations are consistent with the III protein having a localization
defect that can be partly relieved by overproduction.
Localization of GFP-FtsI in the presence of FtsI-specific
-lactams.
Several
-lactam antibiotics, among them
cephalexin, furazlocillin, and piperacillin, cause E. coli cells to filament. These antibiotics specifically inactivate
FtsI by acylation of serine 307 in the transpeptidase catalytic site
(24, 45). To test whether FtsI needs its transpeptidase
activity to localize to a division site, we examined the effect of
these
-lactams on localization of GFP-FtsI (Fig.
3A and B).
|
-lactams, but our IFM
procedures do not detect FtsI very consistently. An alternative which
we cannot exclude is that
-lactams diminish localization of FtsI but
not of GFP-FtsI. This would be the case if, for example, GFP-FtsI does
not react with any of the three
-lactams tested, although this seems
unlikely because GFP-FtsI does not confer resistance to cephalexin or
piperacillin (not shown).
We verified by Western blotting that none of the antibiotic treatments
affected the level of FtsI or GFP-FtsI (reference 46 and data not shown).
Dependency of localization on FtsZ, FtsA, FtsQ, and FtsL.
To
determine whether localization of FtsI to the division site depends on
the activities of three other essential division proteins
FtsZ, FtsA,
and FtsQ
we transduced Ts mutations in each of these proteins into a
strain carrying gfp-ftsI at attB and a wild-type
copy of ftsI at the normal chromosomal locus. The ftsZ84(Ts) allele encodes a protein that fails to make Z
rings at the nonpermissive temperature (46),
although rings form within minutes upon return to the permissive
temperature (4). The ftsA12(Ts) allele encodes a
protein that fails to localize to the division site at the
nonpermissive temperature (5). The localization behavior of
the protein encoded by ftsQ1(Ts) has not been reported. Our
findings with the Ts mutants are presented in Fig.
4 and Table
3.
|
|
|
Localization of other division proteins in an ftsI(Ts) mutant. We fused gfp to ftsZ, ftsA, zipA, ftsQ, and ftsL, and placed these fusions on the chromosome using lambda InCh. The fusions to ftsQ and ftsL and their behavior in an ftsI23(Ts) mutant will be described elsewhere (15, 23). The fusions to ftsZ, ftsA, and zipA are similar to those previously published (29, 38). The fusion to ftsZ complements the ftsZ84(Ts) allele, but the fusion to ftsA does not complement the ftsA12(Ts) allele (data not shown). The fusion to zipA and was not tested for complementation.
To determine whether localization of any of these proteins depends upon FtsI, we transduced the ftsI23(Ts) allele into strains that express each of these gfp fusions and compared localization at the permissive and nonpermissive temperatures. Confirming results obtained with IFM, FtsZ (2, 46) and FtsA (5) localized well at 30°C and 42°C, implying that localization of these proteins to the division site is independent of FtsI (Table 5). The ZipA-GFP protein also localized well at both temperatures (Fig. 5; Table 5). We conclude that ZipA does not require FtsI to localize to the site of septation.
|
|
| |
DISCUSSION |
|---|
|
|
|---|
Little is known about the mechanism(s) by which bacterial proteins are localized to discrete subcellular sites such as the septum or the pole(s). In a couple of instances of polar localization, proteolysis plays an important role by clearing the target protein from the rest of the cell (6, 20, 49), but what protects the target protein from proteolysis at the pole(s) is not yet known. At least two proteins that localize to the division site, FtsA and ZipA, probably do so by binding directly to another protein, FtsZ, that is already present at that site; how FtsZ finds the division site remains to be determined (18, 29, 39, 54). There are several additional instances, most related to cell division, in which localization of a protein depends upon (prior?) localization of another protein(s) (3, 36, 53, 59). In these cases, it is not yet clear whether the interactions are direct.
Here we have used a fusion of gfp to ftsI to study targeting of FtsI to the division site of E. coli. gfp-ftsI was integrated into the chromosome with the aid of a newly constructed lambda vector, lambda InCh, that greatly simplifies this process. gfp-ftsI was expressed at physiologically appropriate levels under control of an IPTG-regulatable promoter. Although gfp-ftsI complemented a null mutation in ftsI, most of our studies were done in merodiploids that also had a wild-type copy of ftsI in the normal chromosomal location (the 2-min region).
