Previous Article | Next Article ![]()
Journal of Bacteriology, November 1999, p. 6779-6787, Vol. 181, No. 21
Tufts University School of Medicine and
Division of Geographic Medicine and Infectious Diseases, Tupper
Research Institute, Boston, Massachusetts 02111
Received 11 May 1999/Accepted 30 August 1999
CTX Cholera is a severe, infectious
diarrheal disease caused by the gram-negative bacterium Vibrio
cholerae. The principal virulence factor of V. cholerae
is cholera toxin (CT), a potent, A-B-type exotoxin that ADP-ribosylates
proteins within intoxicated intestinal epithelial cells
(19). The CT produced by V. cholerae during the
organism's colonization of its host's small intestine accounts for a
majority of the symptoms that characterize the disease process (11). In 1996, Waldor and Mekalanos discovered that the
genes encoding CT (the operon ctxAB) are not integral
components of the V. cholerae genome, but instead are
elements of the genome of a filamentous bacteriophage, CTX Integration of the CTX V. cholerae strains of the classical biotype, which were the
dominant cause of epidemic cholera until 1961 when they were replaced
by El Tor strains, contain a more complex arrangement of CTX The CTX
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
The Vibrio cholerae O139 Calcutta
Bacteriophage CTX
Is Infectious and Encodes a Novel
Repressor
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
is a lysogenic, filamentous bacteriophage. Its genome
includes the genes encoding cholera toxin (ctxAB), one of
the principal virulence factors of Vibrio cholerae;
consequently, nonpathogenic strains of V. cholerae can be
converted into toxigenic strains by CTX
infection. O139 Calcutta
strains of V. cholerae, which were linked to cholera
outbreaks in Calcutta, India, in 1996, are novel pathogenic strains
that carry two distinct CTX prophages integrated in tandem:
CTXET, the prophage previously characterized within El Tor
strains, and a new CTX Calcutta prophage (CTXcalc). We
found that the CTXcalc prophage gives rise to infectious
virions; thus, CTXET
is no longer the only known vector
for transmission of ctxAB. The most functionally
significant differences between the nucleotide sequences of
CTXcalc
and CTXET
are located within the
phages' repressor genes (rstRcalc and
rstRET, respectively) and their RstR operators.
RstRcalc is a novel, allele-specific repressor that
regulates replication of CTXcalc
by inhibiting the
activity of the rstAcalc promoter.
RstRcalc has no inhibitory effect upon the classical and El
Tor rstA promoters, which are instead regulated by their
cognate RstRs. Consequently, production of RstRcalc renders
a CTXcalc lysogen immune to superinfection by
CTXcalc
but susceptible (heteroimmune) to infection by
CTXET
. Analysis of the prophage arrays generated by
sequentially integrated CTX phages revealed that pathogenic V. cholerae O139 Calcutta probably arose via infection of an O139
CTXET
lysogen by CTXcalc
.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
, that
specifically infects V. cholerae (22). Infection
of V. cholerae by CTX
is frequently followed by
integration of the phage genome into the V. cholerae genome,
yielding a stable lysogen. Like the filamentous phages of
Escherichia coli, CTX
can also replicate as a plasmid,
and it does so in bacterial strains lacking appropriate integration sites; however, most if not all natural isolates of V. cholerae containing ctxAB contain integrated phage DNA
(13).
genome is site specific, but the integration
sites and the prophage arrays they contain differ between the two
biotypes of V. cholerae O1. Within El Tor biotype strains, which have been used for most analyses of phage genes, CTX prophages are found at a chromosomal site known as attRS
(16). Integration of CTX
DNA into attRS occurs
via recombination between an 18-bp sequence (originally designated the
end repeat [ER]) in the phage genome and a nearly identical sequence
in attRS (16). Some El Tor strains contain a
single CTX prophage, while many others contain several in tandem
(13). The length of this prophage array can fluctuate
(generally expanding) both during the course of an infection and within
laboratory cultures, in response to the bacterium's environment
(6, 13). We have found that the CTX prophages in El Tor
strains generally give rise to infectious phage particles (10).
genes.
