Previous Article | Next Article 
Journal of Bacteriology, January 1999, p. 632-641, Vol. 181, No. 2
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Phosphorylation and Functional Properties of the IIA Domain of
the Lactose Transport Protein of Streptococcus
thermophilus
Marga G. W.
Gunnewijk,1
Pieter W.
Postma,2 and
Bert
Poolman1,*
Department of Microbiology, Groningen
Biomolecular Sciences and Biotechnology Institute, University of
Groningen, 9751 NN Haren,1 and
E.
C. Slater Institute, BioCentrum, University of Amsterdam, 1018 TV
Amsterdam,2 The Netherlands
Received 25 August 1998/Accepted 9 November 1998
 |
ABSTRACT |
The lactose-H+ symport protein (LacS) of
Streptococcus thermophilus has a carboxyl-terminal
regulatory domain (IIALacS) that is homologous to a family
of proteins and protein domains of the phosphoenolpyruvate:carbohydrate
phosphotransferase system (PTS) in various organisms, of which
IIAGlc of Escherichia coli is the
best-characterized member. On the basis of these similarities, it was
anticipated that IIALacS would be able to perform one or
more functions associated with IIAGlc, i.e., carry out
phosphoryl transfer and/or affect other catabolic functions. The gene
fragment encoding IIALacS was overexpressed in
Escherichia coli, and the protein was purified in two steps
by metal affinity and anion-exchange chromatography. IIALacS was unable to restore glucose uptake in a
IIAGlc-deficient strain, which is consistent with a very
low rate of phosphorylation of IIALacS by phosphorylated
HPr (HPr~P) from E. coli. With HPr~P from S. thermophilus, the rate was more than 10-fold higher, but the rate constants for the phosphorylation of IIALacS
(k1 = 4.3 × 102
M
1 s
1) and dephosphorylation of
IIALacS~P by HPr (k
1 = 1.1 × 103 M
1 s
1) are still at
least 4 orders of magnitude lower than for the phosphoryltransfer
between IIAGlc and HPr from E. coli. This
finding suggests that IIALacS has evolved into a protein
domain whose main function is not to transfer phosphoryl groups
rapidly. On the basis of sequence alignment of IIA proteins with and
without putative phosphoryl transfer functions and the known structure
of IIAGlc, we constructed a double mutant
[IIALacS(I548E/G556D)] that was predicted to have
increased phosphoryl transfer activity. Indeed, the phosphorylation
rate of IIALacS(I548E/G556D) by HPr~P increased
(k1 = 4.0 × 103
M
1 s
1) and became nearly independent of the
source of HPr~P (S. thermophilus, Bacillus
subtilis, or E. coli). The increased phosphoryl
transfer rate of IIALacS(I548E/G556D) was insufficient to
complement IIAGlc in PTS-mediated glucose transport in
E. coli. Both IIALacS and
IIALacS(I548E/G556D) could replace IIAGlc, but
in another function: they inhibited glycerol kinase (inducer exclusion)
when present in the unphosphorylated form.
 |
INTRODUCTION |
The phosphoenolpyruvate
(PEP):carbohydrate phosphotransferase system (PTS) catalyzes the uptake
of carbohydrate concomitant with its phosphorylation. The phosphoryl
group is transferred from PEP via the general energy-coupling proteins
enzyme I and HPr to the sugar-specific phosphoryl transfer
protein/domain IIA; phosphorylated IIA (IIA~P) transfers the
phosphoryl group to the sugar-specific IIB protein domain which
phosphorylates the sugar that is translocated via the sugar-specific
IIC protein domain (23). Apart from its function in the
uptake and phosphorylation of sugars, the PTS regulates transport and
subsequent metabolism of non-PTS carbohydrates. In gram-negative
enteric bacteria, this regulation is mediated by the phosphorylation
state of the Glc-specific IIA (IIAGlc), which is determined
by the relative rates of phosphorylation by HPr~P and
dephosphorylation by IICBGlc. For instance,
IIAGlc~P is involved in the stimulation of adenylate
cyclase, whereby the expression of many catabolic enzymes is regulated
through changes in cyclic AMP (cAMP) levels (1).
Unphosphorylated IIAGlc, on the other hand, binds directly
to several transporters and enzymes of carbohydrate metabolism, and thereby inhibits their activities, via a phenomenon called inducer exclusion (23). The interaction of IIAGlc with
one of its targets, glycerol kinase (GlpK), has been elucidated by
analyzing the crystal structure of Escherichia coli glycerol kinase in complex with E. coli IIAGlc
(7). This study revealed that IIAGlc binds to
glycerol kinase at a region that is distant from the catalytic site of
glycerol kinase, which suggests that long-range conformational changes
mediate the inhibition of glycerol kinase by IIAGlc.
In gram-positive bacteria, not only can HPr be phosphorylated by
PEP/enzyme I on a histidine residue (His-15), but also a metabolite-activated ATP-dependent protein kinase can phosphorylate a
serine residue at position 46 (2). The serine-phosphorylated form of HPr [HPr(Ser-P)] seems to control carbohydrate metabolism both at the protein level and at the gene level, i.e., transport activities (inducer exclusion of both PTS and non-PTS sugars and/or inducer expulsion) and transcription (28).
There is no evidence for the involvement of IIAGlc or
IIA-like proteins in PTS-mediated regulation in gram-positive bacteria. However, several non-PTS sugar transporters have a carboxyl-terminal domain that is homologous to IIAGlc of E. coli
(18, 20). The best-characterized system of this family of
transporters with a two-domain structure is the lactose transport
protein (LacS) of Streptococcus thermophilus. This protein is, among others, also homologous to the melibiose transport proteins of Salmonella typhimurium and E. coli, which lack
a IIA-like domain but are regulated by IIAGlc (18,
41). The carboxyl-terminal IIA domain of the LacS protein of
S. thermophilus (IIALacS) is located in the
cytoplasm and has 34% residue identity with IIAGlc of
E. coli (20). IIALacS is
phosphorylated, most likely at His-552, by HPr~P, which inhibits the
transport activity of LacS (17, 19). This histidine residue corresponds with His-90 of IIAGlc in E. coli,
which has been shown to be the phosphoryl-accepting site (4,
24) (Fig. 1). The phosphorylation of LacS by HPr~P has been
assessed only qualitatively, and it is not known whether the
IIALacS domain has phosphoryl transfer activity equivalent
to that of IIAGlc.
In this study, we investigated (i) the kinetics of (de)phosphorylation
of the IIALacS domain of S. thermophilus and
(ii) the ability of the protein to carry out phosphoryl transfer to
IICBGlc of E. coli (PTS-mediated glucose
transport) and to inhibit glycerol kinase. Information about the
(de)phosphorylation kinetics is relevant because the only known
function of the IIA domain in LacS, and homologous transporters,
involves the regulation of lactose-H+ symport activity, for
which a very rapid phosphoryl transfer may not be critical. For this
study, we expressed IIALacS in E. coli and
S. typhimurium and constructed two mutants in which either
the proposed phosphoryl-accepting histidine was replaced by Arg
[IIALacS(H552R)] or two residues near the putative
phosphorylation site were replaced by the equivalent residues conserved
in all PTS members of the IIAGlc family
[IIALacS(I548E/G556D)] (Fig.
1). The crystal structures of
IIAGlc from E. coli and B. subtilis
show that the Glu residue is exposed to the surface of the molecule and
may be critical for the interaction of IIA with its partner molecules;
the Asp residue is close to the active site in the tertiary structure
(12, 40). For the in vitro phosphorylation assays, we
purified each of the mutant proteins and assessed phosphorylation by
HPr~P from E. coli, B. subtilis, and S. thermophilus.

View larger version (48K):
[in this window]
[in a new window]
|
FIG. 1.
Alignment of the active site regions of PTS IIA and
non-PTS IIA protein domains. *, conserved residue; :, similar
residue; s, salt bridge with residue in glycerol kinase; h,
hydrophobic interaction with glycerol kinase; z, coordination of Zn(II)
(7); @, charged group near phosphorylation site. Only a
portion of each PTS IIA protein domain in the SwissProt database is
shown. Two-letter suffixes denote S. thermophilus (St),
Pseudomonas aeruginosa (Pa), Lactobacillus
bulgaricus (Lb), Leuconastoc lactis, (Ll),
S. typhimurium (Sty), E. coli (Ec), B. subtilis (Bs), Klebsiella pneumoniae (Kp),
Brevibacterium lactofermentum (Bl), and
Corynebacterium glutamicum (Cg).
|
|
 |
MATERIALS AND METHODS |
Bacterial strains and growth conditions.