Confirming previous results obtained by IFM (53, 57), GFP-FtsI localized to the division site in about half of the cells growing in rich medium, with a doubling time of 25 to 30 min. Strong polar localization of GFP-FtsI was not observed unless the protein was overproduced 10-fold relative to wild-type FtsI, suggesting that our previous observation of polar FtsI with IFM was an artifact. Polar FtsI was not reported by Wang et al. (53), who used IFM.
FtsI's membrane anchor is important for septal localization. How are the membrane proteins involved in septum assembly targeted to the division site? Recent progress argues against the naive hope that these proteins might share a targeting motif. No such motif is apparent from sequence comparisons. More convincingly, septal localization depends on the cytoplasmic domain in the case of ZipA, the periplasmic domain of in the case of FtsN, and the membrane anchor in the case of FtsK (3, 29, 59).
As a first step towards defining sequences in FtsI that are involved in targeting the protein to the division site, we fused GFP to several swap proteins in which the cytoplasmic domain and/or membrane spanning segment of FtsI had been replaced with analogous parts of MalF, a maltose transport protein with no role in cell division (28). Interestingly, none of the swap proteins localized to the division site. We draw three conclusions from this finding. (i) Failure of the FFI, FII, and IFI proteins to localize plausibly accounts for their failure to complement null mutations in ftsI. Accounting for the complementation defect is an issue because all three swap proteins appear to insert into the membrane with the proper topology and retain penicillin-binding activity (28). (ii) The membrane anchor (i.e., the cytoplasmic domain plus the membrane spanning segment) has a role in targeting FtsI to the division site. (iii) The poor localization and complementation exhibited by the GFP-III protein, which differs from GFP-FtsI by just one amino acid at each end of the transmembrane domain, indicates that the borders of the membrane-spanning segment are important for FtsI function. With respect to the role of the membrane anchor in septal localization, the simplest interpretation of our findings is that both the cytoplasmic domain and the transmembrane segment are required. However, preliminary results from our lab indicate that most of the cytoplasmic domain can be deleted without loss of ftsI function in cell division; only deletions that approach the presumed border between the cytoplasmic domain and membrane-spanning segment fail to complement a Ts mutant when expressed from plasmids. Thus, it is possible that our FII swap affects both the cytoplasmic domain and the membrane-spanning segment. The membrane-spanning segment of FtsI appears to be unusually short, with only 17 amino acids separating the Arg residues (arbitrarily) defined as the ends of the segment. Lengthening the membrane-spanning segment by just one residue abolishes FtsI function in cell division (28). Moreover, the short length of the transmembrane domain, but not its sequence, is conserved in FtsI proteins from other organisms (data not shown). In contrast, the transmembrane domains of other bitopic cell division proteins in E. coli appear to range in length from 20 (FtsL) to 28 (FtsN) residues, while E. coli PBP2, which appears to be the primary transpeptidase for elongation, is predicted to have a transmembrane domain of 25 amino acids (7, 17, 26). These observations suggest that the length of the transmembrane domain of FtsI is important. What might be the mechanism by which FtsI's short membrane-spanning segment directs the protein to the septum? Perhaps the cytoplasmic membrane is thin at the division site. In this case, the short transmembrane domain would function directly as a localization signal, and recruitment of FtsI to the division site might depend upon membrane alterations induced by other division proteins that localize to this site prior to FtsI (Fig. 6) (see below). Interestingly, several bitopic membrane proteins found in the eukaryotic Golgi apparatus have short transmembrane domains (~17 amino acids) that serve as targeting signals (41). Golgi membranes have little cholesterol and are therefore thinner than cytoplasmic membranes in eukaryotes. An alternative possibility is that accommodating the short membrane-spanning segment in the lipid bilayer forces the periplasmic domain into a precise orientation that is necessary for its assembly into a protein complex. For example, Höltje and coworkers (32) have evidence for a protein complex involving FtsI and several other enzymes involved in peptidoglycan metabolism. If these interactions (or others that remain to be described) are important for septal localization, then the primary localization determinants in FtsI would be sequences in the periplasmic domain. Although these ideas are speculative, they make testable predictions about the behavior of certain mutants.
|
The transpeptidase catalytic activity might not be required for
septal localization.