Classical strains have two integration sites, each of which contains a
single CTX prophage (13). One site is identical to the
attRS integration site found in El Tor strains. The second site has not been well characterized, but it has been localized to a
different chromosome than attRS (21).
Surprisingly, neither prophage within classical strains apparently
gives rise to phage particles (unpublished data). In addition, the DNA
of CTX
derived from El Tor strains does not integrate following
CTX
infection of classical strains. Instead, phage DNA replicates as
a plasmid in classical strains, rather than recombining into either of
the two classical integration sites (22).
genome is composed of two regions (Fig.
1) (6, 16). The core
region contains the genes encoding CT and genes required for phage morphogenesis, including genes that are thought to
encode major and minor phage coat proteins and a protein that aids in
phage assembly and secretion (24). Some of these
morphogenesis genes are similar to genes of E. coli
filamentous phages, such as M13 and fd (22). In contrast,
the three genes of the other CTX
region, RS2, are not similar to
those of E. coli filamentous phages. Their products control
phage replication and site-specific integration (16, 23).
RstA is required for phage DNA replication, RstB is required for
site-specific integration, and RstR is a repressor of rstA
expression (9, 23). RS2 also contains two intergenic
regions: ig-1 and ig-2. Ig-2 appears to encompass the rstA
promoter and the RstR operator; no role has yet been established for
ig-1. These three genes and the intergenic regions are also components
of a related genetic element, RS1, which is found adjacent to CTX
prophages in many V. cholerae strains (23).

View larger version (65K):
[in a new window]
FIG. 1.
Structure and sequence of CTX prophages within
AS207, an O139 Calcutta strain of V. cholerae. (A) Within
the AS207 chromosome, an RS1 element and a CTXET prophage
are followed by two CTXcalc prophages (shown in light
grey). The Calcutta prophage is structurally similar to the previously
described CTX prophages within El Tor and classical strains, which
contain two major domains known as RS2 and core. RS2 contains three
genes (rstA, rstB, and rstR) whose
transcriptional orientation is indicated by the arrows. The black
triangles represent attRS-ER sequences. (B) Alignment of the
nucleotide sequences of rstR, ig-2, and parts of
rstA and ig-1 from Calcutta, El Tor, and classical
prophages. The arrows underneath the sequences depict the ORFs that
encode the three variants of RstR.
We recently performed a detailed comparison of the RS2 regions from
classical and El Tor CTX prophages (9). We found that rstB and the coding sequence of rstA are highly
conserved between the biotypes (94% nucleotide identity), but that
rstR and ig-2 (the rstA promoter) sequences
diverge considerably (44 and 61% nucleotide identity, respectively).
Due to the variations in the sequences and binding sites of both the
repressor proteins, each RstR is a biotype-specific repressor of its
cognate rstA (9). That is, expression of the
classical rstA (rstAclass) reporter
construct rstAclass-lacZ is repressed
by classical, but not El Tor, RstR, and similarly, expression of the El
Tor reporter construct rstAET-lacZ is
repressed by El Tor, but not classical, RstR. This repression allows
integrated phages to inhibit replication of newly infecting phages of
the same biotype, thereby conferring immunity to secondary infection.
However, the production of RstRclass by the prophages
within classical strains of V. cholerae does not prevent
infection of these strains by a Kn-marked El Tor CTX
, suggesting
that classical CTX
lysogens are heteroimmune to the El Tor CTX
(9).