The strains used
were E. coli DH5
[deoR endA1 gyrA961 hsdR17
(rK
mK+) recA
rel-1 supE44 thi-1
(lacZYA-arg-169)
Ø80
lacZ
] (8), BL21 [hsdS
gal(
cIts857) ind-1 sam-7 nin-5
lacUV5-T7 gene1] (32), LM1 [crr-1 thi-1 his-1
argG6 metB galT rpsL ptsM manI nagE] (11), and MC1061
[
(lacIPOZYA) F
araD139
(ara-leu)7697 galU galK
rK+ mK
strA] (8) and S. typhimurium PP2178
[crr-307::Tn10 nagE142 trpB223]
(36). To isolate plasmid DNA, the cells were grown in Luria
broth under vigorous aeration at 37°C (29). For the transport assays, the cells were grown in minimal salts medium A
(31) with glycerol (0.2% [wt/vol]) as carbon and energy
source as described by van der Vlag et al. (37). For
large-scale protein purification, the cells were grown in Luria broth
in a 10-liter fermentor (Bio Bench ADI 1065; Applicon, Inc.) with
oxygen supply (50% saturation) and pH control (pH 7.0). Growth on
succinate was performed on agar plates containing minimal salts medium
A supplemented with succinate (0.5%) and the essential nutrients as
indicated by the autotrophic markers. When necessary, carbenicillin (50 µg/ml), chloramphenicol (10 µg/ml), tetracycline (12.5 µg/ml), or
isopropyl-
-D-thiogalactopyranoside (1 mM) was added to
the medium.
S. thermophilus ST11 (
lacS)/pGKHis was grown
semianaerobically at 42°C in Belliker broth supplemented with 0.5%
beef extract, 20 mM lactose, and 5 mg of erythromycin per ml
(9).
DNA manipulations.
DNA modifications were performed as
described by Sambrook et al. (29) unless indicated
otherwise. Subcloning of plasmids into E. coli strains was
performed via E. coli DH5
. Plasmids used for the
expression of proteins in E. coli and S. typhimurium are listed in Table 1.
Since alignments of IIA
LacS with other IIA proteins do not
clearly reveal an optimal translation initiation site, several gene
fragments specifying IIA
LacS were cloned. ATG initiation
codons were engineered at positions
1359, 1383, and 1440 of the
lacS gene, using the forward primers
ARH
(5'AGGAGGTGTCAACATGGCACGTCACGCTAAAATTGT), ELE
(5'AGGAGGTGTCAACATGGAATTGGAACATCGCTTTAG),
and VSL
(5'AGGAGGTGTCAACATGGTATCTCTTGTAACCCCTAC), respectively;
the
corresponding protein domains are 181, 173, and 154 amino
acids long.
For the PCRs, use of the reverse primer BR
(5'CAAAATACTTAGGATCCGAGTGAGCATC)
generated a new
BamHI site 82 bp downstream of the stop codon
of the
lacS gene. For the PCRs with pSKE8e as the template DNA,
the
oligonucleotide primers were treated with T4 polynucleotide
kinase
before use. PCR fragments were isolated with QIA quick
spin columns
(Qiagen, Inc.) and then blunt-end ligated into pSKII

that
had been digested with
SmaI and dephosphorylated by Klenow
enzyme. In the resulting plasmids pSK181, pSK173, and pSK154,
the gene
fragments encoding IIA
LacS are under the control of the T7
promoter. For the expression
of IIA
LacS from the
tac promoter, plasmid pKKELE was constructed by ligating
the
PCR ELE/BR fragment into pKK223-3 that had been linearized
with
SmaI and treated with Klenow
enzyme.
For the expression of IIA
LacS from the
lacS
promoter and its native ribosome binding site and to generate a
six-histidine tag
at the C terminus of IIA
LacS, the
NcoI/
BamHI fragment of pSKE8N was replaced by the
NE/BR
PCR fragment that had been treated with
NcoI and
BamHI. The NE/BR
PCR fragment was synthesized by using the
oligonucleotide primer
NE (5'GTCACCATGGAATTGGAACATCGC) as
the forward primer, which introduced
a new
NcoI restriction
site at the ATG initiation codon of IIA
LacS, BR as the
reverse primer, and pSKE8his as the template DNA.
IIA
LacS
with mutations H552R and I548E/G556D was constructed by using
pSKE8(
lacS-H552R) and pSKE8(
lacS-I548E/G556D),
respectively, as
template DNAs for the PCRs. NE and LBR (5'
CGCGGATCCTTTTTTGAAGGTAAT)
were used as forward and reverse
primers, respectively; LBR created
a
BamHI restriction site
1 bp upstream of the stop codon of the
lacS gene. After
isolation of the PCR fragments and digestion
with
NcoI and
BamHI, the fragments were ligated into vector pSKoppAChis
that had been treated with the corresponding enzymes. In this
way, the
gene fragments specifying mutant IIA
LacS were put under
control of the
lacS promoter, and the corresponding
proteins
had a six-histidine tag at the carboxyl terminus. All
plasmids
constructed were checked by restriction analysis and
nucleotide
sequencing using the Vistra automated laser fluorescent
DNA sequencer
system with the labeled primer cycle sequencing
kit (Amersham, Inc.).
Nomenclature.
IIALacS refers to the IIA domain
of LacS in general, whereas constructs representing protein fragments
of specific lengths are indicated by numbers between brackets (e.g.,
IIALacS[181] denotes a domain of 181 residues). The
His-tagged IIALacS[173] protein, which was used in most
of the experiments, is referred to as IIALacS-6H; when
appropriate, mutations are indicated between parentheses [e.g.,
IIALacS-6H(H552R) and
IIALacS-6H(I548E/G556D)]. Ile-548, His-552, and Gly-556
denote residue positions in LacS; the same numbering is used to
indicate these positions in IIALacS.
Protein purification.
All purification procedures were
carried out at 4°C unless indicated otherwise. Enzyme I and HPr of
B. subtilis and E. coli were purified as
described previously (26, 27, 38)). For the isolation and
purification of HPr from S. thermophilus, the cells were
lysed after lysozyme treatment (6). For the removal of
lysozyme, the supernatant of the cell lysate fraction was diluted 1×
in Milli Q water and incubated with S-Sepharose (10 ml/g of lysozyme)
for 1 h at 4°C. Fresh S-Sepharose was added twice, after removal
of old resin by decanting the supernatant, after which the cell lysate
fraction was incubated for another hour at 4°C. The proteins were
then precipitated by addition of ammonium sulfate to 80% (wt/vol), and
incubation overnight on ice water. After centrifugation (45 min at
70,000 × g), the pellet was dissolved in 20 mM
Tris-HCl (pH 8.5) and loaded on a DEAE-Sepharose fast flow column (1.6 by 40 cm; Pharmacia Biotech Inc.) that had been equilibrated with 20 mM
Tris-HCl (pH 8.5). The column was washed with 10 column volumes of 20 mM Tris-HCl (pH 7.0). Proteins were eluted with 10 column volumes of 20 mM Tris-HCl (pH 7.0)-40 mM NaCl and precipitated by 80% ammonium
sulfate as described above. The pellet was dissolved in 20 mM sodium
acetate (pH 4.0) and desalted on a PD-10 column (Pharmacia Biotech).
The resulting fraction was loaded onto an S-Sepharose fast flow column
(HR 5/5; Pharmacia Biotech) that had been equilibrated with 20 mM
sodium acetate (pH 4.0). The proteins were eluted with a 250-ml
gradient of 0 to 250 mM NaCl in 20 mM sodium acetate (pH 4.0). The
fractions containing HPr were pooled and concentrated by 80% ammonium
sulfate as described above. The pellet was dissolved in 50 mM potassium phosphate (KPi; pH 7.0) to a concentration of 2 mg/ml.
For the isolation and purification of IIA
LacS,
E. coli cells expressing IIA
LacS-6H were grown to late
exponential phase and harvested by centrifugation.
