Previous Article | Next Article 
Journal of Bacteriology, January 1999, p. 642-647, Vol. 181, No. 2
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
The Mithramycin Gene Cluster of Streptomyces
argillaceus Contains a Positive Regulatory Gene and Two
Repeated DNA Sequences That Are Located at Both Ends of the
Cluster
Felipe
Lombó,
Alfredo F.
Braña,
Carmen
Méndez, and
José A.
Salas*
Departamento de Biología Funcional e
Instituto Universitario de Biotecnología de Asturias
(I.U.B.A.-C.S.I.C.), Universidad de Oviedo, 33006 Oviedo, Spain
Received 13 July 1998/Accepted 5 November 1998
 |
ABSTRACT |
Sequencing of a 4.3-kb DNA region from the chromosome of
Streptomyces argillaceus, a mithramycin producer, revealed
the presence of two open reading frames (ORFs). The first one
(orfA) codes for a protein that resembles several transport
proteins. The second one (mtmR) codes for a protein similar
to positive regulators involved in antibiotic biosynthesis (DnrI, SnoA,
ActII-orf4, CcaR, and RedD) belonging to the Streptomyces
antibiotic regulatory protein (SARP) family. Both ORFs are separated by
a 1.9-kb, apparently noncoding region. Replacement of the
mtmR region by an antibiotic resistance cassette completely
abolished mithramycin biosynthesis. Expression of mtmR in a
high-copy-number vector in S. argillaceus caused a 16-fold
increase in mithramycin production. The mtmR gene restored
actinorhodin production in Streptomyces coelicolor JF1
mutant, in which the actinorhodin-specific activator ActII-orf4 is
inactive, and also stimulated actinorhodin production by
Streptomyces lividans TK21. A 241-bp region located 1.9 kb
upstream of mtmR was found to be repeated approximately 50 kb downstream of mtmR at the other end of the mithramycin
gene cluster. A model to explain a possible route for the acquisition
of the mithramycin gene cluster by S. argillaceus is proposed.
| |
INTRODUCTION |
Actinomycetes are producers of a
variety of antibiotics and other secondary metabolites. In the last few
years many biosynthetic gene clusters have been studied in some detail,
leading to the isolation and characterization of many genes involved in
antibiotic biosynthesis by actinomycetes. Several pathway-specific
regulatory genes have been identified in some of these clusters:
redD for the undecylprodigiosin pathway (24),
actII-orf4 for the actinorhodin pathway (15),
dnrI for the daunorubicin pathway (33),
srmR for the spiramycin pathway (16),
strR for the streptomycin pathway (10), and
ccaR for the cephamycin and clavulanic acid pathways (25). Three of them have been experimentally shown to bind
specifically to promoter regions within the corresponding gene
clusters: the StrR activator from the streptomycin pathway
(28), the DnrI activator from the daunorubicin pathway
(34), and the ActII-orf4 activator from the actinorhodin
pathway (2). The last two regulators recognize similar DNA sequences.
Mithramycin (see Fig. 1A) (also designated aureolic acid, plicamycin,
mithracin, LA7017, and A2371) is an antitumor drug, synthesized by
different actinomycete species, that belongs to the aureolic acid group
of drugs and has clinical application in the treatment of several
tumors (27, 32). Structurally, mithramycin is an aromatic
polyketide containing a three-ring chromophoric aglycon with a side
carbon chain derived from the condensation of ten acetates and a
disaccharide (D-olivose-D-olivose) and a
trisaccharide
(D-olivose-D-oliose-D-mycarose)
attached to C-6 and C-2 of the mithramycin aglycon, respectively.
Several genes from the mithramycin gene cluster of Streptomyces
argillaceus ATCC 12956 have been isolated and characterized,
including type II polyketide synthase genes (6, 20), two
genes involved in early biosynthesis of the deoxysugars
(21), two glycosyltransferases (13), and a
mithramycin resistance determinant consisting of an ABC transporter
(12).
We report here the cloning, sequencing, inactivation, and expression of
another gene from S. argillaceus, mtmR, that
encodes a positive regulator of mithramycin biosynthesis. Evidence is also presented showing the existence of a DNA region located upstream of the mtmR gene which is repeated at the other end of the
mithramycin gene cluster.
| |
MATERIALS AND METHODS |
Microorganisms, culture conditions, and vectors.
S.
argillaceus ATCC 12956, a mithramycin producer, was used as the
donor of chromosomal DNA. For sporulation, it was grown for 7 days at
30°C on plates containing A medium (12). For protoplast transformation, the organism was grown on R5 solid medium plates (17). Streptomyces coelicolor JF1 (11)
and Streptomyces lividans TK21 (17) were used as
hosts for gene expression. Escherichia coli XL1-Blue
(7) was used as the host for subcloning. Growth in liquid
medium was carried out at 37°C on TSB medium (Trypticase soy broth;
Oxoid). pUK21 (38) and pUC18 were used as vectors for
subcloning in E. coli and for DNA sequencing. pIAGO
(1) is pWHM3 (37) containing the promoter of the
erythromycin resistance gene (ermE) from
Saccharopolyspora erythraea (5). Plasmid pBSKT was constructed by subcloning the thiostrepton resistance cassette (36) as a 1.4-kb SmaI fragment in the unique
NaeI site of pBluescript SK(
) (Stratagene).