We found that GFP-FtsI localizes to potential
division sites in the presence of three different
-lactam
antibiotics that specifically inhibit the transpeptidase activity of
FtsI
cephalexin, piperacillin, and furazlocillin. GFP-FtsI was
localized in nearly 100% of the filaments, and the localization
signals were quite strong. Our findings conflict with those of Wang et
al. (53), who used IFM and reported that furazlocillin
prevents localization of FtsI. However, in our hands wild-type FtsI
localized in furazlocillin-treated cells (filaments) as determined by
IFM, although the data were not as clean or as reproducible as those we
obtained with GFP-FtsI. The simplest interpretation of our observations
is that FtsI does not require its transpeptidase activity for septal
localization. Nevertheless, it remains possible that GFP-FtsI responds
aberrantly to
-lactams. FtsI's transpeptidase activity can also be
inactivated genetically by changing serine 307 in the active site to
cysteine. This mutant protein blocks cell division when overproduced
(13), perhaps because it competes for localization to the
division site. Efforts are underway in our lab to fuse this form of
FtsI to GFP so that the localization behavior of a catalytically
inactive FtsI protein can be studied directly.
FtsI is a late recruit to the septal ring.
Localization of
GFP-FtsI to the division site required the Z ring, FtsA, FtsQ, and
FtsL. The requirement for FtsZ and FtsA has also been observed using
IFM (53). Conversely, we found that many other division
proteins localize in an FtsI-independent fashion
this was shown here
for FtsZ, FtsA, and ZipA, and will be published elsewhere for FtsQ and
FtsL (15, 23). In the cases of FtsZ and FtsA, our findings
confirm results obtained by IFM (2, 5, 46). Taken together,
these findings indicate that FtsI is a late recruit to the septal ring.
| |
ACKNOWLEDGMENTS |
|---|
We thank Rich Losick for use of his microscope, Ted Park for furazlocillin, Debu Raychaudhuri for strain DRC14, Susan Gottesman for pCGS165-sfiA+, and Brendan Cormack for pGFPmt2. We thank Barry Wanner and members of the Beckwith lab for helpful discussions.
This work was supported by grants from the American Cancer Society and the National Institutes of Health (GM 38922). J.B. is an American Cancer Society Research Professor. D.S.W. was a DOE Energy Biosciences Fellow of the Life Sciences Research Foundation. J.C.C. was supported by a predoctoral fellowship from the National Science Foundation. J.-M.G. was supported by the Institut Pasteur, France.
| |
FOOTNOTES |
|---|
* Corresponding author. Present address: Department of Microbiology, University of Iowa, 3403 Bowen Science Building, Iowa City, IA 52242. Phone: (319) 335-7785. Fax: (319) 335-7949. E-mail: david-weiss{at}uiowa.edu.
Present address: Unité de Physiologie Cellulaire Institut
Pasteur (CNRS URA 1300), 75724 Paris Cedex 15, France.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Adam, M.,
C. Fraipont,
N. Rhazi,
M. Nguyen-Distèche,
B. Lakaye,
J. M. Frère,
B. Devreese,
J. Van Beeumen,
Y. van Heijenoort,
J. van Heijenoort, and J. M. Ghuysen.
1997.
The bimodular G57-V577 polypeptide chain of the class B penicillin-binding protein 3 of Escherichia coli catalyzes peptide bond formation from thiolesters and does not catalyze glycan chain polymerization from the lipid II intermediate.
J. Bacteriol.
179:6005-6009 |
| 2. |
Addinall, S. G.,
E. Bi, and J. Lutkenhaus.
1996.
FtsZ ring formation in fts mutants.
J. Bacteriol.
178:3877-3884 |
| 3. | Addinall, S. G., C. Cao, and J. Lutkenhaus. 1997. FtsN, a late recruit to the septum in Escherichia coli. Mol. Microbiol. 25:303-309[Medline]. |
| 4. |
Addinall, S. G.,
C. Cao, and J. Lutkenhaus.
1997.
Temperature shift experiments with an ftsZ84(Ts) strain reveal rapid dynamics of FtsZ localization and indicate that the Z ring is required throughout septation and cannot reoccupy division sites once constriction has initiated.
J. Bacteriol.
179:4277-4284 |
| 5. |
Addinall, S. G., and J. Lutkenhaus.
1996.