The cells were
washed twice with 50 mM KP
i (pH 8.0) and resuspended
in
buffer A (50 mM KP
i [pH 8.0], 10% [wt/vol] glycerol)
to a final
total protein concentration of 25 mg/ml. After breaking the
cells
with a French pressure cell (20,000 lb/in
2), DNA was
removed by addition of 0.083% polyethyleneimine that
had been
equilibrated with buffer A and incubated for 15 min at
4°C. After
centrifugation for 15 min at 70,000 ×
g, NaCl and
imidazole
were added to the supernatant to final concentrations of 400 and
10 mM, respectively. The sample was mixed and incubated with
Ni-nitrilotriacetic
acid (NTA) resin (~25 mg of protein/ml of resin)
for 1 h at 4°C;
the resin had been equilibrated with buffer A10
(50 mM KP
i [pH
8], 10% [wt/vol] glycerol, 400 mM NaCl,
10 mM imidazole). Next,
the column material was poured into a Bio-Spin
column (Bio-Rad
Laboratories, Inc.) and washed with 10 column volumes
of buffer
A10 plus 10 column volumes of buffer A30 (buffer A10
containing
30 mM imidazole at pH 6.0). The protein was eluted with
buffer
A containing 500 mM imidazole. The fractions eluting from the
column were desalted by using PD-10 columns that had been equilibrated
with 50 mM Tris-HCl (pH 8.0). Eluted fractions were loaded onto
a MonoQ
column (HR 5/5; Pharmacia Biotech) that had been equilibrated
with 50 mM Tris-HCl (pH 8.0). The proteins were eluted by running
a 100-ml
gradient of 0 to 500 mM NaCl in 50 mM Tris-HCl (pH 8.0).
Phosphorylation and dephosphorylation assays.
For the
phosphorylation of IIALacS-6H, 5.8 µM purified
IIALacS-6H was incubated in 50 mM Tris acetate (pH 7.5)
containing 1 mM dithiothreitol (DTT), 2 mM MgCl2, 0.8 mM
purified enzyme I, 10 mM PEP, and HPr at concentrations ranging from 1 to 90 µM. The phosphorylation reactions were carried out at 10°C in
a total volume of 10 µl. The reactions were stopped by addition of 10 µl of 2× sodium dodecyl sulfate (SDS) sample buffer (29),
and the samples were stored on ice. For the dephosphorylation of
IIALacS-6H~P, IIALacS-6H was first
phosphorylated by PEP, enzyme I, and HPr, after which these components
were removed by binding IIALacS-6H~P to the Ni-NTA
resin. Briefly, 70 µl of reaction mixture was mixed with 40 µl of
Ni-NTA that had been equilibrated with 50 mM KPi (pH 7.0).
Following a wash with 2 ml of 50 mM KPi,
IIALacS-6H~P was eluted with 120 µl of 50 mM
KPi (pH 7.0)-500 mM imidazole. For the dephosphorylation
reactions, IIALacS-6H~P (10 mM or as indicated otherwise)
was incubated in 50 mM Tris acetate (pH 7.5)-1 mM DTT-2 mM
MgCl2 and HPr in the range of 1 to 100 µM in a total
volume of 10 ml at 10°C. The reaction was monitored as described
above. The amount of (de)phosphorylated protein was determined by
SDS-polyacrylamide gel electrophoresis (PAGE) analysis (15%
polyacrylamide [10]) and Coomassie brilliant blue
staining (29), and the amounts of IIALacS-6H and
IIALacS-6H~P were determined by densitometry using a
Dextra DF2400T scanner (Dextra Technology, Inc.).
Immunological methods.
Immunodetection of wild-type and
mutant IIALacS was performed with antibodies raised against
a peptide corresponding to the carboxyl-terminal 17 residues of LacS
(17) or antibodies raised against purified IIALacS-6H (this work). Immunodetection of HPr from
S. thermophilus was performed with antibodies raised against
HPr of S. salivarius. The proteins were separated by
SDS-PAGE (15% polyacrylamide gel) and transferred to polyvinylidene
difluoride membranes by semidry electrophoretic blotting. A
Western-light chemiluminescence detection kit (Tropix Inc.) was used to
visualize the proteins.
Miscellaneous.
Uptake of labeled carbohydrates in intact
cells was carried out as described by Postma (21). Protein
quantification was performed by the Dc protein assay
(Bio-Rad), using bovine serum albumin as the standard. N-terminal
sequencing of proteins was performed by Eurosequence, Inc., Groningen,
The Netherlands.
Materials.
D-[U-14C]glucose (293 mCi/mmol) and [U-14C]glycerol (150 mCi/mmol) were
obtained from the Radiochemical Centre, Amersham, United Kingdom. QIA
quick spin columns and Ni-NTA resin were purchased from Qiagen, the
Bio-Spin columns were from Bio-Rad Laboratories, PD-10 and MonoQ
columns (HR 5/5) were from Pharmacia Biotech, 2-deoxy-D-glucose grade II and polyethyleneimine were from
Sigma, and the enzymes needed for DNA manipulations were obtained from Boehringer Mannheim. All other materials were reagent grade and obtained from commercial sources.
 |
RESULTS |
Expression of the IIALacS.
To study the functional
properties of the IIALacS, this portion of the protein was
expressed separately from the carrier domain. Although
IIALacS is homologous to E. coli
IIAGlc and various other IIA proteins, the similarity at
the amino-terminal end is not significant and the start of the linker
region, connecting the carrier and IIA domain of LacS, is not well
defined (20, 33). Therefore, we selected three translation
initiation sites near the linker region such that IIALacS
proteins 181, 173, and 154 amino acids long were obtained (Fig. 2). The individual proteins were tested
for the ability to be phosphorylated by HPr~P, which was determined
by monitoring the migration of the proteins on an SDS-polyacrylamide
gel (4). The IIALacS proteins present in the
cell extracts were detected by immunoblotting using an antibody
directed against the carboxyl terminus of LacS. On an
SDS-polyacrylamide gel, the IIALacS proteins migrated at a
somewhat higher apparent molecular mass than predicted from the deduced
amino acid sequence, which has also been observed for other IIA
proteins (27). For IIALacS[173] and
IIALacS[181], but not for IIALacS[154], a
shift in the migration of the protein upon SDS-PAGE was observed after
phosphorylation, indicating that IIALacS[173] and
IIALacS[181] are phosphorylated by HPr~P. Further
experiments were performed with IIALacS[173], i.e.,
the smallest fragment that could be phosphorylated and having an amino
terminus of the same length as that of IIAGlc.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 2.
Construction of gene fragments specifying
IIALacS. The 4.1-kb EcoRI chromosomal DNA
fragment of pSKE8, containing the lacS gene of S. thermophilus, is shown. Only relevant restriction sites are
indicated. Shown are the lacS promoter (Ps), the
lacS gene (arrow), wild-type protein and portions of the IIA
domain (bars). The putative linker and flanking regions are indicated
by their amino acid sequences. Amino acids that frequently occur in a Q
linker are marked by asterisks, and the residues following the Met
of IIALacS[181], IIALacS[173], and
IIALacS[154] are indicated by the corresponding numbers.
Phosphorylation of the protein was performed in the presence of enzyme
I, HPr, and PEP (for details, see Materials and Methods). The ability
of LacS to become phosphorylated by HPr~P was taken from reference
19.
|
|
To amplify the expression of IIA
LacS[173], we made
several plasmid constructs (Table
1) in which the copy number was
either high
or medium and the promoter was inducible (
tac
and T7) or constitutive
(
lacS). After transformation of the
E. coli hosts (DH5

, MC1061,
and BL21) with the
appropriate plasmids, the highest expression
(2 to 5% of total cell
protein) was obtained from the
lacS promoter
present in
plasmid pSKIIA with
E. coli DH5

as the host (data
not
shown). Immunoblot detection using an antibody directed against
the
carboxyl terminus of LacS demonstrated that the expressed
proteins
corresponded to IIA
LacS (data not shown). To facilitate the
purification of IIA
LacS, we constructed pSKIIAhis, in which
sequences specifying a factor
Xa cleavage site and a six-histidine tag
are present at the 3'
end of the IIA
LacS gene fragment. The
introduction of a carboxyl-terminal His tag
had no effect on the
ability of HPr~P to phosphorylate IIA
LacS (data not
shown). On SDS-PAGE, IIA
LacS-6H migrated somewhat more
slowly than IIA
LacS.
Purification of IIALacS-6H.
For the purification
of IIALacS-6H, E. coli DH5
/PSKIIAhis cells
were grown to late exponential growth phase (Fig.
3, lane 2). After the cells were broken
in a French pressure cell and cell debris/membranes and DNA were
removed (Fig. 3, lane 3), the His-tagged protein could be isolated with
a purity of 90% by nickel chelate affinity chromatography (lane 4).
