Previous Article | Next Article 
Journal of Bacteriology, November 1999, p. 6585-6590, Vol. 181, No. 21
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Regulated Antisense RNA Eliminates Alpha-Toxin
Virulence in Staphylococcus aureus Infection
Yinduo
Ji,*
Andrea
Marra,
Martin
Rosenberg, and
Gary
Woodnutt
Department of Microbiology, SmithKline
Beecham Pharmaceuticals Research and Development, Collegeville,
Pennsylvania 19426
Received 23 June 1999/Accepted 20 August 1999
 |
ABSTRACT |
The ability to selectively disrupt gene function remains a critical
element in elucidating information regarding gene essentiality for
bacterial growth and/or pathogenesis. In this study, we adapted a
tet regulatory expression system for use in
Staphylococcus aureus, with the goal of downregulating gene
expression via induction of antisense RNA. We demonstrate that this
system exhibits a 50- to 100-fold dose-dependent level of induction in
bacterial cells grown in culture (i.e., in vitro) and also functions in
mice (i.e., in vivo) following oral administration of inducer. To
determine whether induced antisense RNA could interfere with
chromosomally derived gene expression, we cloned a fragment of the
S. aureus alpha-toxin gene (hla) in antisense
orientation downstream of the tet promoter system and
introduced the construct into S. aureus. Induced antisense
hla RNA downregulated chromosomally derived hla
gene expression in vitro approximately 14-fold. Similarly, induction of
hla antisense RNA in vivo dramatically reduced alpha-toxin expression in two different murine models of S. aureus
infection. Most importantly, this reduction completely eliminated the
lethality of the infection. These results indicate that the
tet regulatory system functions efficiently in S. aureus and induced antisense RNA can effectively downregulate
chromosomal gene expression both in vitro and in vivo.
 |
INTRODUCTION |
Selective disruption and/or
downregulation of gene expression is an important tool for elucidating
information on gene essentiality for bacterial growth or pathogenesis.
This information is particularly useful for validating appropriate
molecular targets for antibiotic discovery. A variety of techniques
have been developed in various bacterial systems to achieve functional
inactivation of gene products (4, 5, 10, 13). Most of these
involve gene knockout methods using point mutation, insertional
inactivation, or deletion (e.g. allelic replacement).
A possible refinement over gene knockout technology has been the
introduction of controlled gene expression systems that allow particular genes to be regulated and thereby functionally analyzed (7, 23). Information is gained by switching off or on gene expression and monitoring the effect as the product titrates down or
up. These systems have the potential to provide more quantitative data
on the functional importance of a gene product to either growth or
virulence. These regulated systems are best described for
Escherichia coli and, more recently, Bacillus
subtilis (7). Moreover, they are now beginning to be
developed for other pathogens (23).
Another effective means of reducing gene expression has been the use of
antisense technology. Antisense methods have been used effectively to
downregulate eukaryotic gene expression in a variety of systems
(1, 3, 6, 19). These methods have not been routinely adapted
for prokaryotes despite the fact that antisense regulation has been
shown to be a natural phenomenon in bacteria (25). This may
be because of the other options available for bacterial systems.
However, recent reports have demonstrated that antisense approaches
using various synthetic oligomers can be used effectively in bacteria
(8, 14, 22, 26).
The gram-positive bacterium Staphylococcus aureus represents
a serious human health threat, causing such varied infections as skin
abscesses, osteomyelitis, endocarditis, septicemia, and pneumonia.
There exist a variety of genetic tools and approaches for generating
and analyzing null mutants in S. aureus (4, 24).
However, a facile system for selectively controlling and downregulating
specific staphylococcal gene products for analysis both in vitro and in
vivo is lacking. The ability to titrate down a gene product either
under culture conditions or in an animal model of infection would
provide a powerful, additional approach for studying gene essentiality
and pathogenesis in this organism.
In this study, we adapted a regulated expression system for use in
S. aureus. We show its utility in regulating the expression of an antisense construct of the staphylococcal alpha-toxin gene (hla) and, in turn, regulating the production of the
alpha-toxin itself. Most importantly, we demonstrate that induced
expression of antisense hla RNA is achieved both in in vitro
culture and in two murine models of staphylococcal infection, and
downregulation of the toxin reverses its lethal phenotype in an
intraperitoneal infection.
 |
MATERIALS AND METHODS |
Bacterial strains and plasmids.
The plasmids used in this
study were pUC19 (27), pE194 (11), pMH109
(12), and pWH353 (kindly provided by W. Hillen, Institut
für Mikrobiologie und Biochemie, Erlangen, Germany). The
bacterial strains used in this study were S. aureus RN4220, a derivative of S. aureus 8325-4 that is able to accept
transformed DNA (18), and S. aureus WCUH29, a
virulent alpha-toxin-producing clinical isolate. S. aureus
strains were cultured in tryptic soy broth (TSB; BBL, Sparks, Md.) or
TSB plus 1.5% Bacto Agar (TSA; Difco, Detroit, Mich.). To maintain
selection of plasmid pYJ90, S. aureus was grown in culture
medium containing erythromycin (Erm; 5 µg/ml). Escherichia
coli DH5-
, used for construction of shuttle vectors, was grown
in Luria-Bertani (LB) broth (BBL) containing chloramphenicol (Cam; 20 µg/ml), Erm (300 µg/ml), or ampicillin (Ap; 100 µg/ml) as appropriate.
Construction of E. coli-S. aureus shuttle vector
pYJ90.