FtsA is localized to the septum in an FtsZ-dependent manner.
J. Bacteriol.
178:7167-7172 |
| 6. |
Alley, M. R.,
J. R. Maddock, and L. Shapiro.
1993.
Requirement of the carboxyl terminus of a bacterial chemoreceptor for its targeted proteolysis.
Science
259:1754-1757 |
| 7. | Asoh, S., H. Matsuzawa, F. Ishino, J. L. Strominger, M. Matsuhashi, and T. Ohta. 1986. Nucleotide sequence of the pbpA gene and characteristics of the deduced amino acid sequence of penicillin-binding protein 2 of Escherichia coli K12. Eur. J. Biochem. 160:231-238[Medline]. |
| 8. | Bi, E. F., and J. Lutkenhaus. 1991. FtsZ ring structure associated with division in Escherichia coli. Nature 354:161-164[Medline]. |
| 9. |
Botta, G. A., and J. T. Park.
1981.
Evidence for involvement of penicillin-binding protein 3 in murein synthesis during septation but not during cell elongation.
J. Bacteriol.
145:333-340 |
| 10. | Bowler, L. D., and B. G. Spratt. 1989. Membrane topology of penicillin-binding protein 3 of Escherichia coli. Mol. Microbiol. 3:1277-1286[Medline]. |
| 11. | Boyd, D., D. S. Weiss, J. C. Chen, and J. Beckwith. Unpublished data. |
| 12. | Bramhill, D. 1997. Bacterial cell division. Annu. Rev. Cell. Dev. Biol. 13:395-424[Medline]. |
| 13. | Broome-Smith, J. K., P. J. Hedge, and B. G. Spratt. 1985. Production of thiol-penicillin-binding protein 3 of Escherichia coli using a two primer method of site-directed mutagenesis. EMBO J. 4:231-235[Medline]. |
| 14. |
Chalfie, M.,
Y. Tu,
G. Euskirchen,
W. W. Ward, and D. C. Prasher.
1994.
Green fluorescent protein as a marker for gene expression.
Science
263:802-805 |
| 15. |
Chen, J. C.,
D. S. Weiss,
J.-M. Ghigo, and J. Beckwith.
1998.
Septal localization of FtsQ, an essential cell division protein in Escherichia coli.
J. Bacteriol.
181:521-530 |
| 16. | Cormack, B. P., R. H. Valdivia, and S. Falkow. 1996. FACS-optimized mutants of the green fluorescent protein (GFP). Gene 173:33-38[Medline]. |
| 17. |
Dai, K.,
Y. Xu, and J. Lutkenhaus.
1993.
Cloning and characterization of ftsN, an essential cell division gene in Escherichia coli isolated as a multicopy suppressor of ftsA12(Ts).
J. Bacteriol.
175:3790-3797 |
| 18. | Din, N., E. M. Quardokus, M. J. Sackett, and Y. V. Brun. 1998. Dominant C-terminal deletions of FtsZ that affect its ability to localize in Caulobacter and its interaction with FtsA. Mol. Microbiol. 27:1051-1063[Medline]. |
| 19. |
Dougherty, T. J.,
K. Kennedy,
R. E. Kessler, and M. J. Pucci.
1996.
Direct quantitation of the number of individual penicillin-binding proteins per cell in Escherichia coli.
J. Bacteriol.
178:6110-6115 |
| 20. | Egile, C., H. d'Hauteville, C. Parsot, and P. J. Sansonetti. 1997. SopA, the outer membrane protease responsible for polar localization of IcsA in Shigella flexneri. Mol. Microbiol. 23:1063-1073[Medline]. |
| 21. |
Ehrmann, M.,
D. Boyd, and J. Beckwith.
1990.
Genetic analysis of membrane protein topology by a sandwich gene fusion approach.
Proc. Natl. Acad. Sci. USA
87:7574-7578 |
| 22. | Fraipont, C., M. Adam, M. Nguyen-Distèche, W. Keck, J. Van Beeumen, J. A. Ayala, B. Granier, H. Hara, and J. M. Ghuysen. 1994. Engineering and overexpression of periplasmic forms of the penicillin-binding protein 3 of Escherichia coli. Biochem. J. 298:189-195. |
| 23. | Ghigo, J.-M., D. S. Weiss, J. Chen, J. C. Yarrow, and J. Beckwith. Mol. Microbiol., in press. |
| 24. | Ghuysen, J. M. 1994. Molecular structures of penicillin-binding proteins and beta-lactamases. Trends Microbiol. 2:372-380[Medline]. |
| 25. |
Goffin, C.,
C. Fraipont,
J. Ayala,
M. Terrak,
M. Nguyen-Distèche, and J. M. Ghuysen.
1996.