Further purification was achieved by anion-exchange chromatography
using a MonoQ column (lane 5). The protein was eluted at approximately
150 mM NaCl. From 1 liter of cells grown to an
A660 of 4.5 in a computer-controlled fermentor and under vigorous aeration, 1.6 mg of IIALacS-6H was
obtained. The amino-terminal sequence of the purified protein was
Met-Glu-Leu-Glu-His-Arg, which is identical to the anticipated amino
acid sequence (20); Glu-462 in LacS was replaced by Met to
obtain the initiation codon of the IIA domain. Purification of the
His-tagged IIALacS(H552R) and
IIALacS(I548E/G556D) mutant proteins was performed exactly
as for IIALacS.

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 3.
Purification of IIALacS-6H. Shown is a
Coomassie brilliant blue-stained SDS-15% polyacrylamide gel. Lane 1, protein marker; lane 2, cell extract of E. coli
DH5 /pSKIIAhis (50 µg of protein); lane 3, cytosolic fraction of
E. coli DH5 /pSKIIAhis (50 µg of protein); lane 4, IIALacS-6H after nickel chelate affinity chromatography
(~10 µg of protein); lane 5, IIALacS-6H after nickel
chelate and anion-exchange chromatography (~7 µg of protein).
|
|
Purification of HPr.
HPr from S. thermophilus was
analyzed in column fractions by native PAGE (15% polyacrylamide gel)
and immunodetection using antibodies raised against HPr of S. salivarius. HPr was isolated from cells of S. thermophilus ST11 (
lacS)/pGKhis that were grown to
late exponential phase. After the cells were broken, most of the
lysozyme present in the cell lysate was removed by adsorption to
S-Sepharose. Subsequently, HPr was purified to near homogeneity in two
steps, involving anion-exchange and cation-exchange chromatography. On
an SDS-polyacrylamide gel, HPr migrated at ~13 kDa. This apparent molecular mass of HPr from S. thermophilus is in the same
range as found for HPr purified from other streptococci, 6.7 to 17 kDa, while the molecular mass from the nucleotide sequence is 8.9 kDa (35).
Phosphorylation of IIALacS-6H by PTS-mediated
enzymes.
Phosphorylation of IIALacS-6H was analyzed by
SDS-PAGE. Figure 4A shows the relative
electrophoretic mobilities of purified IIALacS-6H in the
absence (lane 2) and presence of PEP, enzyme I, and HPr of S. thermophilus (lane 4), B. subtilis (lane 6), and
E. coli (lane 8). The phosphorylated form of
IIALacS-6H exhibited a somewhat lower electrophoretic
mobility than the nonphosphorylated protein (compare lanes 2 with lanes
4, 6, and 8). These experiments clearly indicate that the IIA domain of LacS can be phosphorylated via PEP and the general PTS energy-coupling proteins enzyme I and HPr of S. thermophilus as well
as HPr of both E. coli and B. subtilis. Figure 4B
shows the electrophoretic mobilities of the purified mutants
IIALacS-6H(H552R) and
IIALacS-6H(I548E/G556D). The mobility of
IIALacS-6H(H552R) is similar to that of the wild type,
whereas IIALacS-6H(I548E/G556D) exhibited a
significantly lower mobility (lane 5). Upon addition of PEP, enzyme I
of B. subtilis, and HPr of S. thermophilus, the
migration of IIALacS-6H(H552R) was not affected (compare
lanes 1, 2, and 3), whereas IIALacS-6H(I548E/G556D)
migrated more slowly (compare lanes 5 and 7). Similar results were
obtained with PEP, enzyme I, and HPr of E. coli and B. subtilis (data not shown). These results indicate that
IIALacS-6H(I548E/G556D) but not
IIALacS-6H(H552R) is capable of accepting the phosphoryl
group from HPr~P.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 4.
Phosphorylation of IIALacS-6H,
IIALacS-6H(H552R), and IIALacS-6H(I548E/G556D).
The Coomassie brilliant blue-stained SDS-15% polyacrylamide gel
represents samples containing 0.8 µM enzyme I (EI) from B. subtilis, 12.5 µM HPr, 5.8 µM IIALacS-6H, and/or
10 µM PEP, as indicated at the bottom. The phosphorylation reactions
(at 37°C for 15 min) were carried out in 50 mM Tris-acetate (pH
7.5)-1 mM DTT-2 mM MgCl2. (A) IIALacS. (B)
Lanes 1 to 3, IIALacS(H552R); lanes 4 to 6, IIALacS-6H(I548E/G556D). The sources of HPr (S. thermophilus, B. subtilis, and E. coli) are
indicated above the lanes.
|
|
Kinetics of phosphorylation and dephosphorylation of
IIALacS-6H and
IIALacS-6H(I548E/G556D).
The phosphorylation kinetics
of IIALacS-6H by HPr~P from S. thermophilus is
shown in Fig. 5. To determine the
phosphorylation rates more precisely, the experiments were performed at
10°C, which decreased the phosphorylation rate approximately 1 order
of magnitude compared to the level at 37°C. In these experiments, the
concentration of HPr~P was 5- to 50-fold greater than that of
IIALacS-6H, and the kinetics of IIALacS-6H
phosphorylation could be approximated as a first-order process (Fig.
5A). The initial rates of phosphorylation of IIALacS-6H at
different HPr~P concentrations and for HPr of S. thermophilus, E. coli, and B. subtilis are
presented in Fig. 5B. Clearly, IIALacS-6H was
phosphorylated approximately 1 and 2 orders of magnitude faster by
HPr~P from S. thermophilus than by HPr~P from E. coli and B. subtilis, respectively. The derived rate
constants obtained from these data are summarized in Table
2 (first column).

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 5.
Phosphoryl transfer from HPr~P of S. thermophilus, B. subtilis, and E. coli to
IIALacS-6H and IIALacS-6H(I548E/G556D). (A)
Time course of the phosphoryl transfer reaction between 25 µM HPr~P
from S. thermophilus and IIALacS-6H. (B)
Phosphorylation rate of IIALacS-6H by HPr~P from S. thermophilus ( ), B. subtilis, ( ), and E. coli ( ). (C) Phosphorylation rate of
IIALacS-6H(I548E/G556D) by HPr~P from S. thermophilus ( ), B. subtilis ( ), and E. coli ( ). The phosphorylation reaction was started by adding 5.8 µM purified IIALacS-6H or 4.1 µM
IIALacS-6H(I548E/G556D) to 50 mM Tris acetate (pH 7.5)
containing 1 mM DTT, 2 mM MgCl2, 0.8 µM purified enzyme
I, 10 mM PEP, and HPr at concentrations ranging from 0 to 90 µM, in a
total volume of 10 µl at 10°C. The reactions were stopped by
addition of 10 µl of 2× SDS sample buffer.
|
|
View this table:
[in this window]
[in a new window]
|
TABLE 2.
Rate and equilibrium constants for phosphoryl transfer
between HPr of S. thermophilus, B. subtilis, or
E. coli and IIALacS
or IIALacS(I548E/G556D)a
|
|
The IIA
LacS-6H(I548E/G556D) mutant was constructed because
the Glu and Asp residues are conserved in all PTS members of the IIA
family,
whereas they are replaced by neutral residues in the non-PTS
IIA
domains. These residues are predicted to affect the interaction
of
IIA with its partner molecules, e.g., HPr~P and IIB. The
phosphorylation
kinetics of IIA
LacS-6H(I548E/G556D) is
shown in Fig.
5C and Table
2 (fourth column).
Indeed, the rate of
phosphorylation of IIA
LacS-6H(I548E/G556D) by HPr~P
from
S. thermophilus increased approximately
1 order of
magnitude. Remarkably, however, the rate of phosphorylation
of
IIA
LacS-6H(I548E/G556D) by HPr~P from
B. subtilis and
E. coli increased
2 and 3 orders of
magnitude relative to that of IIA
LacS-6H, and the
phosphorylation became nearly independent of the source
of HPr~P.
IIA
Glc~P can be dephosphorylated by transferring the
phosphoryl group to IICB
Glc or by redirecting the
phosphoryl group to HPr. The dephosphorylation
properties of
IIA
LacS-6H~P and IIA
LacS-6H(I548E/G556D)~P
were studied with HPr from
S. thermophilus,
B. subtilis, and
E. coli as phosphoryl acceptors. Figure
6 shows
the time course for the
phosphoryl transfer from IIA
LacS-6H~P to HPr from
S. thermophilus at different concentrations of
HPr. Under
these conditions, IIA
LacS-6H~P was quite stable and the
first-order rate constant for the
autodephosphorylation was 6.7 × 10
5 s
1 (Fig.