To construct a suitable shuttle vector for this study,
plasmids pUC19 carrying an Apr marker (27) and
pE194 carrying an Ermr marker (11) were each
digested with NdeI, gel purified, ligated together, and
transformed into E. coli DH5-
by electroporation. Transformants were selected on LB agar containing Ap (100 µg/ml) and
Erm (300 µg/ml). Transformants were examined by restriction analysis
to identify an appropriate shuttle plasmid containing both pUC19 and
pE194 fragments. One recombinant, pYJ90, was confirmed by further
restriction enzyme digestion. pYJ90 was then electroporated into
S. aureus RN4220 (15, 18). Transformants were
selected on TSA containing Erm (5 µg/ml). The stability of plasmid
pYJ90 in S. aureus was determined by passaging a culture six
times in medium with antibiotics and analyzing plasmid DNA in the
bacterial culture.
Construction of a tet regulatory system in plasmid
pYJ90.
The ClaI-HindIII fragment
containing the tetR gene (which encodes the tet
repressor), its promoter (PR), and the strong
xyl/tet promoter-operator fusion
(Pxyl/tetO) was excised from plasmid pWH353
(7) and cloned between the ClaI and
HindIII sites in plasmid pBluescript II KS (Stratagene,
La Jolla, Calif.). The resulting plasmid, pYJ101, was digested with
EcoRI and PstI and an
EcoRI-PstI fragment containing a promoterless
cat (chloramphenicol acetyltransferase [CAT]-encoding)
gene followed by a transcriptional terminator (derived from pMH109
(12), and adapted with the appropriate EcoRI and
PstI restriction sites by first moving it into the
EcoRI and BamHI sites of pUC19), was inserted.
This new construct was named pYJ103. pYJ103 was digested with
SalI, and the fragment containing the
tetR/PR/Pxyl/tetO-cat region was gel
purified and cloned into the SalI site pYJ90. The resulting
plasmid, pYJ335, was confirmed by restriction enzyme digestion and DNA
sequencing and then electroporated into S. aureus RN4220.
One of the transformants, YJSB335, was confirmed and used to make phage
lysates by using S. aureus phage
11 (2).
Construction of plasmid pYJ335 containing antisense
hla and sense hla.
A 621-bp hla
fragment carrying 354 bp of N-terminal coding region of the
hla gene and 268 bp 5' to this region was generated by PCR
amplification using primers hlaFor64 (5'
GGGGGGCCCGGGTATGTCTTTTCCTTGTTTCA 3') and
hlaRev684
(5'GGGGGGCCCGGGATCAGGTAGTTGCAACTG 3'), corresponding to nucleotides 64 to 83 and 684 to 701, respectively (9). Boldface nucleotides correspond to the
SmaI restriction enzyme recognition site, and underlined
nucleotides correspond to the hla coding sequence. The
amplified hla fragment contains the hla promoter
region. The PCR product was digested with SmaI, gel
purified, and ligated into the EcoRV site of downstream of the xyl/tetO promoter-operator fusion of pYJ335. The
orientation of the hla insertion was determined by PCR. As
expected, only recombinants containing the hla fragment in
the antisense orientation yielded a PCR product of approximately 800 bp, using primers tetRFor1399 and hlaFor64. In
contrast, only recombinants containing the hla fragment in
the sense orientation produced a PCR product of approximately 800 bp,
using primers tetRFor1399 and hlaRev684 (data not
shown). The resulting plasmids, pYJ318-7 and pYJ318-16, which contained hla in the antisense and sense orientations, respectively,
were electroporated separately into S. aureus. Transformants
were selected by Erm resistance, and plasmids were confirmed by
restriction enzyme digestion. Transformants YJSB318-7 and YJSB318-16
containing antisense hla and sense hla,
respectively, were confirmed and used to make
11 phage lysates.
S. aureus transductions.
The clinical isolate
WCUH29 cannot be transformed directly by electroporation. Therefore,
plasmids pYJ335, pYJ318-7, and pJY318-16 were introduced into this
strain by phage transduction (2). Phage
11 was used to
make phage lysates by infecting S. aureus YJSB335,
YJSB318-7, and YJSB318-16 grown in top agar (TSB containing 0.7% agar
and 5 mM CaCl2). The phage lysates were sterilized by passing each through a 0.45-µm-pore-size filter and titered on S. aureus RN4220. Transductions were performed by incubating
5 × 109 CFU of WCUH29 cells with 100 µl of phage
lysate (109 to 1010 PFU) and 5 mM
CaCl2 at 37°C for 30 min. One milliliter of ice-cold 20 mM sodium citrate was then added to the above mixture to block phage
adsorption. The bacterial cells were centrifuged and resuspended in 500 µl of 20 mM sodium citrate. Transductants were selected on TSB-agar
containing sodium citrate (500 µg/ml) and Erm (5 µg/ml), and
transductants YJ335, YJ318-7, and YJ318-16, containing plasmids pYJ335,
pYJ318-7, and pYJ318-16, respectively, were confirmed by restriction
enzyme digestion.
PCR, RT-PCR, and DNA sequencing techniques.
The 621-bp
hla fragment was generated by PCR using
hla-specific primers. The antisense hla and sense
hla orientations in plasmids pYJ318-7 and pYJ318-16,
respectively, were confirmed by PCR using the plasmid-specific primer
tetRFor1399 (5' CAATACATTGTAGGCTGC 3'),
corresponding to nucleotides 1399 to 1416 and
hla-specific primers hlaRev684 and
hlaFor64. The reaction conditions for all PCRs were 0.2 mM
deoxynucleoside triphosphates, 2.5 mM MgCl2, 50 pmol of
each primer, 1 ng of template DNA, and 2.5 U of Taq polymerase in buffer supplied by the manufacturer (Gibco-BRL, Rockville, Md.). For the antisense hla and sense
hla orientations, the primers were tetRFor1399
plus hlaFor64 and tetRFor1399 plus hlaRev684, respectively, using the same annealing
temperature of 48°C. For reverse transcription (RT)-PCR analysis,
bacterial RNA was isolated from infected tissue samples by using
FastRNA reagents (Bio 101, Vista, Calif.) and treated with RNase-free DNase I (GeneHunter Corporation, Nashville, Tenn.) to remove DNA. Single-stranded cDNA was synthesized by incubating DNase-treated RNA
with reverse transcriptase in reaction buffer containing random hexamer
primers supplied by the manufacturer (Gibco-BRL). After RNase H
treatment, cDNA was used as the template for PCR using the
tetR-cat-specific primers tetRFor1399 and
catRev768 (5' GGCAGGTTAGTGACATTAG 3') and the
hla gene-specific primers hlaFor64 and
hlaRev684. DNA sequencing was performed to further confirm
the tet regulatory elements in pYJ335 and the antisense
hla and sense hla orientations in pYJ318-7 and
pYJ318-16, respectively.
