Previous Article | Next Article 
Journal of Bacteriology, January 1999, p. 585-592, Vol. 181, No. 2
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Polyhydroxyalkanoate Inclusion Body-Associated
Proteins and Coding Region in Bacillus
megaterium
Gabriel J.
McCool1 and
Maura C.
Cannon2,*
Department of
Microbiology1 and
Department of
Biochemistry and Molecular Biology,2
University of Massachusetts, Amherst, Massachusetts 01003
Received 20 July 1998/Accepted 9 November 1998
 |
ABSTRACT |
Polyhydroxyalkanoic acids (PHA) are carbon and energy storage
polymers that accumulate in inclusion bodies in many bacteria and
archaea in response to environmental conditions. This work presents the
results of a study of PHA inclusion body-associated proteins and an
analysis of their coding region in Bacillus
megaterium 11561. A 7,917-bp fragment of DNA was cloned and
shown to carry a 4,104-bp cluster of 5 pha genes,
phaP, -Q, -R, -B, and
-C. The phaP and -Q genes were
shown to be transcribed in one orientation, each from a separate
promoter, while immediately upstream, phaR, -B,
and -C were divergently transcribed as a tricistronic
operon. Transfer of this gene cluster to Escherichia coli
and to a PhaC
mutant of Pseudomonas putida
gave a Pha+ phenotype in both strains. Translational
fusions to the green fluorescent protein localized PhaP and PhaC to the
PHA inclusion bodies in living cells. The data presented are consistent
with the hypothesis that the extremely hydrophilic protein PhaP is a storage protein and suggests that PHA inclusion bodies are not only a
source of carbon, energy, and reducing equivalents but are also a
source of amino acids.
 |
INTRODUCTION |
Polyhydroxyalkanoic acids (PHA) are
a class of aliphatic polyesters that accumulate in inclusion bodies in
many bacteria and archaea (2, 41). Their physiological role
in the cell is that of carbon and energy reserves and that of a sink
for reducing power. The most-studied PHA have repeating subunits of
-[O-CH(R)(CH2)xCO]-, where the
most common form is polyhydroxybutyrate, for which R is CH3
and x is 1 (45). The PHA biosynthetic pathway has
been worked out for Alcaligenes eutrophus (17, 18,
44). In this organism two molecules of acetyl coenzyme A (acetyl
CoA) are condensed by
-ketothiolase (PhaA), followed by a
stereo-specific reduction catalyzed by an NADPH-dependent reductase
(PhaB) to produce the monomer D-(
)-
-hydroxybutyryl CoA, which is
polymerized by PHA synthase (PhaC). These three pha genes
are encoded on the phaCAB operon, which is
constitutively expressed, but PHA is not constitutively synthesized. Alternative pathways for synthesis of the monomer in other
organisms have been suggested, most notably in the
Pseudomonas species where the side chain, R, is longer than
CH3 and its composition is influenced by carbon substrates
in the growth medium (7, 45). In addition to being cloned
from A. eutrophus, phaC has been cloned from more
than 20 different bacteria (26, 43). Other genes associated
with PHA synthesis, phaA, phaB, phaZ
(PHA depolymerase), and genes for inclusion body-associated proteins and other low-molecular-weight proteins of unknown function, have also
been cloned from some of these bacteria, in many cases by virtue of the
fact that they are clustered with phaC.
PHA inclusion bodies are 0.2 to 0.5 µm in diameter, but their
structural details are largely unknown. They were described originally for some species of Bacillus (6, 8, 15, 30, 47) and later for many more bacteria, including
Pseudomonas, Alcaligenes, and
Rhodococcus species (5, 11, 12, 25, 42). Those
from Bacillus megaterium were shown to contain 97.7% PHA,
1.87% protein, and 0.46% lipid, with protein and lipid forming an
outer layer (15). More recent reports show the presence of a
14-kDa protein (GA14) on PHA inclusion bodies of Rhodococcus ruber (36, 37) and a 24-kDa protein (GA24) with
similarities to GA14 on the inclusion bodies of A. eutrophus
(48). These proteins are not essential for PHA accumulation
but have been shown to influence the size of PHA inclusion bodies and
the rate of PHA accumulation (37, 48). GA14 and GA24 have
been named phasins due to some similarities with oleosins, which are
proteins on the surface of oil bodies in plant seeds (21).
Proteins with similarity to GA24 are widespread in PHA-accumulating
bacteria (49).
We have previously described the pattern of PHA inclusion body growth
and proliferation throughout the growth cycle of B. megaterium (32). We now present the results of a study
of PHA inclusion body-associated proteins from B. megaterium and the cloning and analysis of their coding region.
The transcription starts were identified, the functional expression of
some of the genes was confirmed in Escherichia coli
and in a PHA-negative mutant of Pseudomonas putida, and PhaP
and PhaC were localized to PHA inclusion bodies throughout growth.
 |
MATERIALS AND METHODS |
Bacterial strains and plasmids.
The bacterial strains and
plasmids used in this study are listed in Table
1.
Media and growth conditions.
Cultures were grown at 37°C
(unless otherwise stated) in liquid media, aerated by rotation at 250 rpm in either Luria-Bertani broth (LB) (33) or M9 minimal
salts (Life Technologies) with 1% (wt/vol) glucose. For growth on
plates, the above media with 1.5% agar (Sigma catalog no. A4550) were
used. For plasmid selections, the appropriate antibiotics were
included in the media: ampicillin (200 µg/ml [AMP200]),
chloramphenicol (25 µg/ml [CM25]),
erythromycin (200 µg/ml [EM200]), or tetracycline (12.5 µg/ml [TC12.5]) for plasmid selection in E. coli; CM12 alone or EM1 plus lincomycin
(25 µg/ml [LM25]) for plasmid selection in
B. megaterium; and CM160 or
TC30 for selection in Pseudomonas.
Separation of polypeptides associated with PHA inclusion
bodies.
Inclusion bodies were purified as previously described
(32) followed by suspension in TE (10 mM Tris-HCl [pH 8],
1 mM EDTA) with 2% sodium dodecyl sulfate (SDS). An equal volume of
2× sample buffer was added prior to boiling for 5 min, and samples
were centrifuged for 3 min to pellet PHA; the supernatant was loaded on
an SDS-12% polyacrylamide gel and run at 8 mA overnight at 4°C to
separate the proteins. The gel was stained with Coomassie blue for 5 min prior to transfer of proteins to a polyvinylidene difluoride (PVDF)
membrane by using a semidry electroblotter at 400 mA for 45 min. The
membrane carrying the proteins of interest was cut for use in
N-terminal amino acid sequence determination by Edman degradation using
a minimum of 200 pmol of each protein.