DNA manipulation and sequencing.
DNA manipulations were
according to standard procedures for E. coli (30)
and for Streptomyces (17). Southern hybridization was according to standard procedures (17). DNA sequencing
was carried out by the dideoxynucleotide chain termination method (31) with Taq polymerase and by using an
ALF-express automatic DNA sequencer (Pharmacia). To overcome band
compression artifacts, 7-deaza-dGTP was routinely used instead of dGTP
(23). Both DNA strands were sequenced with universal primers
or with internal oligoprimers (17-mer). Computer-aided database
searching and sequence analyses were carried out by using the
University of Wisconsin Genetics Computer Group (GCG) programs package
(9) and the BLASTP program (1a).
Gene replacement.
For the inactivation of the
mtmR gene by gene replacement, a 7.5-kb
HindIII-StuI fragment from cosAR13 (Fig. 1B) was
subcloned into the HindIII-EcoRV sites of pUK21,
generating pFLR. The three internal BamHI fragments (0.6, 0.9, and 0.02 kb; see Fig. 1B) were deleted by digestion with
BamHI, thus eliminating the mtmR gene, and
replaced by a 1.4-kb BglII-BamHI fragment
containing an apramycin resistance cassette (plasmid pFL
R). The
insert in this construction was rescued as an SpeI fragment
by using the two SpeI restriction sites at both ends of the
pUK21 polylinker and was then subcloned into the same restriction site
of plasmid pBSKT. This construction (pFLTR) was used to transform
S. argillaceus protoplasts and primary transformants
selected on R5 agar plates containing 25 µg of apramycin/ml. To
verify if the gene replacement event took place, these primary
transformants were then tested for their susceptibility to thiostrepton
(50 µg/ml).
PCR amplification.
A 0.84-kb fragment containing the
mtmR gene was amplified by PCR by using the following
primers: (5') GAGATCTAGAGTCGGAAGGTGTGACAGA (3')
for the 5'-end of the gene and (5')
GAGATCTAGACTACGCCGCGCTCGGCCC (3') for the 3'-end
of the gene (an XbaI site was included in the oligoprimers
to facilitate subcloning and is indicated by underscoring). The PCR
product was subcloned into the XbaI site of pIAGO in the
right orientation.
HPLC analysis.
Production of mithramycin was determined by
high-performance liquid chromatography (HPLC) analysis of ethyl acetate
extracts of cultures of the different strains grown on R5 agar plates
containing 50 µg of thiostrepton/ml when appropriate. One-quarter of
an R5 agar plate was extracted with 10 ml of ethyl acetate, and after evaporation of the organic solvent, the residue was resuspended in 200 µl of methanol. Aliquots (100 µl) were then analyzed by HPLC in a
µBondapak C18 column (Waters) with acetonitrile and 0.1%
trifluoroacetic acid in water as the mobile phase. Elution was carried
out with a linear gradient of acetonitrile from 10 to 100% for 30 min,
at 1 ml/min. Detection and spectral characterization of peaks were
performed with a photodiode array detector (Waters).
Nucleotide sequence accession numbers.
The 4,346-bp sequence
corresponding to the orfA and mtmR genes has
GenBank accession no. AF056309, and the 484-bp region containing the
repeated sequence has GenBank accession no. AF056310.
| |
RESULTS |
The mtmR gene product resembles positive regulators of
antibiotic biosynthetic pathways.
From a cosmid library of
chromosomal DNA from S. argillaceus, a mithramycin producer,
we have previously isolated a family of overlapping clones containing
the mithramycin gene cluster. One of these clones, cosAR13, overlapped
with cosAR7, from which we have cloned and sequenced a region
containing two genes encoding a glucose-1-phosphate:TTP thymidylyl
transferase (mtmD) and a TDP-D-glucose
4,6-dehydratase (mtmE) (21). These two enzymes are involved in the early stages of 6-deoxysugar biosynthesis. We have
now sequenced, at approximately 3.5 kb upstream of mtmD and
mtmE genes, a 4,346-nucleotide DNA region (Fig.
1B). The sequence was analyzed for coding
regions by using the CODONPREFERENCE and TESTCODE programs
of the GCG package (9). From this analysis the presence of
two open reading frames (ORFs) transcribed in opposite and divergent
directions was deduced (Fig. 1B). A 1.9-kb, apparently noncoding DNA
region was located between the two ORFs.
View larger version (14K):
[in this window]
[in a new window]
|
FIG. 1.
(A) Structure of mithramycin. (B) Schematic
representation of the location of mtmR in the chromosome of
S. argillaceus with respect to mithramycin sugar
biosynthetic genes and the mithramycin polyketide synthase (PKS) genes.