Specific CAT activity assays.
CAT activity was determined
spectrophotometrically as described by Shaw (20), using
kinetic SoFTmax PRO II software (Molecular Devices Corporation,
Sunnyvale, Calif.) to monitor activity. Briefly, S. aureus
YJ335 was grown with shaking in TSB-Erm at 37°C to an A600 of 0.25. The culture was divided, and
different doses (0, 2.5, 25, 250, 500, and 1,000 ng/ml) of tetracycline
(Tc) were added to the cultures. Two milliliters was removed from each
culture 3 h after the addition of Tc for the dose-dependent assay
or after 0, 1, 2, 3, and 4 h following the addition of Tc for the
time course assay. The bacterial cells were harvested by centrifugation and washed once with 25 mM Tris (pH 7.8)-10 mM EDTA buffer. Crude protein extracts were prepared by centrifugation after the bacterial cells had been suspended in 200 µl of the same buffer containing lysostaphin (0.2 mg/ml; Sigma, St. Louis, Mo.) and incubated at 37°C
for 10 min. The total protein concentration was determined by using the
Bio-Rad protein microassay (Bio-Rad Laboratories, Hercules, Calif.).
Specific CAT activity was calculated as the number of units of CAT
activity per milligram of total protein. Experiments were performed in
triplicate at least twice, and similar results were obtained.
Northern blot analysis.
S. aureus YJ318-7 and YJ318-16
were grown in TSB-Erm to an A600 of 0.25 with
and without Tc (250 ng/ml), and total RNA was extracted by using a
Qiagen RNeasy mini protocol kit (Qiagen, Incorporated, Chatsworth,
Calif.). Ten-microgram aliquots of total RNA from YJ318-7 and YJ318-16
grown in the presence and absence of Tc (250 ng/ml) were separated by
electrophoresis on a 1.2% agarose-1.8% formaldehyde gel and blotted
onto a nylon membrane (Boehringer Mannheim Biochemicals, Indianapolis,
Ind.). RNA was cross-linked to the membrane by UV irradiation by using
a UV Stratalinker (Stratagene). Blots were prehybridized and then
hybridized with digoxigenin (DIG)-labeled single-stranded DNA
oligonucleotides in high-sodium dodecyl sulfate (SDS) buffer
(Boehringer Mannheim Biochemicals) at 50°C for 6 h.
Single-stranded DNA oligonucleotides specific hybridization with either
sense hla RNA (5'
GGCCAGGCTAAACCACTTTTGTTAGCACCTTCTTCGCTATAAACTCTATA 3') or
antisense hla RNA (5'
TATAGAGTTTATAGCGAAGAAGGTGCTAACAAAAGTGGTTTAGCCTGGCC 3') were
labeled by 3' tailing DIG-dUTP (Boehringer Mannheim Biochemicals), and
100 pmol of each was used to probe the membranes. The DIG-DNA-RNA hybridization on a nylon membrane was detected with DIG luminescent detection reagents (Boehringer Mannheim Biochemicals) and exposed to
X-ray film.
Western blot analysis.
For preparation of extracellular
protein, Tc was added to 10-ml cultures of S. aureus WCUH29,
YJ318-7, and YJ318-16 to a final concentration of 250 ng/ml and
incubated with shaking at 37°C for 8 h. Supernatants were
collected after centrifugation, transferred into tubes containing an
equal volume of ethanol, and incubated overnight at 4°C.
Extracellular proteins were precipitated by centrifugation at
15,000 × g at 4°C for 30 min. SDS-polyacrylamide gel
electrophoresis (PAGE) and Western blotting methods were performed as
previously described (16). Equal amounts of protein were loaded into each lane of an SDS-12.5% polyacrylamide gel. The primary
antiserum used to detect alpha-toxin was provided by M. Burnham,
SmithKline Beecham Pharmaceuticals. Standard alpha-toxin and
anti-rabbit antibody-alkaline phosphatase conjugate were from Sigma.
Western blots were scanned by using Eagle Eye-II software (Stratagene)
to quantitate protein bands.
Murine hematogenous pyelonephritis and intraperitoneal infection
models.
CD-1 female mice (25 g) obtained from Charles River
Laboratories were used for in vivo testing. S. aureus
WCUH29, YJ335, YJ318-7, and YJ318-16 were harvested from 1 ml of
stationary-phase culture, washed once with 1 ml of phosphate-buffered
saline (PBS), and diluted to an A600 of 0.2. These bacterial suspensions were diluted and plated onto TSB-agar
plates for determination of viable CFU. A total of six mice per group
were infected with approximately 107 CFU of bacteria via an
intravenous injection of 0.2 ml of bacterial suspension into the tail
vein via a tuberculin syringe. Sublethal doses of Tc (0.5 µg/g) and
Erm (5 ng/g) to maintain plasmids were given orally (0.1 ml/mouse) to
infected mice on days 1, 2, and 3 after infection. The mice were
sacrificed by carbon dioxide overdose 2 h after the last dose of
Tc, and kidneys were aseptically removed. The kidneys from three mice
in each group were embedded in O.C.T. compound (Tissue-Tek, Torrance,
Calif.), frozen in liquid nitrogen, and kept at
80°C for
immunostaining. The kidneys from the remaining three mice were cut in
half; one half was snap-frozen in cryovials in liquid nitrogen for
RT-PCR analysis, and the other half was homogenized in 1 ml of PBS for
enumeration of viable bacteria.