Transformations.
E. coli and P. putida were
transformed by electroporation of competent cells using an
electroporator (Eppendorf) and following the manufacturer's
instructions. B. megaterium was transformed by a
biolistic transformation procedure (39).
Cloning the pha region.
Purification of genomic
and plasmid DNA, Southern blotting, hybridization, and cloning were
performed by standard procedures (38). To clone the DNA
sequences that coded for the two most abundant proteins on purified PHA
inclusion bodies, degenerate oligonucleotide probes based on their
N-terminal amino acid sequences were used. They were
AAYACRGTNAAATAYNNNACRGTNATYNNNGCDATGATG (n2) and
GCDATYCCDTAYGTNCARGAAGGHTTYAAA (n5) for the 20- and 41-kDa proteins, respectively (see Fig. 1). The restriction fragments indicated by the probes, when separately hybridized at 38°C in Southern blotting experiments to various restriction enzyme digests of
B. megaterium genomic DNA, were purified from agarose
following electrophoresis and cloned into pBluescriptIISK. Positive
clones were identified by hybridization to the same degenerate probes, thus yielding pGM1. Sequences contiguous with and overlapping this
primary cloned fragment were cloned in a similar manner, except that
probes based on the ends of the sequenced DNA fragment were used and
hybridization was at 55°C. The probes used were GCTTCATGCGTGCGGTTTG (bmp) and GGACCGTTCGGAAAATCAGCGG
(bmc), yielding pGM9 and pGM6 (see Fig. 2), respectively.
Sequencing the pha region.
DNA fragments of
pGM1, pGM6, and pGM9 were subcloned into pBluescriptIISK and sequenced
from both ends, using universal primers, and internally, by primer
walking on both strands, by using dye terminator chemistry, cycle
sequencing, and an ABI Prism 377 sequencer (Applied Biosystems).
Sequence assembly and analysis was performed by using Lasergene
(DNAStar, Inc.), Gapped BLAST, and PSI BLAST (1).
Mapping transcriptions starts.
The transcription start
points were mapped in the region from the EcoRI site in
phaP to the HindIII site in ykrM
by primer extension analysis, using the Promega system for primer
extension on RNA templates. DNA oligonucleotide primers, 17 to 20 nucleotides long, were synthesized to match target sequences, initially
at approximately 500-bp intervals and subsequently at about 50 to 250 nucleotides downstream from the predicted transcription start points.
The 32P 5'-end-labeled primers were extended with reverse
transcriptase using total RNA (10 µg per reaction mixture) purified
from B. megaterium (31). The fragment
length, initially, and transcription start nucleotides, subsequently,
were determined by running the cDNA on an 8% denaturing polyacrylamide
gel alongside the products of sequencing reactions, which were
generated with the same 5'-end-labeled primers. The primers used to
identify the transcription start nucleotides for the phaP,
-Q, and -RBC promoters were, respectively, CCCCTTTGTCCATTGTTCCC, CCATGTAGATTCCACCCTC, and CTCCATCTCCTTTCTTGTG.
Microscopy.
For phase-contrast microscopy, wet mounts of
cultures were visualized at a ×1,000 magnification in a light
microscope with phase-contrast attachments (Labophot-2 Microscope,
Nikon, Inc.). To view PHA inclusion bodies, samples were heat fixed,
stained with 1% (wt/vol) Nile blue A (Sigma) for 15 min at 55°C,
destained for 30 s in 8% (vol/vol) acetic acid, water washed, air
dried, and viewed at a ×1,000 magnification under fluorescence using filters (excitation, 446 nm; barrier filter, 590 nm; dichroic mirror,
580 nm). To view green fluorescent protein (GFP), wet mounts of
cultures with or without 1% (wt/vol) agarose were viewed at a ×1,000
magnification under fluorescence using filters (excitation, 390 to 450 nm; barrier filter, 480 to 520 nm; dichroic mirror, 470 nm).
pha gene expression in E. coli and
Pseudomonas.
Triplicate 500-ml cultures, were grown in
2-liter flasks at 30°C, rotating at 250, using 1% inocula of 16-h
cultures, which had been grown in LB, centrifuged, and resuspended in
equal volumes of 0.9% saline. At 48 h samples were removed for
microscopy and cells were harvested, washed once in distilled
H2O, and lyophilized. For PHA extraction, lyophilized cells
were suspended in 10 volumes of 5% (wt/vol) NaOCl, shaken at 65°C
for 1 h, and centrifuged. The pellet was resuspended in 10 volumes
of 5% NaOCl and centrifuged, followed by sequential washing in water
and 95% ethanol. The percentage of PHA is expressed as the weight
vacuum-dried PHA per dry weight of cells.
Nucleotide sequence accession number.
The nucleotide
sequence of the 7,917-bp fragment described in this work is available
in the DDBJ, EMBL, and GenBank nucleotide databases under accession
number AF109909.
 |
RESULTS AND DISCUSSION |
PHA inclusion body-associated proteins.
In an attempt to
determine their relevance, proteins that copurify with PHA
inclusion bodies were separated by electrophoresis on an
SDS-polyacrylamide gel (Fig. 1).
There were at least 13 such proteins present in various quantities.
Some or all of these proteins could be intrinsic structural components
of PHA inclusion bodies, enzymes involved with PHA metabolism, or
possibly scaffolding components involved in inclusion body assembly.
Alternatively, they could have been acquired by the inclusion bodies
during the purification procedure. The three most abundant
proteins had molecular masses of approximately 14, 20, and 41 kDa. The
N-terminal amino acid sequence of the 14-kDa protein
was KVFGRXELAAAMKRXGL, that of the 20-kDa
protein was NTVKYXTVIXAMXXQ, and that of the 41-kDa protein was AIPYVQEXEKL. A BLASTp search revealed that the 14-kDa protein was lysozyme and the other two N-terminal sequences were unknown. It was concluded that the presence of lysozyme resulted from
its use in cell lysis during the inclusion body purification procedure.
This result confirms that not necessarily all of the proteins that
copurify with PHA inclusion bodies are associated with them in
vivo, as was also shown for Chromatium vinosum
(27).