The black bar indicates the region sequenced in this paper. pFL3R,
pFL3R1, and pFL3R2 represent the inserts in the plasmid constructions
used for activation of mithramycin production. The insert in pFL3R1 was
generated by PCR amplification (see Materials and Methods). A,
Asp700I; B, BamHI; H, HindIII; P,
SphI; S, SmaI; T, StuI. Restriction
sites A, P, S, and T are not unique sites in the chromosomal region
shown.
|
|
The first ORF from left to right (designated
orfA) comprises
1,242 nucleotides, starting with a GTG codon and ending with
a TAG
codon; it codes for a polypeptide of 414 amino acids and
has an
Mr of 44,652. Comparison of the deduced product
of
orfA with proteins in databases showed similarities with
different
membrane proteins involved in the transport of
proline-betaine
in
E. coli (33.1% identity) (
8),
transport of different metabolites
in
Haemophilus influenzae
(35.4% identity) (
35), and transport
of pthalates in
Burkholderia cepacia (37.2% identity) (
29).
The second ORF (designated
mtmR) comprises 831 nucleotides,
starting with an ATG codon and ending with a TAG codon. The starting
codon of
mtmR is preceded by a sequence (AGAA) with a
certain
degree of complementarity to a region close to the 3' end of
the
16S rRNA of
S. lividans (
4) that could
potentially act as a
ribosomal binding site. The overall (62.5%) and
third codon position
(77.2%) G+C contents of
mtmR were
lower than those of most
Streptomyces genes, i.e., 61 to
79.7% and 76.4 to 98.3%, respectively (
40).
mtmR contains a large number of codons that are very rare in
a
G+C-rich organism such as
Streptomyces. The presence of
two TTA
codons could be of particular interest, since their involvement
in the regulation of differentiation and secondary metabolism
in
Streptomyces has been shown (
15,
18,
19). The
mtmR gene
would code for a polypeptide of 276 amino acids
with an estimated
Mr of 30,705. Comparison of
the deduced product of the
mtmR gene
with proteins in
databases showed similarities with different
proteins that have been
proposed to be activators of antibiotic
biosynthesis. The highest
scores were with DnrI from the daunorubicin
pathway in
Streptomyces peucetius (41.9% identity) (
33),
SnoA
from the nogalamycin pathway in
Streptomyces nogalater
(37.9%
identity) (
41), ActII-orf4 from the actinorhodin
pathway in
S. coelicolor (32.9% identity) (
15),
RedD from the undecylprodigiosin
pathway in
S. coelicolor
(31% identity) (
24) and CcaR from the
cephamycin and
clavulanic acid pathways in
Streptomyces clavuligerus (32.4% identity) (
25). Also, the
mtmR gene
product showed similarity
with two proteins from
Mycobacterium, Cy50.15 (
26) and EmbR
(
3), which are transcriptional activators of different
genes.
All antibiotic activators described above have been proposed
(
39)
to constitute a family designated
Streptomyces antibiotic regulatory
proteins (SARPs). Its
members contain a region close to the N
termini resembling, both in
amino acid sequence and predicted
secondary structure, the DNA-binding
domain at the C terminus
of the
E. coli activator OmpR
(
22). The MtmR protein also contains
this conserved amino
acid region present in both SARPs and OmpR
(Fig.
2).
View larger version (107K):
[in this window]
[in a new window]
|
FIG. 2.
Alignment of the amino acid sequence of MtmR and
different SARPs. MtmR, mithramycin positive regulator from S. argillaceus (this work); DnrI, daunorubicin positive regulator
from S. peucetius (33); SnoA, nogalamycin
positive regulator from S. nogalater (41);
ActII-orf4, actinorhodin positive regulator from S. coelicolor (15); RedD, undecylprodigiosin positive
regulator from S. coelicolor (24); and CcaR,
cephamycin and clavulanic acid positive regulator from S. clavuligerus (25).
|
|
Extra copies of mtmR increase mithramycin
biosynthesis.
From the above-mentioned similarities, it was
presumed that mtmR could code for a positive regulator of
mithramycin biosynthesis. We therefore decided to express the gene in a
multicopy plasmid and to determine its possible role as a positive
regulator in mithramycin production. A 2.5-kb SmaI fragment
(containing the mtmR gene) was subcloned into the
BamHI site (blunt ended) of pIAGO in the right orientation.
The resultant construction (pFL3R) (Fig. 1B) was used to transform
S. argillaceus protoplasts, and transformants were selected
for thiostrepton resistance. As a control, transformations were also
carried out with pIAGO without any insertion. The levels of mithramycin
production in each class of transformants were then determined by HPLC
after extraction of the cultures with ethyl acetate. The presence of
extra copies of mtmR caused a marked increase (16-fold) in
mithramycin production compared to that by the control (Fig. 3A and
B). The insert in pFL3R (2.5-kb
SmaI fragment) comprises the entire mtmR gene and 1,032 bp of the upstream noncoding region. For that reason and to
verify if the increase in mithramycin production was due either to the
mtmR gene itself or to a possible regulatory role of the upstream noncoding region, we subcloned independently mtmR
and the upstream noncoding region. Two new constructions were generated (Fig. 1B): (i) a 0.84-kb XbaI PCR fragment containing the
entire mtmR gene subcloned in the XbaI site of
pIAGO, generating pFL3R1; and (ii) a 1,252-bp
SmaI-Asp700I fragment containing the upstream noncoding region subcloned into the unique BamHI site
(blunt-ended) of pIAGO, generating pFL3R2. Both constructions were used
to transform S. argillaceus protoplasts, and the levels of
mithramycin production by selected transformants generated from each
transformation were determined. Stimulation of mithramycin production
was observed with pFL3R1 (mtmR gene construction) but not
with pFL3R2 (upstream noncoding region) (data not shown), confirming
that mtmR was responsible for the increase in mithramycin
production.