For murine intraperitoneal infection, female CD1 mice (10 in each
experimental group) were infected as previously described (14). Briefly, 18-h cultures of S. aureus (about
3 × 109 CFU/ml) were collected by centrifugation at
3,000 × g for 10 min, washed three times with PBS, and
resuspended in PBS, and 0.5-ml aliquots of the bacterial solutions were
injected intraperitoneally. Viable counts were determined by plating
dilutions of cultures on TSB-agar Erm plates.
Immunohistochemistry.
Sections of 8 µm were cut from the
frozen embedded kidney tissue in O.C.T. compound, mounted onto
microslides (selected, precleaned Superfrost Plus; VWR Scientific, West
Chester, Pa.), and fixed with cold methanol. The fixed tissue sections
were washed in PBS and incubated in 5% dry milk-PBS. The tissue
sections were then incubated with specific rabbit anti-alpha-toxin
serum at room temperature for 1 h, washed with 0.1% goat
serum-PBS, and incubated with biotinylated donkey anti-rabbit
antibodies (1:200; Amersham Life Science, Piscataway, N.J.) for 1 h at room temperature. The tissue sections were washed in PBS,
processed with Vectastain ABC reagents (Vector Laboratories,
Burlingame, Calif.), and washed in PBS again, after which the
peroxidase substrate 3,3'-diaminobenzidine (Sigma Fast; Sigma) was
added. The sections were washed with tap water, dehydrated, and mounted
with coverslips.
 |
RESULTS |
Adaptation of the tet regulatory system to S. aureus.
To assess both the function and regulation of the
xyl/tet promoter-operator control system, we fused it to a
cat gene reporter construct on an E. coli-S.
aureus plasmid shuttle vector (Fig. 1) and transferred it into S. aureus (See Materials and Methods for details). The resulting
transformant, YJ335, was used to examine the expression of CAT activity
in response to Tc induction. The results are shown in Fig.
2A. In the absence of Tc, YJ335 showed low basal levels of CAT activity. In contrast, upon addition of Tc to
the culture medium, CAT expression was induced efficiently in a
dose-dependent manner, with maximal activity seen 3 h after induction with 250 ng of Tc per ml. Higher Tc doses resulted in decreased levels of CAT expression, presumably due to the effects of
the antibiotic on bacterial growth. Our results demonstrate that a
strong, dose-dependent induction response can be achieved with this
system in S. aureus.

View larger version (8K):
[in this window]
[in a new window]
|
FIG. 1.
Tc-inducible shuttle vector pYJ335 (see Materials and
Methods for details). pUC19 ori and pE194 ori, origins of replication
from pUC19 and pE194, respectively, allowing plasmid replication in
E. coli and S. aureus hosts. A unique
EcoRV site is positioned downstream from the
xyl/tet promoter and 22 nucleotides upstream of the
translation start point of the cat gene.
|
|

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 2.
Dependence of CAT activity on Tc concentration (A) and
kinetics of Tc induction in S. aureus (B). (A) S. aureus YJ335 was incubated in TSB with 5 ng of Erm per ml to early
log phase, and different doses of Tc were added to aliquoted cultures;
2 ml of each culture was transferred into a new tube, and the cells
were harvested by centrifugation 3 h after the addition of Tc. (B)
Strain YJ335 was incubated to early log phase in TSB, and 250 ng of Tc
per ml was added to the culture; 2-ml aliquots of culture were
collected 0, 1, 2, 3, and 4 h after addition of Tc. Crude protein
preparations were used to analyze CAT activity. Specific CAT activity
is defined as units of CAT activity per milligram of total protein.
|
|
We also examined the time dependence of CAT expression at 250 ng of Tc
per ml. The results (Fig.
2B) indicate that in the
absence of Tc, low
basal expression was maintained over a 3- to
4-h period. In the
presence of Tc, CAT activity increased steadily
and achieved a 50- to
100-fold induction between 1 and 4 h. Apparently
the
tet regulatory system can be used effectively in
S. aureus to regulate expression of a gene placed under its
control.
Induced antisense RNA downregulates gene expression in vitro.
Next, we wanted to use this plasmid based tet regulation
system in S. aureus to induce a specific antisense
transcript and measure its effect on the expression of the cognate gene
located on the staphylococcal chromosome. We chose for this analysis a 621-bp DNA fragment containing a portion of the staphylococcal alpha-toxin gene (hla). This gene was chosen because it is a
known virulence factor (2, 14) and reagents were readily
available for monitoring its expression. The hla fragment
was inserted in each of its orientations (sense and antisense)
downstream from the tet-regulated promoter (Fig. 1). The two
plasmids were introduced separately into S. aureus, thereby
creating the isogenic transformants YJ318-7 (antisense) and YJ318-16
(sense). These strains were used to characterize the production of the
hla fragment transcript in response to Tc and to examine the
effects of this induction on alpha-toxin gene expression driven from
the normal hla chromosomal locus.
First, we examined, by Northern blot analysis, RNA production from both
the sense (YJ318-16) and antisense (YJ318-7) constructs
before and
after induction. The results (Fig.
3A)
show that YJ318-7
selectively produced a major antisense
hla
RNA product in response
to Tc induction (lane 5). Antisense RNA was not
detected in the
absence of induction (lane 6), nor was any sense RNA
produced
with or without Tc (lanes 1 and 2). Correspondingly, the
control
sense construct, YJ318-16, produced sense
hla
fragment transcript
only in response to Tc (lane 3). Again, it appears
that the plasmid-based
regulation system operated effectively in
S. aureus.

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 3.