View larger version (60K):
[in this window]
[in a new window]
|
FIG. 1.
PHA inclusion body-associated proteins. Shown are the
results of SDS-polyacrylamide gel electrophoresis of proteins released
from purified PHA inclusion bodies. The bands were visualized by
staining with Coomassie blue. Lane 1, molecular mass markers (14, 18, 29, 43, 68, and 97 kDa); lane 2, proteins from inclusion bodies of
cells harvested in late exponential growth phase; lane 3, same as lane
2 except this part of the gel was stained following 45 min transfer of
proteins (seen in lane 2) to PVDF membrane.
|
|
The 20- and 41-kDa proteins were the two most abundant proteins on the
surface of purified PHA inclusion bodies. For the purpose
of
determining their relevance, if any, to PHA accumulation, their
N-terminal amino acid sequences were used to design degenerative
oligonucleotide probes for use in cloning their DNA coding regions.
Both probes, used in separate hybridization experiments,
identified
a 6.4-kb
HindIII fragment a 5.2-kb
EcoRI fragment, and a 3.7-kb
HindIII-to-
EcoRI DNA fragment of DNA,
indicating that the 5' ends
of the genes coding for both of these
proteins were located less
than 3.7 kb apart in the genome. This 3.7-kb
fragment was cloned,
sequenced, and shown to contain five open reading
frames (ORFs)
(Fig.
2) whose predicted
amino acid sequences code for PhaP (20-kDa
protein), PhaQ, PhaR, PhaB,
and PhaC (41-kDa protein) (an explanation
of this nomenclature is given
below). The 20- and 41-kDa proteins
were identified by their N-terminal
amino acid sequences. Since
the C terminus for each of these two
proteins extended beyond
the boundaries of pGM1, contiguous DNA
sequences from both ends
were cloned.

View larger version (31K):
[in this window]
[in a new window]

View larger version (68K):
[in this window]
[in a new window]
|
FIG. 2.
(A) The pha gene cluster and flanking
sequences. A map of the cloned fragment in pGM10 carrying the
pha genes (striped arrows), intergenic regions (igrs), and
flanking genes (thick black arrows) from B. megaterium
is shown. The thin arrows indicate the locations and directions of
transcripts; P indicates promoter positions. pGM1, pGM6, pGM9, and pGM7
indicate the cloned DNA fragments in these plasmids (Table 1). Probes
used to identify and clone the pha cluster are indicated by
thick short lines under pGM1; n2 and n5 are degenerate probes; bmp and
bmc are probes homologous to the ends of the pGM1 fragment. A ruler of
sequence in base pairs is given for B. megaterium and
B. subtilis. Below this, a map of the yko,
sspD, and ykr region in the B. subtilis genome is shown; genes with homology to those of
B. megaterium in this region are indicated by thick
black arrows; nonhomologous genes are indicated by thick gray arrows.
Gene annotations are given above each gene symbol. Relevant restriction
enzyme sites are shown vertically. (B) Putative promoter regions for
phaRBC, -Q, and -P, and
sspD. Curved arrows indicate the transcription start (+1)
and nucleotides (nt) 10 and 35. The closest resemblance to known
10 and 35 promoter sequences are given in lowercase letters below
putative pha promoter sequences. Immediately downstream from
the PhaP stop codon, the previously described (9)
sspD putative promoter is boxed, and a putative hairpin
structure is underlined. (C) Mapping of the 5' ends of the
phaRBC, -Q, and -P transcripts (see
Materials and Methods). Lanes G, A, T, and C show the dideoxy
sequencing ladders obtained with the same primers used in primer
extension analysis; nucleotide sequences are complementary to the
transcripts. Lane P contains the primer extension product. Lane M
contains a DNA molecular size marker measured in nucleotides. The
primer extension product is indicated by an arrowhead, and the 5' end
of the transcript within the sequence is indicated by a star. Only
regions of the gel containing extension product bands are shown.
|
|
pha locus.
The 7,917-bp region carrying
pha genes from B. megaterium was cloned,
sequenced, and characterized. It was shown to carry eight
complete ORFs and one incomplete ORF (Fig. 2; Table
2). Genes in this region were assigned on
the basis of homology to known sequences, N-terminal amino acid
sequences, putative ribosome binding sites, and operon location. The
complement and arrangement of genes flanking the pha genes
in B. megaterium are very similar to those in a region
of Bacillus subtilis 168 (Fig. 2). This strain is negative
for PHA, and no known pha genes or sequences occur in its
genome, for which the complete sequence is available (24). In place of pha genes in this region of B. subtilis are ykrI, ykrK, and
ykrL, which, respectively, code for putative proteins similar to two unknown proteins and a probable heat shock protein.
pha promoters.
The transcription start nucleotides
in the pha region were determined. Primer extension products
run on 8% denaturing polyacrylamide gels showed a single band from
each reaction mixture, indicating one transcript, while control
reaction mixtures in which RNA was omitted showed no bands. The
extension products run alongside sequencing reaction products obtained
with the same primer (Fig. 2C) identified the 5' ends of the
transcripts, thus allowing the putative promoter sequences at
approximately
10 and
35 bp for phaP, -Q, and
-R to be identified. The arrangement of genes in the
pha cluster of B. megaterium is unique among
those already published, and phaA is notably absent. The
phaP, -Q, -R, -B, and -C genes were shown to be in a 4,104-bp region, with
phaP and -Q transcribed in one orientation, each
from a separate promoter, while phaR, -B, and
-C were divergently transcribed from a promoter in
front of phaR. The putative promoters responsible for
transcription of phaQ and phaR, -B,
and -C show strong similarity to both B. subtilis sigma A type (34) and E. coli sigma
70 type (14) promoters, which can express constitutively.
This is in keeping with previous data for A. eutrophus
showing that phaC is constitutively synthesized, but PHA is
not constitutively accumulated (19). The third putative
promoter in this region, the phaP promoter, resembles a
sigma D type promoter known to control the expression of a regulon of
genes associated with flagellar assembly, chemotaxis, and motility
(13, 20, 46). In B. subtilis sigma D is
expressed in the exponential phase and peaks in late exponential phase
of growth. This parallels the pattern of PHA accumulation previously described for B. megaterium 11561 (32).