6, inset). The
dephosphorylation rates of IIA
LacS-6H~P were determined
with HPr from
S. thermophilus,
B. subtilis,
and
E. coli as phosphoacceptors. As anticipated from the
phosphorylation
assays, HPr from
S. thermophilus was a much
better acceptor than
HPr from
B. subtilis or
E. coli (Table
2). The phosphoryl transfer
from
IIA
LacS-6H(I548E/G556D)~P to HPr from
S. thermophilus,
B. subtilis, and
E. coli was
too fast to be measured accurately at 10°C. The data
with these three
proteins as acceptors were qualitatively very
similar, showing that
residues Glu-548 and Asp-556 allow a better
interaction between
IIA
LacS-6H and HPr of both homologous and heterologous
origin.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 6.
Phosphoryl transfer from IIALacS-6H~P to
HPr from S. thermophilus. The dephosphorylation reaction was
started by adding 11 µM purified IIALacS-6H~P to
50 mM Tris acetate (pH 7.5) containing 1 mM DTT, 2 mM
MgCl2, and HPr at concentrations of 10 µM ( ), 25 µM
( ), and 50 µM ( ). The reaction volume was 10 µl, and the
temperature was 10°C. The inset shows the dephosphorylation of the
IIALacS-6H in the absence of HPr.
|
|
Complementation of crr strains in trans.
Since E. coli HPr~P could phosphorylate
IIALacS, we next addressed the question of whether
IIALacS could substitute for IIAGlc in the
phosphoryl transfer catalyzed by the glucose PTS. The phosphoryl
transfer activity of IIALacS was studied in E. coli LM1 (crr manA), a strain defective in glucose
transport due to a lack of IIAGlc as well as a functional
mannose PTS. Since the N-terminal residues of IIALacS could
be important for the interaction with the membrane IICBGlc
protein, we tested IIALacS[181] and
IIALacS[173] as well as
IIALacS-6H(I548E/G556D) for the ability to restore glucose
transport in E. coli LM1 (data not shown). The results were
all negative, suggesting that these IIALacS proteins are
unable to transfer the phosphoryl group rapidly enough to
IICBGlc even though they can be phosphorylated by HPr~P.
To study the ability of IIA
LacS to affect glycerol
utilization by inhibiting glycerol kinase, IIA
LacS[173],
IIA
LacS-6H(H552R), and IIA
LacS-6H(I548E/G556D)
were expressed in
S. typhimurium PP2178
(
crr::Tn
10 nagE). This strain lacks
IIA
Glc as well as IICBA
Nag, and consequently
glycerol uptake is not inhibited by the presence
of a PTS sugar (Fig.
7A), which was observed in the wild-type
strain. Upon transformation of this strain with a plasmid bearing
a
wild-type
crr+ or
nagE+
gene and expressing the corresponding protein, glycerol uptake
is
inhibited by glucose (or analogs) (
36). Under these
conditions,
the equilibrium of IIA
Glc (or
II
Nag) is shifted from the phosphorylated to the
dephosphorylated state,
which is known to interact with (and inhibit)
glycerol kinase
(
22). Similarly, upon addition of
2-deoxyglucose to
S. typhimurium PP2178 expressing
IIA
LacS or IIA
LacS-6H(I548E/G556D), glycerol
uptake was partially inhibited (Fig.
7B
and C). The glycerol uptake was
not inhibited by IIA
LacS-6H(H552R), indicating that the
residue at position 552 in IIA
LacS is important for the
interaction with glycerol kinase (Fig.
7D).
The inhibition of glycerol
uptake was most clearly observed when
the actual uptake rate of
glycerol (amount of glycerol kinase)
was low (Fig.
8), indicating that the extent of
inhibition is
determined by the level of glycerol kinase, as has been
observed
previously (
37). The maximal inhibition of the
glycerol uptake
rate in
S. typhimurium PP2178 was 65%.
IIA
LacS-6H(I548E/G556D) inhibited glycerol kinase to a
greater extent than
IIA
LacS at equal glycerol uptake rates
(Fig.
8). This difference is most
likely due to the higher expression
of IIA
LacS-6H(I548E/G556D) than of
IIA
LacS[173], using the expression plasmids pSKIIAm2his
and pKKELE, respectively.
IIA
LacS could not be expressed to
similar high levels in
S. typhimurium PP2178, as pSKIIAhis
was lethal to these cells.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 7.
Inhibition of glycerol kinase activity by
IIALacS. S. typhimurium PP2178
(crr::Tn10 nagE) was transformed with
pKK223-3 (control) (A), pKKELE (IIALacS) (B), pSKIIAm2his
[IIALacS-6H(I548E/G556D)] (C), and pSKIIAm1his
[IIALacS-6H(H552R)] (D). Cells were grown overnight on a
minimal salts medium supplemented with 0.4% DL-lactate.
After being washed with minimal salts medium, the cells were diluted to
an A660 of 0.35 in minimal salts medium
containing 54 mM glycerol and incubated for 30 min at 37°C; glucose
was added to a final concentration of 10 mM; the cells were incubated
for 1 h at 37°C and then washed with minimal salts medium.
Uptake assays with 0.5 mM [14C]glycerol were performed in
the presence (open symbols) and absence (filled symbols) of 10 mM
2-deoxy-D-glucose; the cells were equilibrated in the
presence or absence of 2-deoxy-D-glucose for 5 min prior to
the initiation of uptake.
|
|

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 8.
Relationship between the activity of glycerol kinase and
the extent of inhibition of glycerol uptake by IIALacS
( ) and IIALacS-6H(I548E/G556D) ( ). Cells were grown
as described in the legend to Fig. 7. The data are from several
independent experiments that reflect partial induction by glycerol for
15, 20, or 30 min. The glycerol kinase activity was measured as
[14C]glycerol uptake rate in the absence of
2-deoxyglucose, and the inhibition of [14C]glycerol
uptake was measured from the ratio of the rates in the presence and
absence of 10 mM 2-deoxyglucose.
|
|
To investigate a possible role of IIA
LacS in regulating
adenylate cyclase activity, IIA
LacS,
IIA
LacS-6H(H552R), and
IIA
LacS-6H(I548E/G556D) were expressed in
S. typhimurium PP2178 and grown
on minimal salts A plates containing
succinate or citrate. No
growth was observed unless 5 mM cAMP was
included in the medium.
These results indicate that even though these
IIA
LacS proteins can be phosphorylated by HPr~P, they
cannot stimulate
adenylate cyclase to restore growth of
crr
mutants on citrate
or
succinate.
 |
DISCUSSION |
In this paper, we describe the functional expression and
purification to near homogeneity of the IIA domain of the lactose transport protein of S. thermophilus. On the basis of the
similarities in the primary sequences of IIALacS,
IIAGlc, and other PTS IIA protein domains (12,
20), we anticipated that IIALacS would be able to
carry out one or more functions associated with IIAGlc,
i.e., complement crr strains in PTS-mediated glucose uptake, inhibit glycerol kinase, and/or activate adenylate cyclase.