View larger version (13K):
[in this window]
[in a new window]
|
FIG. 3.
HPLC analysis of mithramycin production by the wild-type
S. argillaceus strains containing pIAGO (A) and pFL3R (B)
and S. argillaceus M13R1 (C). The arrows indicate the
mobility of mithramycin.
|
|
Plasmid pFL3R was also used to complement
S. coelicolor JF1.
This is a mutant in which the ActII-orf4, a positive regulator
of
actinorhodin biosynthesis, is inactive (
11). Transformation
of this mutant with pFL3R restored actinorhodin biosynthesis.
S. lividans TK21 carries the entire gene cluster for actinorhodin
production, but this cluster is not usually expressed under normal
growth conditions. When
S. lividans TK21 was transformed
with
pFL3R, actinorhodin production was activated. Similar activation
has been described for the use of the
actII-orf4 gene from
S. coelicolor A3(2) (
15). The results of all
these experiments
suggest that MtmR is a positive regulator of
antibiotic
biosynthesis.
Inactivation of mtmR blocked mithramycin
biosynthesis.
To demonstrate the involvement of mtmR in
mithramycin biosynthesis, the gene was deleted by gene replacement.
Plasmid pFLTR (Fig. 4A) was used to
transform S. argillaceus protoplasts, and 38 primary
transformants (apramycin-resistant transformants) were obtained. The
occurrence of a second crossover in some of these clones was verified
by their susceptibility to thiostrepton, and six clones were found to
be thiostrepton sensitive (50 µg/ml) as a consequence of a double
crossover at both sides of the apramycin resistance cassette. One clone
(M13R1) was selected for further analysis. The occurrence of the gene
replacement event in M13R1 was verified by Southern analysis (Fig. 4).
When a 3.7-kb HindIII-SphI fragment was used
as a probe, three expected hybridizing BamHI bands (9, 0.9, and 0.6 kb) were observed (Fig. 4B), while these bands were absent in
M13R1 mutant and were replaced by a 10-kb BamHI fragment
(Fig. 4B). This confirmed that the mtmR gene had been
deleted from the chromosome and replaced by the antibiotic resistance
cassette. Interestingly, an additional unexpected hybridizing BamHI band of 6.7 kb was also observed in the chromosome of
both the wild-type strain and M13R1 mutant (Fig. 4B) (see below for further details about this band). Ethyl acetate extracts from agar
plates from mutant M13R1 were analyzed by HPLC, and neither mithramycin
nor mithramycin intermediates were detected (Fig. 3C), indicating that
mtmR is essential for mithramycin biosynthesis.
View larger version (18K):
[in this window]
[in a new window]
|
FIG. 4.
Analysis of the gene replacement experiment to generate
mutant M13R1. (A) Scheme representing the replacement event in the
chromosome of wild-type S. argillaceus strain produced by a
double crossover to construct mutant M13R1. The asterisks indicate the
ends of the probe used for Southern hybridization (a 3.7-kb
HindIII-SphI fragment). The thin lines
represent the BamHI hybridizing bands both in the wild type
and in the mutant. B, BamHI; G, BglII; H,
HindIII; P, SphI; T, StuI. Am,
apramycin resistance cassette; tsr, thiostrepton resistance cassette.
(B) Southern hybridization by using a 3.7-kb
HindIII-SphI fragment as a probe. Lane 1, BamHI-digested chromosomal DNA of the wild-type S. argillaceus strain; lane 2, BamHI-digested chromosomal
DNA of M13R1 strain. Sizes of bands in kilobases are indicated on the
left and right of the gel.
|
|
A 241-bp region located upstream of mtmR is repeated at
the other end of the mithramycin gene cluster.
The detection of an
extra band in the Southern hybridization mentioned above (Fig. 4B)
suggested to us the possible existence of repeated sequences in the
mithramycin gene cluster. In our laboratory we have isolated several
overlapping cosmid clones containing a DNA region from S. argillaceus of approximately 80 kb, in which we have identified 34 genes that probably encode the entire mithramycin gene cluster. Data
for 14 of these genes have been published (12, 13, 20, 21).
To test if this repeated sequence was located within the mithramycin
gene cluster, a Southern analysis with the same probe (the 3.7-kb
HindIII-SphI fragment) against
BamHI digestions of the different overlapping cosmid clones
containing the mithramycin gene cluster was carried out (Fig.
5). cosAR7 contains most of the genes of
the central region of the cluster, while cosAR13 and cosAR3 contain the
genes located at the left- and right-hand sides of the cluster (Fig. 5B). cosAR3 showed a 6.5-kb BamHI hybridizing band under
high-stringency conditions (Fig. 5A). This clone (cosAR3) had been
isolated by conferring resistance to mithramycin when expressed in
Streptomyces albus, and from this clone an ABC transporter
system that was located within the 6.5-kb BamHI fragment was
cloned and sequenced (12). Further subcloning and Southern
analysis reduced the hybridizing region to a 0.6-kb
BglII-SalI fragment located approximately 800 bp
downstream of the mtrB gene (Fig. 5B). mtrB is
the last gene at the right-hand side of the mithramycin gene cluster
and is approximately 50 kb apart from mtmR. The DNA sequence
of the 0.6-kb BglII-SalI fragment was determined
and compared with that of the 4.3-kb previously sequenced fragment
described above. Interestingly, a nearly perfect 241-bp identical
region (with only three mismatches) was found between a sequence
located within the 0.6-kb BglII-SalI fragment and
a DNA sequence located 1,851 bp upstream of mtmR (Fig.