However, further experiments are required to test the hypothesis that
PHA accumulation is regulated by sigma D or products of its resulting
transcripts. The phaP gene has 18-bp duplicate sequences
that could base pair to form a rho-independent terminator
close to its translational stop codon (Fig. 2B). The fact that the
35
promoter region of sspD is within this putative hairpin
structure suggests that transcription of phaP and
sspD could be mutually exclusive, thus allowing the
expression of phaP to play a regulatory role in the
expression of sspD (which codes for spore specific storage protein).
pha genes and their products.
The deduced amino
acid sequence of PhaP shows a 20-kDa extremely hydrophilic product with
no obvious similarity to known sequences. Inclusion body- associated
low-molecular-weight proteins (phasins) have been described in many
bacteria (49), but for those for which sequences were
available we found no similarities of identifiable significance with
PhaP of B. megaterium. PhaP does not have an obvious
membrane anchoring domain, nor can it be described as an oleosin-like
protein as was described for that of R. ruber (36). Low-molecular-weight, PHA inclusion body-abundant
proteins obviously play an important role in PHA-producing cells, since they are involved in determining inclusion body size and shape and are
present in quantities up to 5% of total protein in the case of
PHA-producing A. eutrophus (48). It is
interesting that the amino acid sequences of phasin proteins are so
dissimilar, even in closely related bacteria. Some similarity between
such proteins would be expected in closely related bacteria, were they to have a role in inclusion body biogenesis; however, conservation of
sequence would be entirely unnecessary should they have a role as
storage proteins.
The deduced amino acid sequences of PhaQ and PhaR also revealed small
hydrophilic proteins with no significant identifiable
similarity to
known proteins. Figure
1 (lane 2) shows that purified
inclusion bodies
have proteins represented by bands of the approximate
sizes of PhaQ (17 kDa) and -R (23 kDa), but the roles of these
proteins are unknown. They
may be nonorthologous replacements
for the small putative gene
products, whose roles are also unknown,
encoded in known
pha
gene clusters. The deduced amino acid sequence
of PhaB is very similar
in size and amino acid sequence to known
phaB and
fabG gene products (Table
2). The deduced amino acid
sequence of PhaC shows that while it has low homology overall
to known
PhaC proteins, it is most similar to that of
Thiocystis violacea,
Synechocystis sp., and
C. vinosum.
PhaC proteins from
these three bacterial strains, respectively, have
355, 378, and
355 amino acids, while PhaC from
B. megaterium has 362 amino acids.
All other PhaC proteins studied
are larger in size and range from
559 amino acids for that of
Pseudomonas oleovorans (
22) to 636
amino acids
for that of
Rhizobium etli (
3). Alignment studies
of sequences of all known PhaC proteins show that each of the
four
small PhaC proteins is missing approximately 150 amino acids
from the N
terminus and 50 amino acids from the C terminus; this
is demonstrated
for PhaC from
B. megaterium and
P. oleovorans in Fig.
3.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 3.
Pairwise alignment of PhaC from B. megaterium (B.meg.) (this study) and P. oleovorans (P.ole.) (SWISS-PROT accession no. P26494); amino
acid identities are boxed in black. The Clustal method with a PAM250
residue weight table was used.
|
|
Expression of B. megaterium pha genes in E. coli and P. putida.
Functionality of the
B. megaterium putative pha gene cluster was
tested in E. coli, which is naturally PHA negative, and
P. putida GPp104, a PhaC
mutant. Plasmids
carrying one or more of these genes were introduced, and the
resulting transformants were tested for PHA accumulation following growth on LB or M9 medium with various carbon sources and the
appropriate antibiotic for plasmid selection. E. coli carrying pGM7 or pGM10 accumulated low levels of PHA while E. coli carrying pGM1 or pGM6 accumulated no PHA. Fluorescence
microscopy of Nile blue A-stained cells showed that ~1 cell in 20 had
one or a few inclusion bodies and the quantity of PHA produced was ~5% of cell dry weight. Since E. coli does not have PhaA,
a low level of PHA or no PHA is the expected result. However, in
Pseudomonas, in which PhaA is not known to be required,
P. putida GPp104(pGM107) accumulated PHA on rich as
well as minimal medium with various carbon sources to >50% of cell
dry weight, and 90 to 100% of cells appeared full of PHA (Table
3). The positive control P. oleovorans, (equivalent to wild-type P. putida)
accumulated PHA only when grown on longer-chain carbon sources, and not
on LB. No PHA was accumulated by the negative control or by
P. putida carrying phaC alone (pDR1). These
results showed that this B. megaterium gene cluster is
functional in both E. coli and P. putida. PhaC alone was insufficient to complement
PhaC
P. putida or to synthesize PHA in
E. coli. Furthermore, since Pseudomonas cannot
synthesize PHA when grown in LB, these data indicate that PhaB can
function to supply substrate to PhaC in P. putida.
However, these data do not exclude the possibility that PhaP, -Q, or -R
is necessary for PHA accumulation.
Localization of PhaP and PhaC.
Proteins associated with
purified PHA inclusion bodies may not accurately reflect the
localization of these proteins within the growing cell. Visualization
of pha::gfp gene product fusion proteins in living cells throughout culture growth is a useful method
for determining both the localization of the pha gene
products and their comparative levels in growing cells. PhaP and PhaC, as fusion proteins (Fig. 4), localized to
PHA inclusion bodies at all time points tested throughout growth of
B. megaterium 11561. The negative control (pHPS9)
showed no fluorescence at any time point. The localization control
(pGM13C) showed nonlocalized green fluorescence at all time points. The
profiles of PHA accumulation in these two control strains were similar
to that of the wild-type, where the quantity of PHA decreased during
the lag phase, increased during the exponential phase, and continued to
increase at a lower steady-state rate in the stationary phase growth
(32).

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 4.
pha::gfp fusion plasmids
and precursors. Only relevant restriction sites are shown. Annotations
are described in the legend to Fig. 2. In all fusions the C-terminus,
excluding the stop codon, of either phaC or phaP
is fused to the gfp gene by the pGFPuv polylinker. For more
details, see Table 1.
|
|
PhaP, monitored as a PhaP::GFP fusion protein in pGM16.2
(Fig.
5A and B), decreased significantly
during the first half (2
h) of lag phase growth, increased during late
lag phase and early
to mid-exponential phase, decreased in mid- to late
exponential
phase, and increased during stationary phase growth.