The in vitro phosphorylation assays indicate that
IIALacS-6H can be phosphorylated by HPr~P from S. thermophilus, B. subtilis, and E. coli, and
the results suggest that the phosphorylation site in
IIALacS is His-552. This residue corresponds to His-90 of
IIAGlc in E. coli, which has been shown to be
the phosphoryl-accepting site (4). Although
IIALacS can be phosphorylated by HPr~P, the
phosphorylation rates are lower than for phosphorylation of IIA
proteins involved in PTS-mediated transport (14). The rate
constant for the phosphoryl transfer between S. thermophilus
HPr~P and IIALacS at a temperature of 10°C was
k1 = 4.3 × 102
M
1 s
1; the rate constant for the
reverse reaction (IIALacS~P to HPr) was
k
1 = 1.1 × 103
M
1 s
1. Although these phosphoryl transfer
rates increased 10-fold at 37°C, it is evident that phosphorylation
of IIALacS by HPr~P from S. thermophilus is 4 orders of magnitude slower than phosphorylation of IIAGlc
by HPr~P from E. coli (14)
(k1 = 6.1 × 107
M
1 s
1). With HPr~P from
B. subtilis and E. coli, the differences are even
much larger, as one might expect, when interacting proteins from
different sources are compared (Fig. 5). The phosphorylation rate of
IIALacS by HPr~P from S. thermophilus
increased 1 order of magnitude when Ile-548 and Gly-556 were
substituted by Glu and Asp, respectively, and increased 3 and 4 orders
of magnitude when IIALacS-6H(I548E/G556D) was
phosphorylated by HPr~P from E. coli and B. subtilis, respectively (Fig. 6). The corresponding acidic residues (Glu-86 and Asp-94 of IIAGlc in E. coli) are
conserved in all PTS IIA protein domains but are not present in the
non-PTS IIA protein domains (Fig. 1). The crystal structure of
IIAGlc from E. coli shows that Asp-94
participates in phosphoryl transfer, as the backbone amide nitrogen of
this residue is positioned to form an H bond to the phosphoryl group
(16). It has been suggested that this H bond stabilizes the
transition state (trigonal bipyramid) form of the P atom. The conserved
Glu-86 is more exposed to the surface of the molecule and is proposed
to serve as the recognition site for one of the interacting PTS
proteins (12). Substitution in the
-glucoside IICBA of
E. coli of Asp-551, the equivalent of Asp-94 in
IIAGlc, by an alanine residue decreased the phosphorylation
rate relative to the wild-type protein (30). The higher rate
of phosphorylation of IIALacS-6H(I548E/G556D) than of
IIALacS-6H is consistent with the predictions one could
make from the three-dimensional structure of IIAGlc of
E. coli and substantiates the critical role of these
residues in the phosphorylation of IIA. Importantly, the rates of
(de)phosphorylation of IIALacS-6H(I548E/G556D) by HPr~P
from E. coli and B. subtilis are similar to those
of S. thermophilus, which allowed us to assess some of the
functional properties of IIALacS in a heterologous system
(see below).
The inability of IIALacS to substitute for
IIAGlc in phosphorylation of E. coli IIB, as
determined by assays of PTS-mediated glucose uptake, is likely due to
the low phosphorylation rate of IIALacS by E. coli HPr~P. Additionally, the inability of IIALacS
to complement the lack of IIAGlc in PTS-mediated glucose
uptake could also be due to an incompatible amino terminus. In this
respect, it is worth noting that cell extracts of E. coli
contain two electrophoretically distinguishable forms of
IIAGlc, a slow form and fast form. The fast form
[IIAGlc(fast)] is the product of an endopeptidase that
cleaves the N-terminal heptapeptide from the mature form.
IIAGlc(fast) is fully active in accepting the phosphoryl
group from HPr~P, but it has only 3% of the phosphodonor activity of
the intact protein (13) and has a smaller effect on
inhibition of methyl-
-D-thiogalactopyranoside uptake
(inducer exclusion) than IIAGlc(slow) (15). This
finding suggests that the N-terminal region of IIAGlc could
participate in the interaction with its partner molecules, such as
IIBGlc and the lactose permease. The IIALacS
protein that was used in the majority of the experiments is 173 amino
acids long and corresponds in length to IIAGlc(slow).
Addition of another eight amino acids (part of putative Q-linker region
in LacS) did not affect the (de)phosphorylation activity. Shortening of
IIALacS[173] by 19 residues abolished the ability of the
protein to accept the phosphoryl group from HPr. Future experiments are
required to clarify which amino acid residues are involved in the
interaction between IIAGlc and IIBGlc to
facilitate phosphoryl transfer to glucose.
Apart from its function in the uptake and phosphorylation of sugars,
IIAGlc interacts with several non-PTS enzymes such as
glycerol kinase, the MalK component of the maltose transport system,
and the melibiose and lactose transporters of E. coli,
resulting in inactive complexes (23). In a previous study
(36), it was shown that wild-type LacS protein, in which the
IIA domain is fused to the membrane-bound carrier domain, does not
inhibit glycerol kinase. This could point to the inability of
membrane-bound IIALacS to interact functionally with
glycerol kinase, but more likely the expression of LacS in S. typhimurium was too low for significant inhibition to be observed.
It is worth noting that membrane-bound IIANag, as part of
the IICBANag complex, is able to inhibit glycerol kinase
(37), indicating that inducer exclusion is not exclusively
mediated by cytosolic IIAGlc. Since we could express
IIALacS separate from the carrier domain of LacS, we also
studied the ability of the various IIALacS proteins to
inhibit glycerol uptake. Although IIALacS~P and
IIALacS-6H (I548E/G556D)~P were not able to rapidly
transfer the phosphoryl group to IICBGlc, the uptake of
glycerol in S. typhimurium PP2178 was inhibited by the
addition of 2-deoxyglucose, most likely because IIALacS~P
or IIALacS-6H (I548E/G556D)~P was dephosphorylated
through the redirection of phosphoryl groups to HPr and subsequently to
the mannose PTS. 2-Deoxyglucose is taken up by the mannose PTS and thus
indirectly influences the phosphorylation state of IIALacS.
The extent of inhibition of glycerol uptake was dependent on the actual
uptake rate of glycerol (amount of glycerol kinase) (Fig. 8),
suggesting that IIALacS inhibits glycerol kinase by forming
a stoichiometric complex with the enzyme as observed for
IIAGlc and glycerol kinase (37). Hurley et al.
(7) identified the sites of interactions between glycerol
kinase and E. coli IIAGlc, which mainly involve
hydrophobic and electrostatic interactions and a Zn(II) binding site.
The Zn(II) binding site is made up of the two active-site histidines of
IIAGlc (His-75 and His-90), Glu-478 of glycerol kinase, and
an H2O molecule. In the absence of Zn(II),
IIAGlc binds to glycerol kinase primarily via the
hydrophobic patch and without participation of the His residues. Except
for the histidines that coordinate the Zn atom, the positions are
poorly conserved in the non-PTS IIA protein domain(s). Nevertheless, IIALacS was able to inhibit glycerol kinase. Our results
also indicate that substitution of His-552 for Arg (His-552 in LacS
corresponds to His-90 in E. coli IIAGlc)
abolished the putative interaction of IIALacS with glycerol
kinase. Possibly, the binding constant of the mutant to glycerol kinase
is decreased as suggested for IIAGlc(H90Q) (16).
Whether the Zn atom plays an important role in the interaction of IIA
proteins to glycerol kinase is unclear, as IIAGlc(H75Q)
seems as effective an inhibitor as the wild-type protein (cited in
reference 16).
In gram-negative enteric bacteria the phosphorylated form of
IIAGlc stimulates adenylate cyclase, whereby the expression
of many catabolic enzymes is regulated through changes in cAMP levels, e.g., the expression of genes for succinate and citrate catabolism (1, 23). Reddy et al. (25) suggested that the
acquisition of a negative charge at His-90~P of E. coli
IIAGlc is responsible for the interaction with adenylate
cyclase. Although IIALacS and
IIALacS(I548E/G556D) could be phosphorylated by HPr from
E. coli both in vitro and in vivo, these IIALacS
proteins were not able to stimulate adenylate cyclase sufficiently, if
at all, to restore growth of crr mutants on succinate and
citrate. The in vivo phosphorylation is suggested by the identification of two species of IIALacS (IIALacS and
IIALacS~P) in cell extracts of E. coli cells
(unpublished data); it also follows from the glycerol kinase inhibition experiments.
The equilibrium constant (Keq = k1/K
1) for the phosphoryl transfer
reactions between IIALacS and HPr from S. thermophilus is 0.5, which is approximately threefold lower than
the corresponding value for HPr and IIAGlc from E. coli (Keq = 1.4 ± 0.5 [14]). This implies that at a given phosphorylation
potential, the phosphorylation state of IIALacS (and we
assume LacS as well) in S. thermophilus will be lower than
that of IIAGlc in E. coli. Since phosphorylation
of LacS inhibited the lactose-H+ symport reaction
(17), this condition will be met in vivo only when the
[HPr(His~P)]/[HPr] ratio is relatively high. Vadeboncoeur and
coworkers (34) reported that in stationary-phase cells of S. salivarius, the [HPr(His~P)]/[HPr] ratio is
approximately 2.5 for S. salivarius. On the other hand,
actively growing cells of S. mutans and S. salivarius contained mainly HPr(Ser-P) and HPr(His~P)(Ser-P), with very little HPr(His~P) and free HPr. Thus, the degree of phosphorylation of LacS will be low in exponentially growing cells of
S. thermophilus, which implies that the system will have
full activity. In resting cells of S. thermophilus, a
partial inhibition of LacS-mediated
methyl-
-D-thiogalactopyranoside transport was observed
(17).
 |
ACKNOWLEDGMENTS |
Enzyme I and HPr from E. coli were kindly provided by
G. T. Robillard (University of Groningen, Groningen, The
Netherlands), enzyme I and HPr from B. subtilis were a gift
from J. Reizer (University of California at San Diego), and the
antibodies raised against HPr of S. salivarius were provided
by C. Vadeboncoeur (Laval University, Quebec, Quebec, Canada). We thank
Rechien Bader-van't Hof for technical assistance.