The non-penicillin-binding module of the tripartite penicillin-binding protein 3 of Escherichia coli is required for folding and/or stability of the penicillin-binding module and the membrane-anchoring module confers cell septation activity on the folded structure.
J. Bacteriol.
178:5402-5409 |
| 26. | Guzman, L. M., J. J. Barondess, and J. Beckwith. 1992. FtsL, an essential cytoplasmic membrane protein involved in cell division in Escherichia coli. J. Bacteriol. 174:7716-7728. |
| 27. |
Guzman, L. M.,
D. Belin,
M. J. Carson, and J. Beckwith.
1995.
Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter.
J. Bacteriol.
177:4121-4130 |
| 28. |
Guzman, L. M.,
D. S. Weiss, and J. Beckwith.
1997.
Domain-swapping analysis of FtsI, FtsL, and FtsQ, bitopic membrane proteins essential for cell division in Escherichia coli.
J. Bacteriol.
179:5094-5103 |
| 29. | Hale, C. A., and P. A. de Boer. 1997. Direct binding of FtsZ to ZipA, an essential component of the septal ring structure that mediates cell division in E. coli. Cell 88:175-185[Medline]. |
| 30. | Harry, E. J., and R. G. Wake. 1997. The membrane-bound cell division protein DivIB is localized to the division site in Bacillus subtilis. Mol. Microbiol. 25:275-283[Medline]. |
| 31. |
Heim, R.,
D. C. Prasher, and R. Y. Tsien.
1994.
Wavelength mutations and posttranslational autoxidation of green fluorescent protein.
Proc. Natl. Acad. Sci. USA
91:12501-12504 |
| 32. |
Höltje, J. V.
1998.
Growth of the stress-bearing and shape-maintaining murein sacculus of Escherichia coli.
Microbiol. Mol. Biol. Rev.
62:181-203 |
| 33. |
Huisman, O.,
R. D'Ari, and S. Gottesman.
1984.
Cell-division control in Escherichia coli: specific induction of the SOS function SfiA protein is sufficient to block septation.
Proc. Natl. Acad. Sci. USA
81:4490-4494 |
| 34. | Katis, V. L., E. J. Harry, and R. G. Wake. 1997. The Bacillus subtilis division protein DivIC is a highly abundant membrane-bound protein that localizes to the division site. Mol. Microbiol. 26:1047-1055[Medline]. |
| 35. |
Levin, P. A., and R. Losick.
1996.
Transcription factor Spo0A switches the localization of the cell division protein FtsZ from a medial to a bipolar pattern in Bacillus subtilis.
Genes Dev.
10:478-488 |
| 36. | Levin, P. A., R. Losick, P. Stragier, and F. Arigoni. 1997. Localization of the sporulation protein SpoIIE in Bacillus subtilis is dependent upon the cell division protein FtsZ. Mol. Microbiol. 25:839-846[Medline]. |
| 37. | Lutkenhaus, J., and S. G. Addinall. 1997. Bacterial cell division and the Z ring. Annu. Rev. Biochem. 66:93-116[Medline]. |
| 38. |
Ma, X.,
D. W. Ehrhardt, and W. Margolin.
1996.
Colocalization of cell division proteins FtsZ and FtsA to cytoskeletal structures in living Escherichia coli cells by using green fluorescent protein.
Proc. Natl. Acad. Sci. USA
93:12998-13003 |
| 39. |
Ma, X.,
Q. Sun,
R. Wang,
G. Singh,
E. L. Jonietz, and W. Margolin.
1997.
Interactions between heterologous FtsA and FtsZ proteins at the FtsZ ring.