6). A detailed analysis of the location
of this sequence around the mtmR gene region showed that it
is formed by 139 bp of the 5' end of orfA and 102 bp of the
region immediately upstream of orfA (Fig. 6). Consequently,
the mithramycin gene cluster is flanked upstream of mtmR and
downstream of mtrB by two direct repeated sequences (Fig.
5B).
View larger version (13K):
[in this window]
[in a new window]
|
FIG. 5.
(A) Southern hybridization of overlapping cosmid clones
containing the mithramycin gene cluster by using the 3.7-kb
HindIII-SphI fragment as a probe. Plasmid
DNAs from cosAR3, cosAR7, and cosAR13 were digested with
BamHI. Sizes of bands in kilobases are indicated on the left
of the gel. (B) Schematic representation of the mithramycin gene
cluster showing the locations of the repeated sequences (RS) at both
ends of the cluster. B, BamHI; G, BglII; L,
SalI. The black bars indicate the hybridizing bands formed
against the probe, the 3.7-kb HindIII-SphI
fragment. The shaded rectangles indicate the locations of the direct
repeated sequences. cosAR13, cosAR7, and cosAR3 correspond to three
cosmid clones comprising the mithramycin gene cluster.
|
|
View larger version (58K):
[in this window]
[in a new window]
|
FIG. 6.
Alignment of the DNA sequences of the 0.6-kb
BglII-SalI fragment from cosAR3 and the
homologous region from the 4.3-kb sequence located in cosAR13 around
orfA and mtmR. The sequences were compared by
using the GAP program (9). The coding sequence of
orfA is indicated in bold letters. The sequence that is
identical in both DNA regions is enclosed within a frame.
|
|
| |
DISCUSSION |
Sequencing of the left-hand side of the mithramycin gene cluster
revealed the presence of a gene, mtmR, that very possibly plays a role as an activator for mithramycin biosynthesis in S. argillaceus. Several lines of evidence support this role: (i) comparison of MtmR with proteins in databases shows that MtmR resembles
different positive regulators of the SARP family which are involved in
antibiotic biosynthesis, (ii) deletion of mtmR completely
blocked the production of mithramycin or any intermediates, (iii) the
presence of extra copies of mtmR in the producer strain produced a 16-fold increase in mithramycin biosynthesis, and (iv) mtmR was able to complement a mutation in the
actinorhodin-specific activator actII-orf4 gene and
activated actinorhodin biosynthesis in S. lividans TK21.
Based on protein similarity, DnrI is the closest homologue regulatory
protein to MtmR. DnrI has been described as a daunorubicin
transcriptional activator in S. peucetius (34). Through DNA-binding and DNase I footprinting assays it was also shown
that DnrI binds specifically to DNA fragments containing promoter
regions in the daunorubicin gene cluster. Interestingly, these binding
sites contain imperfect inverted repeat sequences (6 to 10 bp) with a
5'-TCGAG-3' consensus sequence (34). This consensus sequence
forms part of a heptameric direct repeat unit present two to three
times in the promoter regions of the daunorubicin and actinorhodin
biosynthetic gene clusters (34, 39). Evidence is also
available for the interaction between the ActII-orf4 regulatory protein
and these sequences (2). We have examined the DNA sequences around putative promoter regions in the mithramycin gene cluster, and
we found that the TCGAG consensus sequence is also present in most of
the DNA regions examined, including the regions (i) between the
divergent mtmQ (aromatase) and mtmX (cyclase)
genes (20), (ii) between the mtmZ (thioesterase)
and mtmA (S-adenosylmethionine synthase) genes
(14), (iii) preceding the mtrA (export
ATP-binding protein) gene (12), and (iv) between the
divergent mtmV (2,3-dehydratase in sugar biosynthesis) and
mtmW (2,3-reductase in sugar biosynthesis) genes
(14). This indicates that the TCGAG consensus sequence is
present in promoter regions from at least three antibiotic biosynthetic
gene clusters (daunorubicin, actinorhodin, and mithramycin), all of
them containing positive regulators of the SARP family, and that
possibly MtmR could act as a transcriptional activator in mithramycin
biosynthesis in a manner similar to DnrI and ActII-orf4.
Upstream of mtmR there is another gene, orfA,
that is transcribed divergently from mtmR. Both genes are
separated by a long, apparently noncoding region (1.9 kb). Within this
region and partially overlapping the 5' end of orfA, there
is a 241-bp DNA region that is also present at the other end of the
mithramycin gene cluster. These sequences are direct repeated sequences
(RS) and are probably located outside of the mithramycin gene cluster.