Northern blot analysis of sense hla and
antisense hla transcription (A). DIG-labeled single-stranded
DNA oligonucleotide probes hybridized specifically with either sense
hla RNA (sense probe) or antisense hla RNA
(antisense probe). Hybridization of the 1.6-kb RNA represents the
hla-cat cotranscripts. Western blot analysis of alpha-toxin
expressed in strain WCUH29 and its isogenic strains with or without Tc
induction (B). Lanes: 1, molecular weight markers (biotinylated
low-molecular-weight SDS-PAGE standards; Bio-Rad) 2, alpha-hemolysin
(Sigma) as positive standard control; 3, proteins from WCUH29 culture
supernatant; 4, proteins from YJ318-16 culture supernatant without
induction; 5, proteins from YJ318-16 culture supernatant with Tc
induction; 6, proteins from YJ318-7 culture supernatant without
induction; 7, proteins from YJ318-7 culture supernatant with Tc
induction.
|
|
Second, we examined the effect of these induced
hla RNA
segments on the expression of endogenous
hla gene product.
The culture
supernatant of YJ318-7 without Tc induction reacted
strongly with
anti-alpha-toxin antisera (Fig.
3B), while YJ318-7,
following
Tc induction, demonstrated a 14-fold-lower reactivity as
measured
by densitometer scanning. In addition, the amount of
alpha-toxin
in the culture supernatant of YJ318-16, with or
without induction,
was similar to that of wild-type WCUH29. These
results demonstrate
the ability of this
tet regulatory
system to efficiently inhibit
gene expression in
S. aureus.
tet-regulated transcription during infection.
We
used a standard murine renal infection model (21) to examine
Tc-induced transcription from the tet regulatory system in
vivo. S. aureus YJ335 carrying CAT expression vector pYJ335 (Fig. 1) was injected (107 CFU) into the mouse tail vein
(see Materials and Methods for details). One day after infection, mice
were either not treated or given Tc orally once a day for 3 days. On
day 3, the kidneys were removed, and the total RNA was prepared and
analyzed by RT-PCR using CAT gene-specific primers. The results (shown
in Fig. 4A) demonstrate the selective
expression of CAT RNA in the infected mouse kidney (lane 3) in response
to Tc induction. No PCR signal was detected in the absence of the RT
reaction (lane 4), which demonstrates the lack of any plasmid DNA
contamination in the RNA sample. Moreover, no signal was detected in
the absence of Tc induction (lanes 1 and 2), thereby confirming that
Tc-induced expression of CAT transcript was achieved in vivo.

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 4.
RT-PCR analysis of transcription of cat (A,
lane 3) and antisense hla (B, lanes 3 and 5) following in
vivo induction with sublethal doses of Tc. The expected sizes of the
RT-PCR products are 1 kb for cat and 620 bp for
hla. Plasmid DNA template was used as a positive control for
the expected PCR product (pYJ335 and pYJ318-7). Negative controls were
samples prepared without RT or template DNA. Marker is the 1-Kb Plus
DNA ladder from Gibco-BRL.
|
|
We repeated this experiment in the same infection model using
S. aureus YJ318-7 carrying the antisense construct of
hla.
The
results (Fig.
4B) again demonstrate selective RT-PCR detection
of
the antisense
hla transcript in the infected mouse kidney
only
in response to Tc induction (lanes 3 and
5).
Induced antisense RNA downregulates gene expression in vivo.
To examine directly the consequences of antisense hla RNA
induction in the murine kidney infection model, we monitored the expression of alpha-toxin in infected kidney tissue by using
immunohistochemical staining (Fig. 5). As
a control, we used wild-type S. aureus carrying the sense
fragment hla expression vector, YJ318-16. Kidneys from mice
infected with YJ318-16 in the presence and in the absence of Tc
induction (Fig. 5C and D, respectively) exhibited strong hla
staining, essentially identical to a wild-type staphylococcal infection
without plasmid (data not shown). Similarly, kidneys infected with
S. aureus carrying antisense hla construct
YJ318-7, in the absence of induction, also showed very strong
hla staining (Fig. 5A). In contrast, kidneys infected with
YJ318-7 following induction of antisense hla RNA showed
little to no staining (Fig. 5B). These results clearly indicate that
tet regulation of the plasmid vector system functions
effectively in vivo and significantly downregulates chromosomally
derived hla gene expression.

View larger version (157K):
[in this window]
[in a new window]
|
FIG. 5.
Immunohistochemical detection of expression of
alpha-toxin after in vivo induction of antisense hla RNA
with sublethal doses of Tc. Sections of the kidneys were from mice
infected with YJ318-7 in the absence (A) and presence (B) of Tc
induction. Sections of the kidneys were from mice infected with
YJ318-16 in the absence (C) and presence (D) of Tc induction.
Magnification, ×400.
|
|
To confirm and extend these results, we examined the effect of
antisense
hla RNA induction in a second standard mouse model
of acute infection. In this case, the mice are infected by the
intraperitoneal route (
14), which results in death within 12
to 24 h. The results (Fig.
6)
indicate that all animals infected
with the control carrying the
hla sense fragment construct, YJ318-16,
died within 24 h of inoculation whether or not they were given
the Tc inducer.
Similarly, all mice infected with
S. aureus carrying
the
antisense construct, YJ318-7, in the absence of Tc inducer
died. In
marked contrast, all 10 mice infected with YJ318-7 and
subject to oral
Tc induction survived throughout the 6-day experiment.
Clearly, Tc
induction of antisense
hla RNA dramatically attenuates
the
virulence and lethal phenotype of the
S. aureus infection.

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 6.