The rapid
decrease of PhaP in lag phase is consistent with PhaP
being a
storage protein that is degraded as a source of amino
acids. The
profile of PHA accumulation in these cells (carrying
pGM16.2)
followed a pattern similar to that of PhaP except that PHA
decreased
only in the lag phase and continued to accumulate throughout
other
phases of culture growth. This data is consistent with PHA
inclusion
bodies' being a source of carbon, reducing equivalents and
amino
acids when the organism is first provided with fresh medium.
Possible
explanations as to why the level of PhaP and not PHA decreased
at mid- to late exponential phase are that either PhaP was synthesized
at a lower rate than PHA was or PhaP was used as a source of
amino
acids at this phase of growth, or both scenarios may apply.

View larger version (62K):
[in this window]
[in a new window]
|
FIG. 5.
Localization of PhaP and PhaC. At time zero, cultures of
B. megaterium carrying pGM16.2, pGM13, pGM13C, or
pHPS9, grown in LB with LM25 EM1 for 24 h
at 35°C, were inoculated (5% vol/vol) into 75 ml of fresh medium of
the same composition, in 300-ml Naphelco flasks, and growth was
continued at 27°C with shaking at 250 rpm. Optical densities (O.D.)
of cultures were monitored and samples were removed for microscopy at
time points from time zero to 24 h. One part of each sample was
immediately observed for green fluorescence by embedding in 1%
low-melting-point agarose for viewing by phase-contrast microscopy and
under fluorescence for GFP (magnification, ×870). Another part of each
sample was stained for PHA and viewed by light microscopy and by
fluorescence for PHA inclusion bodies (magnification, ×870). Images
were recorded by using identical parameters for all samples to allow
comparison of fluorescence and light intensities (f-stop, 1/15;
brightness, 0.6; sharpness, 1.0; contrast, 0.8; color, 0.3; see also
Materials and Methods). (A) Time course for B. megaterium (pGM16.2). Time 24/0 was a sample taken at inoculation
(time zero) using a 24-h culture; sampling times were at hours
postinoculation as indicated; phase-contrast (Phase cont.) and GFP
fluorescence images were of the same living cells; light and PHA
fluorescence images were of the same heat-fixed cells. Images of living
cells and heat-fixed cells were taken from the same sample at each
sampling time. (B) Growth curve for cells shown in panel A; arrows
indicate a decrease in PhaP::GFP fluorescence. (C)
B. megaterium (pGM16.2) sampled at 2 days
postinoculation. (D) B. megaterium (pGM13) sampled at 2 days postinoculation, (right and left panels show whole and lysed
cells, respectively). (E) B. megaterium (pGM13C)
sampled at 9 h postinoculation. (F) B. megaterium
(pHPS9) showed no fluorescence at any time point. For panels C through
F, top images are by phase-contrast microscopy and bottom images are by
GFP fluorescence.
|
|
PhaC, monitored as a PhaC::GFP fusion protein in pGM13 (data
not shown), showed a profile of expression similar to that of
PhaP with
one exception: PhaC did not reduce in level during lag
phase growth. It
did, however, reduce in level in mid- to late
exponential phase growth,
as did PhaP. The profile of PHA accumulation
in these cells
carrying PhaC::GFP was similar to that of cells
carrying
PhaP::GFP, except that the PHA level did not reduce during
lag phase growth. It is reasonable to assume that the increased
quantity of PhaC in the cell is a likely explanation since PhaC
remained functional in the fusion protein PhaC::GFP.
This was
indicated by the fact that
E. coli DH5

(pC/GFP3)
and
E. coli DH5

(pGM7)
accumulated PHA to equivalent low
levels, while the host strain
alone, or carrying pGFPuv, accumulated no
PHA, as visualized by
fluorescence microscopy of Nile blue A-stained
cells. The reduction
in level of PhaC in mid- to late exponential
phase, as was also
seen with PhaP, is consistent with both PhaC's and
PhaP's being
synthesized at a lower rate than PHA
is.
In cells of all growth phases, inclusion bodies were rarely visible
under light in stained heat-fixed cells while larger inclusion
bodies
were visible by phase-contrast microscopy of living cells
(Fig.
5C to
F). In older cultures (2 days and older) some cells
were lysed and
showed PhaP::GFP and PhaC::GFP localized to free
PHA inclusion bodies (Fig.
5D). Both free and intracellular inclusion
bodies had doughnut-shaped localization of GFP at some focal
planes
while at other focal planes the same inclusion bodies appeared
completely covered in GFP. We interpret this data as a
difference
in quantity of GFP that is visible when viewed through the
edge
or the center of the inclusion
bodies.
Concluding remarks.
This is the first report of PHA
inclusion body-associated proteins and their coding region in
B. megaterium. The phaP, -Q, -R, -B, and -C genes can be
positioned in the B region of the B. megaterium map due
to linkage to the sspD gene (46), provided that
strains 11561 and QM B1551 have similar genetic maps. PhaP, -Q, and R
are extremely hydrophilic proteins, with no discernible sequence
similarities to known proteins. PhaP localized to PHA inclusion bodies
in living cells. In addition to a possible role in inclusion body
biogenesis, the data are consistent with PhaP's being a storage
protein. PhaB and -C have homology to known PHA proteins. The sequence
of PhaB is more like that of FabG than like other PhaB proteins, and
our data suggest that it can function to provide substrate to the
B. megaterium PhaC in a PhaC
mutant of
P. putida, thus allowing PHA accumulation. PhaC is among the smallest of the known PhaC proteins and localizes to PHA
inclusion bodies in living cells. The significance of PhaC and PhaP
localization in the mechanism of PHA inclusion body biogenesis and
PHA accumulation is being further investigated. The analysis of the
pha locus of B. megaterium not only provides
further comparative data on pha genes and their products but
also allows a comparison of this locus with its counterpart in
B. subtilis.
 |
ACKNOWLEDGMENTS |
We thank Frank Cannon for discussions and critically reading the
manuscript, Tom Redlinger for help with polypeptide separations, and
Tania Fernandez, Doreen Campbell, and Dennis Ryan for excellent technical assistance.
This research was supported in part by a grant from the National
Science Foundation (MCB 97-28066).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biochemistry and Molecular Biology, University of Massachusetts,
Amherst, MA 01003. Phone: (413) 545-0092. Fax: (413) 545-1578. E-mail: mcannon{at}bio.umass.edu.
 |
REFERENCES |
| 1.
|
Altschul, S. F.,
T. L. Madden,
A. A. Schaffer,
J. Zhang,
Z. Zhang,
W. Miller, and D. J. Lipman.
1997.