Based on the existence and location of these two RS, a hypothetical
model is proposed to explain how S. argillaceus could
acquire the mithramycin gene cluster through evolution. The mithramycin
gene cluster could have been part of a circular extrachromosomal
element in which a copy of the RS would be present between
mtrB and mtmR genes. Through Campbell
recombination to an identical RS present in the chromosome of an
ancestor non-mithramycin-producing strain of S. argillaceus,
the extrachromosomal element could have been incorporated into the
S. argillaceus chromosome. This event would have resulted in
the acquisition of the mithramycin gene cluster by S. argillaceus, and as a consequence, two RS would now be
flanking the mithramycin cluster.
| |
ACKNOWLEDGMENTS |
This work was supported by a grant from the European Community
(BIO4-CT96-0068) and by grants from the Spanish Ministry of Education
and Science through the Plan Nacional en Biotecnologia (BIO94-0037 and
BIO97-0771).
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Departamento de
Biología Funcional e Instituto Universitario de
Biotecnología de Asturias (I.U.B.A.-C.S.I.C.), Universidad de
Oviedo, 33006 Oviedo, Spain. Phone: (34-8)5103652. Fax:
(34-8)5103652. E-mail:
Jasf{at}sauron.quimica.uniovi.es.
| |
REFERENCES |
| 1.
| Aguirrezabalaga, I. Unpublished data.
|
| 1a.
|
Altschul, S. F.,
W. Gish,
W. Miller,
E. W. Myers, and D. J. Lipman.
1990.
Basic local alignment search tool.
J. Mol. Biol.
215:403-410[Medline].
|
| 2.
| Arias, P., M. A. Fernández-Moreno, and F. Malpartida. Personal communication.
|
| 3.
|
Belanger, A. E.,
G. S. Besra,
M. E. Ford,
K. Mikusova,
J. T. Belisle,
P. J. Brennan, and J. M. Inamine.
1996.
The embAB genes of Mycobacterium avium encode an arabinosyl transferase involved in cell wall arabinan biosynthesis that is the target for the antimycobacterial drug ethambutol.
Proc. Natl. Acad. Sci. USA
93:11919-11924[Abstract/Free Full Text].
|
| 4.
|
Bibb, M. J., and S. N. Cohen.
1982.
Gene expression in Streptomyces: construction and application of promoter-probe plasmid vectors in Streptomyces.
Mol. Gen. Genet.
187:265-277[Medline].
|
| 5.
|
Bibb, M. J.,
G. R. Janssen, and J. M. Ward.
1985.
Cloning and analysis of the promoter region of the erythromycin resistance gene (ermE) of Streptomyces erythraeus.
Gene
38:215-226[Medline].
|
| 6.
|
Blanco, G.,
H. Fu,
C. Méndez,
C. Khosla, and J. A. Salas.
1996.
Deciphering the biosynthetic origin of the aglycone of the aureolic acid group of anti-tumor agents.
Chem. Biol.
3:193-196[Medline].
|
| 7.
|
Bullock, W. O.,
J. M. Fernández, and J. N. Short.
1987.
XL1-Blue: a high efficiency plasmid transforming recA Escherichia coli strain with beta-galactosidase selection.
BioTechniques
5:376.
|
| 8.
|
Culham, D. E.,
B. Lasby,
A. G. Marangoni,
J. L. Milner,
B. A. Steer,
R. W. Nues, and J. M. Wood.
1993.
Isolation and sequencing of Escherichia coli gene proP reveals unusual structural features of the osmoregulatory proline/betaine transporter ProP.
J. Mol. Biol.
229:268-276[Medline].
|
| 9.
|
Devereux, J.,
P. Haeberli, and O. Smithies.
1984.
A comprehensive set of sequence analysis programs for the VAX.
Nucleic Acids Res.
12:387-395.
|
| 10.
|
Distler, J.,
A. Ebert,
K. Mansouri,
K. Pissowotzki,
M. Stockmann, and W. Piepersberg.
1987.
Gene cluster for streptomycin biosynthesis in Streptomyces griseus: nucleotide sequence of three genes and analysis of transcriptional activity.
Nucleic Acids Res.
15:8041-8056[Abstract/Free Full Text].
|
| 11.
|
Feitelson, J. S., and D. A. Hopwood.
1983.
Cloning of a Streptomyces gene for an O-methyltransferase involved in antibiotic biosynthesis.
Mol. Gen. Genet.
190:394-398[Medline].
|
| 12.
|
Fernández, E.,
F. Lombó,
C. Méndez, and J. A. Salas.
1996.
An ABC transporter is essential for resistance to the antitumor agent mithramycin in the producer Streptomyces argillaceus.
Mol. Gen. Genet.
251:692-698[Medline].
|
| 13.
|
Fernández, E.,
U. Weißbach,
C. Sánchez Reillo,
A. F. Braña,
C. Méndez,
J. Rohr, and J. A. Salas.
1998.
Identification of two genes from Streptomyces argillaceus encoding two glycosyltransferases involved in transfer of a disaccharide during biosynthesis of the antitumor drug mithramycin.
J. Bacteriol.
180:4929-4937[Abstract/Free Full Text].
|
| 14.
| Fernández-Lozano, M. J. Unpublished
results.
|
| 15.
|
Fernández-Moreno, M. A.,
J. L. Caballero,
D. A. Hopwood, and F. Malpartida.
1991.
The act cluster contains regulatory and antibiotic export genes, direct targets for translational control by the bldA tRNA gene of Streptomyces.