J. Bacteriol.
179:6788-6797 |
| 40. | Miller, J. H. 1992. A short course in bacterial genetics: a laboratory manual and handbook for Escherichia coli and related bacteria. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 41. | Munro, S. 1995. Localization of proteins to the Golgi apparatus. Trends Cell Biol. 8:11-15. |
| 42. | Nakamura, M., I. N. Maruyama, M. Soma, J. Kato, H. Suzuki, and Y. Horota. 1983. On the process of cellular division in Escherichia coli: nucleotide sequence of the gene for penicillin-binding protein 3. Mol. Gen. Genet. 191:1-9[Medline]. |
| 43. |
Nanninga, N.
1998.
Morphogenesis of Escherichia coli.
Microbiol. Mol. Biol. Rev.
62:110-129 |
| 44. | Nguyen-Distèche, M., C. Fraipont, N. Buddelmeijer, and N. Nanninga. 1998. The structure and function of Escherichia coli penicillin-binding protein 3. Cell. Mol. Life Sci. 54:309-316[Medline]. |
| 45. |
Nicholas, R. A.,
J. L. Strominger,
H. Suzuki, and Y. Hirota.
1985.
Identification of the active site in penicillin-binding protein 3 of Escherichia coli.
J. Bacteriol.
164:456-460 |
| 46. |
Pogliano, J.,
K. Pogliano,
D. S. Weiss,
R. Losick, and J. Beckwith.
1997.
Inactivation of FtsI inhibits constriction of the FtsZ cytokinetic ring and delays the assembly of FtsZ rings at potential division sites.
Proc. Natl. Acad. Sci. USA
94:559-564 |
| 47. | Pogliano, K., E. Harry, and R. Losick. 1995. Visualization of the subcellular location of sporulation proteins in Bacillus subtilis using immunofluorescence microscopy. Mol. Microbiol. 18:459-470[Medline]. |
| 48. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 49. | Shere, K. D., S. Sallustio, A. Manessis, T. G. D'Aversa, and M. B. Goldberg. 1997. Disruption of IcsP, the major Shigella protease that cleaves IcsA, accelerates actin-based motility. Mol. Microbiol. 25:451-462[Medline]. |
| 50. |
Spratt, B. G.
1975.
Distinct penicillin binding proteins involved in the division, elongation, and shape of Escherichia coli K12.
Proc. Natl. Acad. Sci. USA
72:2999-3003 |
| 51. | Spratt, B. G., and A. B. Pardee. 1975. Penicillin-binding proteins and cell shape in E. coli. Nature 254:516-517[Medline]. |
| 52. |
Strauch, K. L., and J. Beckwith.
1988.
An Escherichia coli mutation preventing degradation of abnormal periplasmic proteins.
Proc. Natl. Acad. Sci. USA
85:1576-1580 |
| 53. |
Wang, L.,
M. K. Khattar,
W. D. Donachie, and J. Lutkenhaus.
1998.
FtsI and FtsW are localized to the septum in Escherichia coli.
J. Bacteriol.
180:2810-2816 |
| 54. |
Wang, X.,
J. Huang,
A. Mukherjee,
C. Cao, and J. Lutkenhaus.
1997.
Analysis of the interaction of FtsZ with itself, GTP, and FtsA.
J. Bacteriol.
179:5551-5559 |
| 55. | Wang, X., and J. Lutkenhaus. 1993. The FtsZ protein of Bacillus subtilis is localized at the division site and has GTPase activity that is dependent upon FtsZ concentration. Mol. Microbiol. 9:435-442[Medline]. |
| 56. | Ward, J. J., and J. Lutkenhaus. 1985. Overproduction of FtsZ induces minicell formation in E. coli. Cell 42:941-949[Medline]. |
| 57. | Weiss, D. S., K. Pogliano, M. Carson, L. M. Guzman, C. Fraipont, M. Nguyen-Distèche, R. Losick, and J. Beckwith. 1997. Localization of the Escherichia coli cell division protein Fts1 (PBP3) to the division site and cell pole. Mol. Microbiol. 25:671-681[Medline]. |
| 58. |
Wientjes, F. B., and N. Nanninga.
1989.
Rate and topography of peptidoglycan synthesis during cell division in Escherichia coli: concept of a leading edge.
J. Bacteriol.
171:3412-3419 |
| 59. |
Yu, X. C.,
A. H. Tran,
Q. Sun, and W. Margolin.
1998.
Localization of cell division protein FtsK to the Escherichia coli septum and identification of a potential N-terminal targeting domain.
J. Bacteriol.
180:1296-1304 |
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»