Gapped BLAST and PSI BLAST: a new generation of protein database search programs.
Nucleic Acids Res.
25:3389-3402[Abstract/Free Full Text].
|
| 2.
|
Anderson, A., and E. A. Dawes.
1990.
Occurrence, metabolism, metabolic role, and industrial uses of bacterial polyhydroxyalkanoates.
Microbiol. Rev.
54:450-472[Abstract/Free Full Text].
|
| 3.
|
Cevallos, M. A.,
S. Encarnacion,
A. Leija,
Y. Mora, and J. Mora.
1996.
Genetic and physiological characterization of a Rhizobium etli mutant strain unable to synthesize poly-beta-hydroxybutyrate.
J. Bacteriol.
178:1646-1654[Abstract/Free Full Text].
|
| 4.
|
Connors, M. J.,
J. M. Mason, and P. Setlow.
1986.
Cloning and nucleotide sequencing of genes for three small, acid-soluble proteins Bacillus subtilis spores.
J. Bacteriol.
166:417-425[Abstract/Free Full Text].
|
| 5.
|
deSmet, M. J.,
G. Eggink,
B. Witholt,
J. Kingma, and H. Wynberg.
1983.
Characterization of intracellular inclusions formed by Pseudomonas oleovorans during growth on octane.
J. Bacteriol.
154:870-878[Abstract/Free Full Text].
|
| 6.
|
Dunlop, W., and A. W. Robards.
1973.
Ultrastructural study of poly- -hydroxybutyrate granules from Bacillus cereus.
J. Bacteriol.
114:1271-1280[Abstract/Free Full Text].
|
| 7.
|
Eggink, G.,
P. de Waard, and G. N. M. Huijberts.
1992.
The role of fatty acid biosynthesis and degradation in the supply of substrates for poly(3-hydroxyalkanoate) formation in P. putida.
FEMS Microbiol. Rev.
103:159-164.
|
| 8.
|
Ellar, D.,
D. G. Lundgren,
K. Okamura, and R. H. Marchessault.
1968.
Morphology of poly- -hydroxybutyrate granules.
J. Mol. Biol.
35:489-502[Medline].
|
| 9.
|
Fliss, E. R.,
A. C. Loshon, and P. Setlow.
1986.
Genes for Bacillus megaterium small, acid-soluble spore proteins: Cloning and nucleotide sequence of three additional genes from this multigene family.
J. Bacteriol.
165:467-473[Abstract/Free Full Text].
|
| 10.
|
Fliss, E. R., and P. Setlow.
1984.
Bacillus megaterium spore protein C-3: nucleotide sequence of its gene and the amino acid sequence at its spore cleavage site.
Gene
30:167-172[Medline].
|
| 11.
|
Fuller, R. C.,
J. P. O'Donnell,
J. Saulnier,
T. E. Redlinger,
J. Foster, and R. W. Lenz.
1992.
The supramolecular architecture of the polyhydroxyalkanoate inclusions in Pseudomonas oleovorans.
FEMS Microbiol. Rev.
103:279-288.
|
| 12.
|
Gerngross, T. U.,
P. Reilly,
J. Stubbe,
A. J. Sinskey, and O. P. Peoples.
1993.
Immunocytochemical analysis of poly- -hydroxybutyrate (PHB) synthase enzyme at the surface of PHB granules.
J. Bacteriol.
175:5289-5293[Abstract/Free Full Text].
|
| 13.
|
Gilman, M. Z.,
J. L. Wings, and M. J. Chamberlin.
1981.
Nucleotide sequence of two Bacillus subtilis promoters used by Bacillus subtilis sigma-28 RNA polymerase.
Nucleic Acids Res.
9:5991-6000[Abstract/Free Full Text].
|
| 14.
|
Gitt, M. A.,
L. F. Wang, and R. H. Doi.
1985.
A strong sequence homology exists between RNA polymerase sigma factors of Bacillus subtilis and Escherichia coli.
J. Biol. Chem.
260:7178-7185[Abstract/Free Full Text].
|
| 15.
|
Griebel, R.,
Z. Smith, and M. Merrick.
1968.
Metabolism of poly- -hydroxybutyrate. 1. Purification, composition, and properties of native poly- -hydroxyburyrate granules from Bacillus megaterium.
Biochemistry
7:3676-3681[Medline].
|
| 16.
|
Haima, P.,
D. van Sinderen,
H. Scholting,
S. Bron, and G. Venema.
1990.
Development of -galactosidase -complementation system for molecular cloning in Bacillus subtilis.
Gene
86:63-69[Medline].
|
| 17.
|
Haywood, G. W.,
A. J. Anderson,
L. Chu, and E. A. Dawes.
1988.
The role of NADH- and NADPH-linked acetoacetyl-CoA reductases in the poly-3-hydroxybutyrate synthesizing organism Alcaligenes eutrophus.
FEMS Microbiol. Lett.
52:259-264.
|
| 18.
|
Haywood, G. W.,
A. J. Anderson,
L. Chu, and E. A. Dawes.
1988.
Characterization of two 3-ketothiolases in the polyhydroxyalkanoate synthesizing organism Alcaligenes eutrophus.
FEMS Microbiol. Lett.
52:91-96.
|
| 19.
|
Haywood, G. W.,
A. J. Anderson, and E. A. Dawes.
1989.
The importance of PHB-synthase substrate specificity in polyhydroxyalkanoate synthesis by Alcaligenes eutrophus.
FEMS Microbiol. Lett.
57:1-6.
|
| 20.
|
Helmann, J. D.
1991.
Alternative sigma factors and the regulation of flagellar gene expression.
Mol. Microbiol.
5:2875-2882[Medline].
|
| 21.
|
Huang, A. H. C.
1992.
Oil bodies and oleosins in seeds.
Annu. Rev. Plant Physiol. Plant Mol. Biol.
43:177-200.
|
| 22.
|
Huisman, G. W.,
E. Wonink,
R. Meima,
B. Kazemier,
P. Terpstra, and B. Witholt.
1991.
Metabolism of poly(3-hydroxyalkanoates) (PHAs) by Pseudomonas oleovorans.
J. Biol. Chem.
266:2191-2198[Abstract/Free Full Text].
|
| 23.
|
Kaneko, T., et al.
1996.
Sequence analysis of the genome of the unicellular cyanobacterium Synechocystis sp. strain PCC6803. II. Sequence determination of the entire genome and assignment of potential protein-coding regions.