Cell
66:769-780[Medline].
|
| 16.
|
Geistlich, M.,
R. Losick,
J. R. Turner, and N. R. Rao.
1992.
Characterization of a novel regulatory gene governing the expression of a polyketide synthase gene in Streptomyces ambofaciens.
Mol. Microbiol.
6:2019-2029[Medline].
|
| 17.
|
Hopwood, D. A.,
M. J. Bibb,
K. F. Chater,
T. Kieser,
C. J. Bruton,
H. M. Kieser,
D. J. Lydiate,
C. P. Smith,
J. M. Ward, and H. Schrempf.
1985.
Genetic manipulation of Streptomyces. A laboratory manual.
The John Innes Foundation, Norwich, England.
|
| 18.
|
Lawlor, E. J.,
H. A. Baylis, and K. F. Chater.
1987.
Pleiotropical, morphological and antibiotic deficiencies result from mutations in a gene encoding a tRNA-like product in Streptomyces coelicolor A3(2).
Genes Dev.
1:1305-1310[Abstract/Free Full Text].
|
| 19.
|
Leskiw, B. K.,
E. J. Lawlor,
J. M. Fernández-Abalos, and K. F. Chater.
1991.
TTA codons in some genes prevent their expression in a class of developmental, antibiotic-negative, Streptomyces mutants.
Proc. Natl. Acad. Sci. USA
88:184-189[Abstract/Free Full Text].
|
| 20.
|
Lombó, F.,
G. Blanco,
E. Fernández,
C. Méndez, and J. A. Salas.
1996.
Characterization of Streptomyces argillaceus genes encoding a polyketide synthase involved in the biosynthesis of the antitumor mithramycin.
Gene
172:87-91[Medline].
|
| 21.
|
Lombó, F.,
K. Siems,
A. F. Braña,
C. Méndez,
K. Bindseil, and J. A. Salas.
1997.
Cloning and insertional inactivation of Streptomyces argillaceus genes involved in earliest steps of sugar biosynthesis of the antitumor polyketide mithramycin.
J. Bacteriol.
179:3354-3357[Abstract/Free Full Text].
|
| 22.
|
Martinez-Hackert, E., and A. M. Stock.
1997.
The DNA-binding domain of OmpR: crystal structures of a winged helix transcription factor.
Structure
15:109-124.
|
| 23.
|
Mizusawa, S.,
S. Nishimura, and F. Seila.
1986.
Improvement of the dideoxy chain termination method of DNA sequencing by the dideoxy-7-deazaguanosine triphosphate in place of dGTP.
Nucleic Acids Res.
14:1319-1324[Abstract/Free Full Text].
|
| 24.
|
Narva, K. E., and J. S. Feitelson.
1990.
Nucleotide sequence and transcriptional analysis of the redD locus of Streptomyces coelicolor A3(2).
J. Bacteriol.
172:326-333[Abstract/Free Full Text].
|
| 25.
|
Pérez-Llarena, F. J.,
P. Liras,
A. Rodríguez García, and J. F. Martín.
1997.
A regulatory gene (ccaR) required for cephamycin and clavulanic acid production in Streptomyces clavuligerus: amplification results in overproduction of both  -lactam compounds.
J. Bacteriol.
179:2053-2059[Abstract/Free Full Text].
|
| 26.
|
Philipp, W. J.,
S. Poulet,
K. Eiglmeier,
L. Pascopella,
V. Balasubramanian,
B. Heym,
S. Bergh,
B. R. Bloom,
W. R. Jakobs, and S. T. Cole.
1996.
An integrated map of the genome of the tubercle bacillus Mycobacterium tuberculosis H37Rv, and comparison with Mycobacterium leprae.
Proc. Natl. Acad. Sci. USA
93:3132-3137[Abstract/Free Full Text].
|
| 27.
|
Remers, W. A.
1979.
The chemistry of antitumor antibiotics, vol. 1. , p. 133-175.
Wiley-Interscience, New York, N.Y.
|
| 28.
|
Retzlaff, L., and J. Distler.
1995.
The regulator of streptomycin gene expression, StrR, of Streptomyces griseus is a DNA binding activator protein with multiple recognition sites.
Mol. Microbiol.
18:151-162[Medline].
|
| 29.
|
Saint, C. P., and P. Romas.
1996.
4-Methyl phthalate catabolism in Burkholderia (Pseudomonas) cepacia Pc701: a gene encoding a phthalate-specific permease forms part of a novel gene cluster.
Microbiology
142:2407-2418[Abstract/Free Full Text].
|
| 30.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 31.
|
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain- terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467[Abstract/Free Full Text].
|
| 32.
|
Skarbek, J. D., and M. K. Speedie.
1981.
Antitumor antibiotics of the aureolic acid group: chromomycin A3, mithramycin A, and olivomycin A, p. 191-235.
In
A. Aszalos (ed.), Antitumor compounds of natural origin: chemistry and biochemistry, 8th ed., vol. 1. CRC Press, Inc., Boca Raton, Fla.
|
| 33.
|
Stutzman-Engwall, K. J.,
S. L. Otten, and C. R. Hutchinson.
1992.
Regulation of secondary metabolism in Streptomyces spp. and overproduction of daunorubicin in Streptomyces peucetius.