Survival of mice infected intraperitoneally with strains
YJ318-7 (1.4 × 109 CFU) and YJ318-16 (1.5 × 109 CFU) followed by oral induction with sublethal doses of
Tc (YJ318-7 Tc and YJ318-16 Tc) or in the absence of Tc induction
(YJ318-7 and YJ318-16).
|
|
 |
DISCUSSION |
We have adapted the tet-regulated gene expression
system originally developed for controlling expression of heterologous
genes in B. subtilis (7) for use in a pathogenic
strain of S. aureus. The results demonstrate that the
xyl/tet hybrid promoter is functional in S. aureus and can increase expression of a reporter gene (i.e., cat) 50- to 100-fold. The extent of induction is similar to
that seen in B. subtilis (7) and, more recently,
in S. pneumoniae with an optimized plasmid-based promoter
(23). Moreover, we show that in S. aureus, the
induction is titrated in a dose-dependent manner, thereby allowing the
system to be used for evaluating the level of expression required to
achieve gene function and bacterial viability. However, we point out
that the plasmid-based system we describe does exhibit some basal
expression (albeit low [Fig. 2]) in the absence of induction, and
this must be considered when interpreting any titration data obtained.
Because of the strong transcriptional induction achieved with the
system, we examined its utility for producing antisense RNA in an
efficient, regulated manner in order to selectively downregulate
expression of specific chromosomal loci. We used an antisense fragment
of the staphylococcal alpha-toxin gene and demonstrated that the
plasmid-based tet regulatory system can effectively produce
an antisense transcript in response to induction. Importantly, this
induction of antisense RNA was shown to effectively inhibit
(~14-fold) hla expression in vitro. Thus, antisense
regulation could be achieved in S. aureus and, coupled with
a regulated promoter, provides a valuable tool for studying the effects
of disrupting gene function.
We were particularly interested in extending the utility of our system
to the in vivo analyses of staphylococcal gene function. The ability to
examine the effects of downregulating specific bacterial genes in
various animal infection models provides tremendous new scope for
studying genes that may be essential for growth or virulence during
infection. Our data for the murine pyelonephritis model demonstrate
that hla expression (i.e., the production of staphylococcal
alpha-toxin) can be regulated effectively via antisense RNA production.
Direct examination of the infected mouse kidney shows a dramatic
reduction in bacterial foci producing alpha-toxin. The few stained foci
remaining (Fig. 5B) probably result from plasmid loss during the course
of the infection study.
In the murine acute intraperitoneal infection model, we demonstrated
that induction of antisense hla RNA abolished the lethal phenotype caused by expression of the toxin. Others have shown alpha-toxin to be a virulence factor in experimental infections such as
peritonitis (17) and endocarditis (2). Our data
support the importance of this gene product as a pathogene and provide a clear demonstration of the utility of regulated antisense production in vivo for examining virulence factors. By varying the time at which
the antisense RNA is induced (i.e., varying the time of oral Tc
administration), this methodology should allow examination of the
temporal relevance of specific gene products to the early establishment, maintenance, and postsymptomatic periods of the infection process. Thus, the system described should enable a detailed
examination of the function of any staphylococcal gene throughout the
infection process.
 |
ACKNOWLEDGMENTS |
We thank Martin Burnham and Damien McDevitt for many helpful
discussions and suggestions, Martin Burnham for the gift of
anti-alpha-toxin antiserum, and Wolfgang Hillen for the generous gift
of plasmid pWH353. We also thank the SmithKline Beecham Microbiology
sequencing group and Microbiology pathogenesis group for skillful
technical assistance.
This work was funded by the U.S. Defense Advanced Research Projects
Agency (N65236-97-1-5810).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: 1250 South
Collegeville Road, UP1345, Collegeville, PA 19426. Phone: (610)
917-7663. Fax: (610) 917-7901. E-mail:
Yinduo_Ji-1{at}sbphrd.com.
Present address: Protein Design Labs, Fremont, CA 94555.
 |
REFERENCES |
| 1.
|
Agrawal, S.,
Z. Jiang,
Q. Zhao,
D. Shaw,
Q. Cai,
A. Roskey,
L. Channavajjala,
C. Saxinger, and R. Zhang.
1997.
Mixed-backbone oligonucleotides as second generation antisense oligonucleotides: in vitro and in vivo studies.
Proc. Natl. Acad. Sci. USA
94:2620-2625[Abstract/Free Full Text].
|
| 2.
|
Bayerer, A. S.,
M. D. Ramos,
B. E. Menzies,
M. R. Yeaman,
A. J. Shen, and A. L. Cheung.
1997.
Hyperproduction of alpha-toxin by Staphylococcus aureus results in paradoxically reduced virulence in experimental endocarditis a host defense role for platelet microbicidal proteins.
Infect. Immun.
65:4652-4660[Abstract].
|
| 3.
|
Beauregard, M. C.,
E. Pringault,
S. Robine, and D. Louvard.
1995.
Suppression of villin expression by antisense RNA impairs brush border assembly in polarized epithelial intestinal cells.
EMBO J.
14:409-421[Medline].
|
| 4.
|
Cheung, A. L.,
C. Wolz,
M. R. Yeaman, and A. S. Bayer.
1995.
Insertional inactivation of a chromosomal locus that modulates expression of potential virulence determinants in Staphylococcus aureus.
J. Bacteriol.
177:3220-3226[Abstract/Free Full Text].
|
| 5.
|
de Lorenzo, V., and R. N. Timms.
1994.
Analysis and construction of stable phenotypes in gram-negative bacteria with Tn5- and Tn10-derived minitransposons.
Methods Enzymol.
235:386-405[Medline].
|
| 6.
|
Fire, A.,
S. Xu,
M. K. Montgomery,
S. A. Kostas,
S. E. Driver, and C. C. Mello.
1998.
Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans.
Nature
391:806-810[Medline].
|
| 7.
|
Geissendorfer, M., and W. Hillen.
1990.
Regulated expression of heterologous genes in Bacillus subtilis using the Tn10 encoded tet regulatory elements.
Appl. Microbiol. Biotechnol.
33:657-663[Medline].
|
| 8.
|
Good, L., and P. E. Nielsen.
1998.
Antisense inhibition of gene expression in bacteria by PNA targeted to mRNA.