This work was supported by a grant from the Dutch Organization for
Scientific Research under the auspices of the Dutch Foundation for Life Science.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology, Groningen Biomolecular Sciences and Biotechnology
Institute, University of Groningen, Kerklaan 30, 9751 NN Haren, The
Netherlands. Phone: (3150) 3632170. Fax: (3150) 3632154. E-mail:
B.Poolman{at}biol.rug.nl.
 |
REFERENCES |
| 1.
|
Botsford, J. L., and J. G. Harman.
1992.
Cyclic AMP in prokaryotes.
Microbiol. Rev.
56:100-122[Abstract/Free Full Text].
|
| 2.
|
Deutscher, J., and M. H. Saier, Jr.
1983.
ATP-dependent protein kinase-catalyzed phosphorylation of a seryl residue in HPr, a phosphate carrier protein of the phosphotransferase system in Streptococcus pyogenes.
Proc. Natl. Acad. Sci. USA
80:6790-6794[Abstract/Free Full Text].
|
| 3.
|
Deutscher, J., and H. Sauerwald.
1986.
Stimulation of dihydroxyacetone and glycerol kinase activity in Streptococcus faecalis by phosphoenolpyruvate-dependent phosphorylation catalyzed by enzyme I and HPr of the phosphotransferase system.
J. Bacteriol.
166:829-836[Abstract/Free Full Text].
|
| 4.
|
Dörschug, M.,
R. Frank,
H. R. Kalbitzer,
W. Hengstenberg, and J. Deutscher.
1984.
Phosphoenolpyruvate-dependent phosphorylation site in enzyme IIIGlc of the Escherichia coli phosphotransferase system.
Eur. J. Biochem.
14:113-119.
|
| 5.
|
Feese, M.,
D. W. Pettigrew,
N. D. Meadow,
S. Roseman, and S. J. Remington.
1994.
Cation-promoted association of a regulatory and target protein is controlled by protein phosphorylation.
Proc. Natl. Acad. Sci. USA
91:3544-3548[Abstract/Free Full Text].
|
| 6.
|
Foucaud, C., and B. Poolman.
1992.
Lactose transport system of Streptococcus thermophilus. Functional reconstitution of the protein and characterization of the kinetic mechanism of transport.
J. Biol. Chem.
267:22087-22094[Abstract/Free Full Text].
|
| 7.
|
Hurley, J. H.,
H. R. Faber,
D. Worthylake,
N. D. Meadow,
S. Roseman,
D. W. Pettigrew, and S. J. Remington.
1993.
Structure of the regulatory complex of Escherichia coli IIIGlc with glycerol kinase.
Science
259:673-677[Abstract/Free Full Text].
|
| 8.
|
Huynh, T. V.,
R. A. Young, and R. W. Daves.
1985.
In
D. M. Glover (ed.), DNA cloning, p. 56-110.
IRL Press Limited, Oxford, England.
|
| 9.
|
Knol, J.,
L. Veenhoff,
W. J. Liang,
P. J. F. Henderson,
G. Leblanc, and B. Poolman.
1996.
Unidirectional reconstitution into detergent-destabilized liposomes of the purified lactose transport system of Streptococcus thermophilus.
J. Biol. Chem.
271:15358-15366[Abstract/Free Full Text].
|
| 10.
|
Laemmli, U. K.
1970.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature (London)
227:680-685[Medline].
|
| 11.
|
Lengeler, J.,
A.-M. Auburger,
R. Mayer, and A. Pecher.
1980.
Characterization of mutants of Escherichia coli K12, selected by resistance to streptozotocin.
Mol. Gen. Genet.
179:49-54[Medline].
|
| 12.
|
Liao, D. I.,
G. Kapadia,
P. Reddy,
M. H. Saier, Jr.,
J. Reizer, and O. Herzberg.
1991.
Structure of the IIA domain of the glucose permease of Bacillus subtilis at 2.2-Å resolution.
Biochemistry
30:9583-9594[Medline].
|
| 13.
|
Meadow, N. D., and S. Roseman.
1982.
Sugar transport by the bacterial phosphotransferase system. Isolation and characterization of a glucose-specific phosphocarrier protein (IIIGlc) from Salmonella typhimurium.
J. Biol. Chem.
257:14526-14537[Abstract/Free Full Text].
|
| 14.
|
Meadow, N. D., and S. Roseman.
1996.
Rate equilibrium constants for phosphoryl transfer between active site histidines of Escherichia coli HPr and the signal transducing protein III-Glc.
J. Biol. Chem.
271:33440-33445[Abstract/Free Full Text].
|
| 15.
|
Misko, T. P.,
W. J. Mitshell,
N. D. Meadow, and S. Roseman.
1987.
Sugar transport by bacterial phosphotransferase system. Reconstitution of inducer exclusion in Salmonella typhimurium membrane vesicles.
J. Biol. Chem.
262:16261-16266[Abstract/Free Full Text].
|
| 16.
|
Pelton, J. G.,
D. A. Torchia,
S. J. Remington,
K. P. Murphy,
N. D. Meadow, and S. Roseman.
1996.
Structures of active-site histidine mutants of IIIGlc, a major signal-transducing protein in Escherichia coli. Effects on the mechanisms of regulation and phosphoryl transfer.
J. Biol. Chem.
271:33446-33456[Abstract/Free Full Text].
|
| 16a.
| Picon, A., and B. Poolman. Unpublished data.
|
| 17.
|
Poolman, B.,
J. Knol,
B. Mollet,
B. Nieuwenhuis, and G. Sulter.
1995.
Regulation of bacterial sugar-H+ symport by phosphoenolpyruvate-dependent enzyme I/HPr-mediated phosphorylation.
Proc. Natl. Acad. Sci. USA
92:778-782[Abstract/Free Full Text].
|
| 18.
|
Poolman, B.,
J. Knol,
C. van der Does,
P. J. Henderson,
W. J. Liang,
G. Leblanc,
T. Pourcher, and I. Mus-Veteau.
1996.
Cation and sugar selectivity determinants in a novel family of transport proteins.
Mol. Microbiol.
19:911-922[Medline].
|
| 19.
|
Poolman, B.,
R. Modderman, and J. Reizer.
1992.
Lactose transport system of Streptococcus thermophilus. The role of histidine residues.
J. Biol. Chem.
267:9150-9157[Abstract/Free Full Text].
|
| 20.
|
Poolman, B.,
T. J. Royer,
S. E. Mainzer, and B. F. Schmidt.
1989.
Lactose transport system of Streptococcus thermophilus: a hybrid protein with homology to the melibiose carrier and enzyme III of phosphoenolpyruvate-dependent phosphotransferase systems.
J. Bacteriol.
171:244-253[Abstract/Free Full Text].
|
| 21.
|
Postma, P. W.
1977.
Galactose transport in Salmonella typhimurium.
J. Bacteriol.
129:630-639[Abstract/Free Full Text].
|
| 22.
|
Postma, P. W.,
W. Epstein,
A. R. Schuitema, and S. O. Nelson.
1984.
Interaction between IIIGlc of the phosphoenolpyruvate:sugar phosphotransferase system and glycerol kinase of Salmonella typhimurium.
J. Bacteriol.
158:351-353[Abstract/Free Full Text].
|
| 23.
|
Postma, P. W.,
J. W. Lengeler, and G. R. Jacobson.
1993.
Phosphoenolpyruvate:carbohydrate phosphotransferase systems of bacteria.
Microbiol. Rev.
57:543-594[Abstract/Free Full Text].
|
| 24.
|
Presper, K. A.,
C. Y. Wong,
L. Liu,
N. D. Meadow, and S. Roseman.
1989.
Site-directed mutagenesis of the phosphocarrier protein. IIIGlc, a major signal-transducing protein in Escherichia coli.