J. Bacteriol.
174:144-154[Abstract/Free Full Text].
|
| 34.
|
Tang, L.,
A. Grimm,
Y. X. Zhang, and C. R. Hutchinson.
1996.
Purification and characterization of the DNA-binding protein DnrI, a transcriptional factor of daunorubicin biosynthesis in Streptomyces peucetius.
Mol. Microbiol.
22:801-813[Medline].
|
| 35.
|
Tatusov, R.,
A. R. Mushegian,
P. Bork,
N. P. Brown,
W. S. Hayes,
M. Borodovsky,
K. E. Rudd, and E. V. Koonin.
1996.
Metabolism and evolution of Haemophilus influenzae deduced from a whole-genome comparison with Escherichia coli.
Curr. Biol.
6:279-291[Medline].
|
| 36.
|
Thompson, C. J.,
T. Kieser,
J. M. Ward, and D. A. Hopwood.
1982.
Physical analysis of antibiotic-resistance genes from Streptomyces and their use in vector construction.
Gene
20:51-62[Medline].
|
| 37.
|
Vara, J.,
M. Lewandowska-Skarbek,
Y.-G. Wang,
S. Donadio, and C. R. Hutchinson.
1989.
Cloning of genes governing the deoxysugar portion of the erythromycin biosynthesis pathway in Saccharopolyspora erythraea (Streptomyces erythreus).
J. Bacteriol.
171:5872-5881[Abstract/Free Full Text].
|
| 38.
|
Vieira, J., and J. Messing.
1991.
New pUC-derived cloning vectors with different selectable markers and DNA replication origins.
Gene
100:189-194[Medline].
|
| 39.
|
Wietzorrek, A., and M. J. Bibb.
1997.
A novel family of proteins that regulates antibiotic production in streptomycetes appears to contain an OmpR-like DNA-binding fold.
Mol. Microbiol.
25:1177-1184[Medline].
|
| 40.
|
Wright, F., and M. J. Bibb.
1992.
Codon usage in the G+C-rich Streptomyces genome.
Gene
113:55-65[Medline].
|
| 41.
|
Ylihonko, K.,
J. Hakala,
S. Jusilaa,
L. Cong, and P. Mäntsälä.
1996.
A gene cluster involved in nogalamycin biosynthesis from Streptomyces nogalater: sequence analysis and complementation of early blocked mutants of the anthracycline pathway.
Mol. Gen. Genet.
251:113-120[Medline].
|
Journal of Bacteriology, January 1999, p. 642-647, Vol. 181, No. 2
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Davidsen, J. M., Townsend, C. A.
(2009). Identification and Characterization of NocR as a Positive Transcriptional Regulator of the {beta}-Lactam Nocardicin A in Nocardia uniformis. J. Bacteriol.
191: 1066-1077
[Abstract]
[Full Text]
-
Chen, Y., Wendt-Pienkowski, E., Shen, B.
(2008). Identification and Utility of FdmR1 as a Streptomyces Antibiotic Regulatory Protein Activator for Fredericamycin Production in Streptomyces griseus ATCC 49344 and Heterologous Hosts. J. Bacteriol.
190: 5587-5596
[Abstract]
[Full Text]
-
Higashi, T., Iwasaki, Y., Ohnishi, Y., Horinouchi, S.
(2007). A-Factor and Phosphate Depletion Signals Are Transmitted to the Grixazone Biosynthesis Genes via the Pathway-Specific Transcriptional Activator GriR. J. Bacteriol.
189: 3515-3524
[Abstract]
[Full Text]
-
Eustaquio, A. S., Li, S.-M., Heide, L.
(2005). NovG, a DNA-binding protein acting as a positive regulator of novobiocin biosynthesis. Microbiology
151: 1949-1961
[Abstract]
[Full Text]
-
Anton, N., Mendes, M. V., Martin, J. F., Aparicio, J. F.
(2004). Identification of PimR as a Positive Regulator of Pimaricin Biosynthesis in Streptomyces natalensis. J. Bacteriol.
186: 2567-2575
[Abstract]
[Full Text]
-
Metsa-Ketela, M., Halo, L., Munukka, E., Hakala, J., Mantsala, P., Ylihonko, K.
(2002). Molecular Evolution of Aromatic Polyketides and Comparative Sequence Analysis of Polyketide Ketosynthase and 16S Ribosomal DNA Genes from Various Streptomyces Species. Appl. Environ. Microbiol.
68: 4472-4479
[Abstract]
[Full Text]
-
Colombo, V., Fernandez-de-Heredia, M., Malpartida, F.
(2001). A polyketide biosynthetic gene cluster from Streptomyces antibioticus includes a LysR-type transcriptional regulator. Microbiology
147: 3083-3092
[Abstract]
[Full Text]
-
Lozano, M. J. F., Remsing, L. L., Quiros, L. M., Brana, A. F., Fernandez, E., Sanchez, C., Mendez, C., Rohr, J., Salas, J. A.
(2000). Characterization of Two Polyketide Methyltransferases Involved in the Biosynthesis of the Antitumor Drug Mithramycin by Streptomyces argillaceus. J. Biol. Chem.
275: 3065-3074
[Abstract]
[Full Text]
Top
Abstract
Introduction