Nat. Biotechnol.
16:355-358[Medline].
|
| 9.
|
Gray, G. S., and M. Kehoe.
1984.
Primary sequence of the alpha-toxin gene from Staphylococcus aureus Wood 46.
Infect. Immun.
46:615-618[Abstract/Free Full Text].
|
| 10.
|
Hensel, M. J. E.,
Shea,
C. Gleeson,
M. D. Jones,
E. Dalton, and D. W. Holden.
1995.
Simultaneous identification of bacterial virulence genes by negative selection.
Science
269:400-403[Abstract/Free Full Text].
|
| 11.
|
Horinouchi, S., and B. Weisblum.
1982.
Nucleotide sequence and functional map of pE194, a plasmid that specifics inducible resistance to macrolide, lincosamide and streptogramin type B antibiotics.
J. Bacteriol.
150:804-814[Abstract/Free Full Text].
|
| 12.
|
Hudson, M. C., and G. C. Stewart.
1986.
Differential utilization of Staphylococus aureus promoter sequences by Escherichia coli and Bacillus subtilis.
Gene
48:93-100[Medline].
|
| 13.
|
Ji, Y. L.,
Mclandsborough,
A. Kondagunta, and P. P. Cleary.
1996.
C5a peptidase alters clearance and trafficking of group A streptococci by infected mice.
Infect. Immun.
64:503-510[Abstract].
|
| 14.
|
Kernodle, D. S.,
R. K. R. Voladri,
B. E. Menzies,
C. C. Hager, and K. M. Edwards.
1997.
Expression of an antisense hla fragment in Staphylococcus aureus reduces alpha-toxin production in vitro and attenuates lethal activity in murine model.
Infect. Immun.
65:179-184[Abstract].
|
| 15.
|
Kraemer, G. R., and J. J. Iacmdolo.
1990.
High-frequency transformation of Staphylococcus aureus by electroporation.
Curr. Microbiol.
21:373-376.
|
| 16.
|
Laemmli, U. K.
1970.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
227:680-685[Medline].
|
| 17.
|
Menzies, B. E., and D. S. Kernodle.
1994.
Site-directed mutagenesis of the alpha-toxin gene of Staphylococcus aureus: role of histidines in toxin activity in vitro and in a murine model.
Infect. Immun.
62:1843-1847[Abstract/Free Full Text].
|
| 18.
|
Novick, R. P.
1990.
The staphylococcus as a molecular genetic system, p. 1-40.
In
R. P. Novick (ed.), Molecular biology of the staphylococci. VCH Publishers, New York, N.Y
|
| 19.
|
Ottavio, L.,
O. Sthandier,
L. Ricci,
C. Passananti, and P. Amati.
1992.
Constitutive synthesis of polyoma antisense RNA renders cells immune to virus infection.
Virology
189:812-816[Medline].
|
| 20.
|
Shaw, W. V.
1975.
Chloramphenicol acetyltransferase from chloramphenicol resistant bacteria.
Methods Enzymol.
43:737-755[Medline].
|
| 21.
|
Skerrett, S. J.,
R. A. Schmidt, and T. R. Martin.
1989.
Impaired clearance of aerosolized Legionella pneumophila in corticosteroid-treated rats: a model of legionnaires' disease in the compromised host.
J. Infect. Dis.
160:261-273[Medline].
|
| 22.
|
Soderbom, F., and E. G. H. Wagner.
1998.
Degradation pathway of CopA, the antisense RNA that controls replication of plasmid R1.
Microbiology
144:1907-1917[Abstract/Free Full Text].
|
| 23.
|
Stieger, M.,
B. Wohlgensinger,
M. Kamber,
R. Lutz, and W. Keck.
1999.
Integrational plasmids for the tetracycline-regulated expression of genes in Streptococcus pneumoniae.
Gene
226:243-251[Medline].
|
| 24.
|
von Eiff, C.,
C. Heilmann,
R. A. Proctor,
C. Woltz,
G. Petters, and F. Gotz.
1997.
A site-directed Staphylococcus aureus hemB mutant is a small-colony variant which persists intracellularly.
J. Bacteriol.
179:4706-4712[Abstract/Free Full Text].
|
| 25.
|
Wagner, E. G. H., and R. W. Simons.
1994.
Antisense RNA control in bacteria, phages, and plasmids.
Annu. Rev. Microbiol.
48:717-742.
|
| 26.
|
Wilson, T.,
G. W. deLisle,
J. A. Marcinkeviciene,
J. S. Blanchard, and D. M. Collins.
1998.
Antisense RNA to ahpC, an oxidative stress defence gene involved in isoniazid resistance indicates that AhpC of Mycobacterium bovis has virulence properties.
Microbiology
144:2687-2695[Abstract/Free Full Text].
|
| 27.
|
Yanisch-Perron, C.,
J. Vieira, and J. Messing.
1985.
Improved m13 phage cloning vectors and host strains: nucleotide sequences of the m13mp18 and pUC19 vectors.
Gene
33:103-119[Medline].
|
Journal of Bacteriology, November 1999, p. 6585-6590, Vol. 181, No. 21
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Sastalla, I., Chim, K., Cheung, G. Y. C., Pomerantsev, A. P., Leppla, S. H.
(2009). Codon-Optimized Fluorescent Proteins Designed for Expression in Low-GC Gram-Positive Bacteria. Appl. Environ. Microbiol.
75: 2099-2110
[Abstract]
[Full Text]
-
Liang, X., Yan, M., Ji, Y.
(2009). The H35A Mutated Alpha-Toxin Interferes with Cytotoxicity of Staphylococcal Alpha-Toxin. Infect. Immun.
77: 977-983
[Abstract]
[Full Text]
-
Yarovinsky, T. O., Monick, M. M., Husmann, M., Hunninghake, G. W.