Proc. Natl. Acad. Sci. USA
86:4052-4055[Abstract/Free Full Text].
|
| 25.
|
Reddy, P., and M. Kamireddi.
1998.
Modulation of Escherichia coli adenylate cyclase activity by catalytic-site mutants of protein IIAGlc of the phosphoenolpyruvate:sugar phosphotransferase system.
J. Bacteriol.
180:732-736[Abstract/Free Full Text].
|
| 26.
|
Reizer, J.,
S. L. Sutrina,
M. H. Saier,
G. C. Stewart,
A. Peterkofsky, and P. Reddy.
1989.
Mechanistic and physiological consequences of HPr(ser) phosphorylation on the activities of the phosphoenolpyruvate:sugar phosphotransferase system in gram-positive bacteria: studies with site-specific mutants of HPr.
EMBO J.
8:2111-2120[Medline].
|
| 27.
|
Reizer, J.,
S. L. Sutrina,
L. F. Wu,
J. Deutscher,
P. Reddy, and M. H. Saier.
1992.
Functional interactions between proteins of the phosphoenolpyruvate:sugar phosphotransferase systems of Bacillus subtilis and Escherichia coli.
J. Biol. Chem.
267:9158-9169[Abstract/Free Full Text].
|
| 28.
|
Saier, M. H., Jr.,
S. Chauvaux,
G. M. Cook,
J. Deutscher,
I. T. Paulsen,
J. Reizer, and J.-J. Ye.
1996.
Catabolite repression and inducer control in gram-positive bacteria.
Microbiology
142:217-230[Free Full Text].
|
| 29.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 30.
|
Schnetz, K.,
S. L. Sutrina,
M. H. Saier, Jr., and B. Rak.
1990.
Identification of residues in the catalytic permease of beta-glucoside of Escherichia coli by site specific mutagenesis and demonstration of interdomain cross-reactivity between the beta-glucoside and glucose system.
J. Biol. Chem.
265:13464-13471[Abstract/Free Full Text].
|
| 31.
|
Scholte, B. J., and P. W. Postma.
1981.
Competition between two pathways for sugar uptake by the phosphoenolpyruvate-dependent sugar phosphotransferase system in Salmonella typhimurium.
Eur. J. Biochem.
114:51-58[Medline].
|
| 32.
|
Studier, F. W., and B. A. Moffat.
1986.
Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes.
J. Mol. Biol.
189:113-130[Medline].
|
| 33.
|
Sutrina, S. L.,
P. Reddy,
M. H. Saier, Jr., and J. Reizer.
1990.
The glucose permease of Bacillus subtilis is a single polypeptide chain that functions to energize the sucrose permease.
J. Biol. Chem.
265:18581-18589[Abstract/Free Full Text].
|
| 34.
|
Vadeboncoeur, C.,
D. Brochu, and J. Reizer.
1991.
Quantitative determination of the intracellular concentration of the various forms of HPr, a phosphocarrier protein of the phosphoenolpyruvate:sugar phosphotransferase system in growing cells of oral streptococci.
Anal. Biochem.
196:24-30[Medline].
|
| 35.
|
Vadeboncoeur, C., and M. Pelletier.
1997.
The phosphoenolpyruvate:sugar phosphotransferase system of oral streptococci and its role in the control of sugar metabolism.
FEMS Microbiol. Rev.
19:187-207[Medline].
|
| 36.
|
van der Vlag, J., and P. W. Postma.
1995.
Regulation of glycerol and maltose uptake by the IIAGlc-like domain of IINag of the phosphotransferase system in Salmonella typhimurium LT2.
Mol. Gen. Genet.
248:236-241[Medline].
|
| 37.
|
van der Vlag, J.,
K. van Dam, and P. W. Postma.
1994.
Quantification of the regulation of glycerol and maltose metabolism by IIAGlc of the phosphoenolpyruvate-dependent glucose phosphotransferase system in Salmonella typhimurium.
J. Bacteriol.
176:3518-3526[Abstract/Free Full Text].
|
| 38.
|
van Dijk, A. A.,
L. C. M. de Lange,
W. W. Bachovchin, and G. T. Robillard.
1990.
Effect of phosphorylation on hydrogen-bonding interactions of the active site histidine of the phosphocarrier protein HPr of the phosphoenolpyruvate-dependent phosphotransferase system determined by 15N NMR spectroscopy.
Biochemistry
29:8164-8171[Medline].
|
| 39.
|
Vogler, A. P.,
C. P. Broekhuizen,
A. Schuitema,
J. W. Lengeler, and P. W. Postma.
1988.
Suppression of IIAGlc-defects by enzymes IINag and IIBgl of the PEP:carbohydrate phosphotransferase system.
Mol. Microbiol.
2:719-726[Medline].
|
| 40.
|
Worthylake, D.,
N. D. Meadow,
S. Roseman,
D.-I. Liao,
O. Herzberg, and S. J. Remington.
1991.
Three-dimensional structure of the Escherichia coli phosphocarrier protein IIIGlc.
Proc. Natl. Acad. Sci. USA
88:10382-10386[Abstract/Free Full Text].
|
| 41.
|
Yazyu, H.,
S. S. Niiya,
T. Shimamoto,
H. Kanazawa,
M. Futai, and T. Tsuchiya.
1984.
Nucleotide sequence of the melB gene and characterization of deduced amino acid sequence of the melibiose carrier in Escherichia coli.
J. Biol. Chem.
259:4320-4326[Abstract/Free Full Text].
|
Journal of Bacteriology, January 1999, p. 632-641, Vol. 181, No. 2
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Deutscher, J., Francke, C., Postma, P. W.
(2006). How Phosphotransferase System-Related Protein Phosphorylation Regulates Carbohydrate Metabolism in Bacteria. Microbiol. Mol. Biol. Rev.
70: 939-1031
[Abstract]
[Full Text]
-
Cochu, A., Vadeboncoeur, C., Moineau, S., Frenette, M.
(2003). Genetic and Biochemical Characterization of the Phosphoenolpyruvate:Glucose/Mannose Phosphotransferase System of Streptococcus thermophilus. Appl. Environ. Microbiol.
69: 5423-5432
[Abstract]
[Full Text]
-
Monedero, V., Kuipers, O. P., Jamet, E., Deutscher, J.
(2001). Regulatory Functions of Serine-46-Phosphorylated HPr in Lactococcus lactis. J. Bacteriol.
183: 3391-3398
[Abstract]
[Full Text]
-
Dossonnet, V., Monedero, V., Zagorec, M., Galinier, A., Pérez-Martínez, G., Deutscher, J.
(2000). Phosphorylation of HPr by the Bifunctional HPr Kinase/P-Ser-HPr Phosphatase from Lactobacillus casei Controls Catabolite Repression and Inducer Exclusion but Not Inducer Expulsion. J. Bacteriol.
182: 2582-2590
[Abstract]
[Full Text]
-
Reizer, J., Bachem, S., Reizer, A., Arnaud, M., Saier, M. H. Jr, Stulke, J.
(1999). Novel phosphotransferase system genes revealed by genome analysis - the complete complement of PTS proteins encoded within the genome of Bacillus subtilis. Microbiology
145: 3419-3429
[Abstract]
[Full Text]
-
Tobisch, S., Stülke, J., Hecker, M.
(1999). Regulation of the lic Operon of Bacillus subtilis and Characterization of Potential Phosphorylation Sites of the LicR Regulator Protein by Site-Directed Mutagenesis. J. Bacteriol.
181: 4995-5003
[Abstract]
[Full Text]
-
Veenhoff, L. M., Geertsma, E. R., Knol, J., Poolman, B.
(2000). Close Approximation of Putative alpha -Helices II, IV, VII, X, and XI in the Translocation Pathway of the Lactose Transport Protein of Streptococcus thermophilus. J. Biol. Chem.
275: 23834-23840
[Abstract]
[Full Text]
-
Gunnewijk, M. G. W., Poolman, B.
(2000). Phosphorylation State of HPr Determines the Level of Expression and the Extent of Phosphorylation of the Lactose Transport Protein of Streptococcus thermophilus. J. Biol. Chem.
275: 34073-34079
[Abstract]
[Full Text]
-
Gunnewijk, M. G. W., Poolman, B.
(2000). HPr(His~P)-mediated Phosphorylation Differently Affects Counterflow and Proton Motive Force-driven Uptake via the Lactose Transport Protein of Streptococcus thermophilus. J. Biol. Chem.
275: 34080-34085
[Abstract]
[Full Text]