DNA Res.
3:109-136[Abstract].
|
| 24.
|
Kunst, N., et al.
1997.
The complete genome sequence of the Gram-positive bacterium Bacillus subtilis.
Nature
390:249-256[Medline].
|
| 25.
|
Lauzier, C.,
R. H. Marchessault,
P. Smith, and H. Chanzy.
1992.
Structural study of isolated poly( -hydroxybutyrate) granules.
Polymer
33:823-827.
|
| 26.
|
Lee, S. Y.
1995.
Bacterial polyhydroxyalkanoates.
Biotechnol. Eng.
49:1-14.
|
| 27.
|
Liebergesell, M.,
B. Schmidt, and A. Steinbüchel.
1992.
Isolation and identification of granule-associated proteins relevant for poly(hydroxyalkanoic acid) biosynthesis in Chromatium vinosum D.
FEMS Microbiol. Lett.
99:227-232.
|
| 28.
|
Liebergesell, M., and A. Steinbüchel.
1992.
Cloning and nucleotide sequences of genes relevant for biosynthesis of poly(3-hydroxybutyric acid) in Chromatium vinosum strain D.
Eur. J. Biochem.
209:135-150[Medline].
|
| 29.
|
Liebergesell, M., and A. Steinbüchel.
1993.
Cloning and molecular analysis of the poly (3-hydroxybutyric acid) biosynthetic genes of Thiocystis violacea.
Appl. Microbiol. Biotechnol.
38:493-501[Medline].
|
| 30.
|
Lundgren, D. G.,
R. M. Pfister, and J. M. Merrick.
1964.
Structure of poly- -hydroxybutyric acid granules.
J. Gen. Microbiol.
34:441-446[Abstract/Free Full Text].
|
| 31.
|
Magni, C.,
P. Marini, and D. de Mendoza.
1995.
Extraction of RNA from gram-positive bacteria.
BioTechniques
19:882-884.
|
| 32.
|
McCool, G. J.,
T. Fernandez,
N. Li, and M. C. Cannon.
1996.
Polyhydroxyalkanoate inclusion-body growth and proliferation in Bacillus megaterium.
FEMS Microbiol. Lett.
137:41-48.
|
| 33.
|
Miller, J. H.
1972.
Experiments in molecular genetics.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 34.
|
Moran, C. P., Jr.,
N. Lang,
S. F. J. LeGrice,
G. Lee,
M. Stephens,
A. L. Sonenshein,
J. Pero, and R. Losick.
1982.
Nucleotide sequences that signal the initiation of transcription and translation in Bacillus subtilis.
Mol. Gen. Genet.
186:339-346[Medline].
|
| 35.
|
Morbidoni, H. R.,
D. de Mendoza, and J. E. Cronan.
1996.
Bacillus subtilis acyl carrier protein is encoded in a cluster of lipid biosynthesis genes.
J. Bacteriol.
178:4794-4800[Abstract/Free Full Text].
|
| 36.
|
Pieper-Fürst, U.,
M. H. Madkour,
F. Mayer, and A. Steinbüchel.
1994.
Purification and characterization of a 14-kilodalton protein that is bound to the surface of polyhydroxyalkanoic acid granules in Rhodococcus ruber.
J. Bacteriol.
176:4328-4337[Abstract/Free Full Text].
|
| 37.
|
Pieper-Fürst, U.,
M. H. Madkour,
F. Mayer, and A. Steinbüchel.
1995.
Identification of the region of a 14-kilodalton protein of Rhodococcus ruber that is responsible for the binding of this phasin to polyhydroxyalkanoic acid granules.
J. Bacteriol.
177:2513-2523[Abstract/Free Full Text].
|
| 38.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 39.
|
Shark, K. B.,
F. D. Smith,
P. R. Harpending, and J. L. Rasmussen.
1991.
Biolistic transformation of a procaryote, Bacillus megaterium.
Appl. Environ. Microbiol.
57:480-485[Abstract/Free Full Text].
|
| 40.
|
Simon, R.,
U. Priefer, and A. Puhler.
1983.
In
A. Puhler (ed.), Molecular genetics of the bacteria-plant interaction, p. 98-106.
Springer, Berlin, Germany.
|
| 41.
|
Steinbüchel, A.
1991.
Polyhydroxyalkanoic acids, p. 123-213.
In
D. Byrom (ed.), Biomaterials, novel materials from biological sources. Macmillan Publishers Ltd., Basingstoke, England.
|
| 42.
|
Steinbüchel, A.,
K. Aerts,
W. Babel,
C. Follner,
M. Liebergesell,
M. H. Madkour,
F. Mayer,
U. Pieper-Furst,
A. Pries,
H. E. Valentin, and R. Wieczorek.
1995.
Considerations on the structure and biochemistry of bacterial polyhydroxyalkanoic acid inclusions.
Can. J. Microbiol.
41:94-105.
|
| 43.
|
Steinbüchel, A.,
E. Hustede,
M. Liebergesell,
U. Pieper,
A. Timm, and H. Valentin.
1992.
Molecular basis for biosynthesis and accumulation of polyhydroxyalkanoic acids in bacteria.
FEMS Microbiol. Rev.
103:217-230.
|
| 44.
|
Steinbüchel, A., and H. G. Schlegel.
1991.
Physiology and molecular genetics of poly( -hydroxyalkanoic acid) synthesis in Alcaligenes eutrophus.
Mol. Microbiol.
5:535-542[Medline].
|
| 45.
|
Steinbuchel, A., and H. E. Valentin.
1995.
Diversity of bacterial polyhydroxyalkanoic acids.
FEMS Microbiol. Lett.
128:219-228.
|
| 46.
|
Vary, P.
1993.
The genetic map of Bacillus megaterium, p. 475-481.
In
A. L. Sonenshein, J. A. Hoch, and R. Losick (ed.), Bacillus subtilis and other gram-positive bacteria: biochemistry, physiology, and molecular genetics. American Society for Microbiology, Washington, D.C.
|
| 47.
|
Wang, W. S., and D. G. Lundgren.
1969.
Poly- -hydroxybutyrate in the chemolithotrophic bacterium Ferrobacillus ferrooxidans.
J. Bacteriol.
97:947-950[Free Full Text].
|
| 48.
|
Wieczorek, R.,
A. Pries,
A. Steinbüchel, and F. Mayer.
1995.
Analysis of a 24-kilodalton protein associated with the polyhydroxyalkanoic acid granules in Alcaligenes eutrophus.