(2008). Interferons Increase Cell Resistance to Staphylococcal Alpha-Toxin. Infect. Immun.
76: 571-577
[Abstract]
[Full Text]
-
Kedar, G. C., Brown-Driver, V., Reyes, D. R., Hilgers, M. T., Stidham, M. A., Shaw, K. J., Finn, J., Haselbeck, R. J.
(2007). Evaluation of the metS and murB Loci for Antibiotic Discovery Using Targeted Antisense RNA Expression Analysis in Bacillus anthracis. Antimicrob. Agents Chemother.
51: 1708-1718
[Abstract]
[Full Text]
-
Liang, X., Yu, C., Sun, J., Liu, H., Landwehr, C., Holmes, D., Ji, Y.
(2006). Inactivation of a Two-Component Signal Transduction System, SaeRS, Eliminates Adherence and Attenuates Virulence of Staphylococcus aureus.. Infect. Immun.
74: 4655-4665
[Abstract]
[Full Text]
-
Dubytska, L., Godfrey, H. P., Cabello, F. C.
(2006). Borrelia burgdorferi ftsZ Plays a Role in Cell Division.. J. Bacteriol.
188: 1969-1978
[Abstract]
[Full Text]
-
Pomerantsev, A. P., Sitaraman, R., Galloway, C. R., Kivovich, V., Leppla, S. H.
(2006). Genome Engineering in Bacillus anthracis Using Cre Recombinase. Infect. Immun.
74: 682-693
[Abstract]
[Full Text]
-
Sun, J., Zheng, L., Landwehr, C., Yang, J., Ji, Y.
(2005). Identification of a Novel Essential Two-Component Signal Transduction System, YhcSR, in Staphylococcus aureus. J. Bacteriol.
187: 7876-7880
[Abstract]
[Full Text]
-
Bertram, R., Kostner, M., Muller, J., Ramos, J. V., Hillen, W.
(2005). Integrative elements for Bacillus subtilis yielding tetracycline-dependent growth phenotypes. Nucleic Acids Res
33: e153-e153
[Abstract]
[Full Text]
-
Liang, X., Zheng, L., Landwehr, C., Lunsford, D., Holmes, D., Ji, Y.
(2005). Global Regulation of Gene Expression by ArlRS, a Two-Component Signal Transduction Regulatory System of Staphylococcus aureus. J. Bacteriol.
187: 5486-5492
[Abstract]
[Full Text]
-
Wang, B., Kuramitsu, H. K.
(2005). Inducible Antisense RNA Expression in the Characterization of Gene Functions in Streptococcus mutans. Infect. Immun.
73: 3568-3576
[Abstract]
[Full Text]
-
Kamionka, A., Bertram, R., Hillen, W.
(2005). Tetracycline-Dependent Conditional Gene Knockout in Bacillus subtilis. Appl. Environ. Microbiol.
71: 728-733
[Abstract]
[Full Text]
-
Blokpoel, M. C. J., Murphy, H. N., O'Toole, R., Wiles, S., Runn, E. S. C., Stewart, G. R., Young, D. B., Robertson, B. D.
(2005). Tetracycline-inducible gene regulation in mycobacteria. Nucleic Acids Res
33: e22-e22
[Abstract]
[Full Text]
-
Chen, G., Patten, C. L., Schellhorn, H. E.
(2003). Controlled Expression of an rpoS Antisense RNA Can Inhibit RpoS Function in Escherichia coli. Antimicrob. Agents Chemother.
47: 3485-3493
[Abstract]
[Full Text]
-
Pomerantsev, A. P., Kalnin, K. V., Osorio, M., Leppla, S. H.
(2003). Phosphatidylcholine-Specific Phospholipase C and Sphingomyelinase Activities in Bacteria of the Bacillus cereus Group. Infect. Immun.
71: 6591-6606
[Abstract]
[Full Text]
-
Weichhart, T., Horky, M., Sollner, J., Gangl, S., Henics, T., Nagy, E., Meinke, A., von Gabain, A., Fraser, C. M., Gill, S. R., Hafner, M., von Ahsen, U.
(2003). Functional Selection of Vaccine Candidate Peptides from Staphylococcus aureus Whole-Genome Expression Libraries In Vitro. Infect. Immun.
71: 4633-4641
[Abstract]
[Full Text]
-
Schofield, D. A., Westwater, C., Hoel, B. D., Werner, P. A., Norris, J. S., Schmidt, M. G.
(2003). Development of a Thermally Regulated Broad-Spectrum Promoter System for Use in Pathogenic Gram-Positive Species. Appl. Environ. Microbiol.
69: 3385-3392
[Abstract]
[Full Text]
-
Bateman, B. T., Donegan, N. P., Jarry, T. M., Palma, M., Cheung, A. L.
(2001). Evaluation of a Tetracycline-Inducible Promoter in Staphylococcus aureus In Vitro and In Vivo and Its Application in Demonstrating the Role of sigB in Microcolony Formation. Infect. Immun.
69: 7851-7857
[Abstract]
[Full Text]
-
Kielian, T., Cheung, A., Hickey, W. F.
(2001). Diminished Virulence of an Alpha-Toxin Mutant of Staphylococcus aureus in Experimental Brain Abscesses. Infect. Immun.
69: 6902-6911
[Abstract]
[Full Text]
-
Ji, Y., Zhang, B., Van, S. F., Horn, , Warren, P., Woodnutt, G., Burnham, M. K. R., Rosenberg, M.
(2001). Identification of Critical Staphylococcal Genes Using Conditional Phenotypes Generated by Antisense RNA. Science
293: 2266-2269
[Abstract]
[Full Text]
-
Morrissey, J. A., Cockayne, A., Hill, P. J., Williams, P.
(2000). Molecular Cloning and Analysis of a Putative Siderophore ABC Transporter from Staphylococcus aureus. Infect. Immun.
68: 6281-6288
[Abstract]
[Full Text]