J. Bacteriol.
177:2425-2435[Abstract/Free Full Text].
|
| 49.
|
Wieczorek, R.,
A. Steinbüchel, and B. Schmidt.
1996.
Occurrence of polyhydroxyalkanoic acid granule-associated proteins related to the Alcaligenes eutrophus H16 GA24 protein in other bacteria.
FEMS Microbiol. Lett.
135:23-30[Medline].
|
Journal of Bacteriology, January 1999, p. 585-592, Vol. 181, No. 2
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Han, J., Lu, Q., Zhou, L., Liu, H., Xiang, H.
(2009). Identification of the Polyhydroxyalkanoate (PHA)-Specific Acetoacetyl Coenzyme A Reductase among Multiple FabG Paralogs in Haloarcula hispanica and Reconstruction of the PHA Biosynthetic Pathway in Haloferax volcanii. Appl. Environ. Microbiol.
75: 6168-6175
[Abstract]
[Full Text]
-
Jahns, A. C., Rehm, B. H. A.
(2009). Tolerance of the Ralstonia eutropha Class I Polyhydroxyalkanoate Synthase for Translational Fusions to Its C Terminus Reveals a New Mode of Functional Display. Appl. Environ. Microbiol.
75: 5461-5466
[Abstract]
[Full Text]
-
Chen, H.-J., Pan, S.-C., Shaw, G.-C.
(2009). Identification and Characterization of a Novel Intracellular Poly(3-Hydroxybutyrate) Depolymerase from Bacillus megaterium. Appl. Environ. Microbiol.
75: 5290-5299
[Abstract]
[Full Text]
-
Jendrossek, D.
(2009). Polyhydroxyalkanoate Granules Are Complex Subcellular Organelles (Carbonosomes). J. Bacteriol.
191: 3195-3202
[Full Text]
-
Yamada, M., Yamashita, K., Wakuda, A., Ichimura, K., Maehara, A., Maeda, M., Taguchi, S.
(2007). Autoregulator Protein PhaR for Biosynthesis of Polyhydroxybutyrate [P(3HB)] Possibly Has Two Separate Domains That Bind to the Target DNA and P(3HB): Functional Mapping of Amino Acid Residues Responsible for DNA Binding. J. Bacteriol.
189: 1118-1127
[Abstract]
[Full Text]
-
Tseng, C.-L., Chen, H.-J., Shaw, G.-C.
(2006). Identification and Characterization of the Bacillus thuringiensis phaZ Gene, Encoding New Intracellular Poly-3-Hydroxybutyrate Depolymerase. J. Bacteriol.
188: 7592-7599
[Abstract]
[Full Text]
-
Schultheiss, D., Handrick, R., Jendrossek, D., Hanzlik, M., Schuler, D.
(2005). The Presumptive Magnetosome Protein Mms16 Is a Poly(3-Hydroxybutyrate) Granule-Bound Protein (Phasin) in Magnetospirillum gryphiswaldense. J. Bacteriol.
187: 2416-2425
[Abstract]
[Full Text]
-
Hai, T., Lange, D., Rabus, R., Steinbuchel, A.
(2004). Polyhydroxyalkanoate (PHA) Accumulation in Sulfate-Reducing Bacteria and Identification of a Class III PHA Synthase (PhaEC) in Desulfococcus multivorans. Appl. Environ. Microbiol.
70: 4440-4448
[Abstract]
[Full Text]
-
Moldes, C., Garcia, P., Garcia, J. L., Prieto, M. A.
(2004). In Vivo Immobilization of Fusion Proteins on Bioplastics by the Novel Tag BioF. Appl. Environ. Microbiol.
70: 3205-3212
[Abstract]
[Full Text]
-
Lee, T.-R., Lin, J.-S., Wang, S.-S., Shaw, G.-C.
(2004). PhaQ, a New Class of Poly-{beta}-Hydroxybutyrate (PHB)-Responsive Repressor, Regulates phaQ and phaP (Phasin) Expression in Bacillus megaterium through Interaction with PHB. J. Bacteriol.
186: 3015-3021
[Abstract]
[Full Text]
-
Grunberg, K., Muller, E.-C., Otto, A., Reszka, R., Linder, D., Kube, M., Reinhardt, R., Schuler, D.
(2004). Biochemical and Proteomic Analysis of the Magnetosome Membrane in Magnetospirillum gryphiswaldense. Appl. Environ. Microbiol.
70: 1040-1050
[Abstract]
[Full Text]
-
Makinoshima, H., Aizawa, S.-I., Hayashi, H., Miki, T., Nishimura, A., Ishihama, A.
(2003). Growth Phase-Coupled Alterations in Cell Structure and Function of Escherichia coli. J. Bacteriol.
185: 1338-1345
[Abstract]
[Full Text]
-
York, G. M., Stubbe, J., Sinskey, A. J.
(2002). The Ralstonia eutropha PhaR Protein Couples Synthesis of the PhaP Phasin to the Presence of Polyhydroxybutyrate in Cells and Promotes Polyhydroxybutyrate Production. J. Bacteriol.
184: 59-66
[Abstract]
[Full Text]
-
Hai, T., Hein, S., Steinbuchel, A.
(2001). Multiple evidence for widespread and general occurrence of type-III PHA synthases in cyanobacteria and molecular characterization of the PHA synthases from two thermophilic cyanobacteria: Chlorogloeopsis fritschii PCC 6912 and Synechococcus sp. strain MA19. Microbiology
147: 3047-3060
[Abstract]
[Full Text]
-
York, G. M., Junker, B. H., Stubbe, J., Sinskey, A. J.
(2001). Accumulation of the PhaP Phasin of Ralstonia eutropha Is Dependent on Production of Polyhydroxybutyrate in Cells. J. Bacteriol.
183: 4217-4226
[Abstract]
[Full Text]
-
McCool, G. J., Cannon, M. C.
(2001). PhaC and PhaR Are Required for Polyhydroxyalkanoic Acid Synthase Activity in Bacillus megaterium. J. Bacteriol.
183: 4235-4243
[Abstract]
[Full Text]
-
York, G. M., Stubbe, J., Sinskey, A. J.
(2001). New Insight into the Role of the PhaP Phasin of Ralstonia eutropha in Promoting Synthesis of Polyhydroxybutyrate. J. Bacteriol.
183: 2394-2397
[Abstract]
[Full Text]