Until 1997, only these two forms, El Tor and classical, of CTX
prophages had been identified. However, analyses in 1997 of novel O139
strains responsible for severe outbreaks of cholera in Calcutta, India,
revealed that they contained prophages with atypical restriction
endonuclease sites (3, 20). We reported previously that
these Calcutta strains contain sequences within RS2 quite dissimilar to
both the classical and El Tor RS2s (8). In this study, we
present further analyses of the Calcutta CTX prophage, especially of
its RS2 domain. We show that RstRcalc, despite a size and
structure dramatically different from previously described repressors,
also functions as an allele-specific repressor, capable of repressing
rstAcalc expression. In addition, we demonstrate
that, unlike the classical prophages, the Calcutta prophage generates
infectious phage particles. Thus, CTXcalc
, as well as
the El Tor CTX
(denoted here as CTXET
but in earlier
works simply as CTX
), can transmit ctxAB to nonpathogenic
strains. Lysogens of CTXcalc
have immunity to
superinfection with CTXcalc
, similar to the immunity
provoked by CTXET
. Finally, we have used
CTXcalc
and CTXET
to investigate the
potential genesis of multiply lysogenized V. cholerae
strains, such as those identified in Calcutta.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Nucleotide sequence of the CTXcalc prophage RS2 region. RS2 from the CTXcalc prophage was amplified from strain AS207 using PCR. In this PCR, a forward primer within ctxB (5' GCGATTGAAAGGATGAAGGATAC 3') and a reverse primer within cep (5' AACCCCGAGTGAAAGCGTG 3') allows amplification of the CTXcalc prophage RS2 region from strains such as AS207, which contain Calcutta prophages downstream of a single El Tor prophage (Fig. 1) (8). This PCR product was cloned into pCR2.1 (Invitrogen, Carlsbad, Calif.) to generate pHK268, which was used as a template for dye terminator cycle sequencing, using an Applied Biosystems 373A DNA sequencer. The BLAST programs (1) were used to compare the Calcutta RS2 nucleotide sequence to sequences in the GenBank databases. Potential repressor and helix-turn-helix (hth) DNA binding domains were evaluated by using the matrix of Dodd and Egan (4) and the motif analysis program fingerPRINTScan (5).
Bacterial strains and culture conditions.
Bacterial strains
and plasmids used in this study are described within Table
1. All bacteria were cultured in
Luria-Bertani broth (14) at 37°C unless otherwise noted.
Antibiotics were used at the following concentrations: ampicillin
(AMP), 50 µg/ml (V. cholerae); AMP, 100 µg/ml (E. coli); KAN, 50 µg/ml; streptomycin (STR), 200 µg/ml;
chloramphenicol (CMP), 15 µg/ml) (E. coli). Arabinose
(ARA)-induced cultures contained 0.05% ARA, and sucrose-resistant (Scr) clones were selected on 10% sucrose.
|
Plasmid and strain construction. pBD40, which contains an rstAcalc-lacZ fusion, was constructed by first amplifying the rstAcalc promoter and part of the rstAcalc coding sequence with primers rstAcalc proF (5' GATGTTTGTTTTGGTCTCGATTACCG 3') and rstA proR (5' TGAAGCATAAGGAACCGACC 3'). Next, the PCR product was cloned into the TA cloning vector pCRII-TOPO (Invitrogen). An XbaI/HindIII fragment containing the insert was then ligated to XbaI/HindIII-digested pCB192 (18) to generate pBD40. To construct pBD87, a PCR product containing rstRcalc was first amplified with primers rstR-11 (5' AATAGGGCTTTACGGAATC 3') and rstR-10 (5' TGTTTGGAAATCAAGAGAGG 3'). Following subcloning of this product into pCRII-TOPO, a KpnI/XbaI fragment containing the insert was ligated into KpnI/XbaI-digested pBAD33 (7).
AS207 CTXcalc::Kn was made from AS207 with an allele exchange vector derived from the temperature-sensitive, sacB+, counterselectable plasmid pCACTUS. This allele exchange vector, pHK260, was constructed by ligating the SphI/BglII fragment of pCTXET-Kn (22), which spans the Knr cassette, to SphI/BglII-digested pCACTUS. Following electroporation of AS207 with pHK260, plasmid integrants were isolated at 39°C. KAN-resistant colonies were subsequently screened for resistance to sucrose, which results from recombination and excision of the vector sequences. Sucrose- and KAN-resistant colonies were screened by Southern blotting to ascertain which ctxAB gene pair(s) had been replaced by the Knr cassette. In AS207 CTXcalc::Kn, the ctxAB gene pairs of both CTXcalc prophages were replaced. In addition, 408 bp of the Calcutta ig-1 were replaced by El Tor ig-1 sequences, which were present within the targeting vector. CTXcalc-Kn
produced
by AS207 CTXcalc::Kn contains only Calcutta
sequences for rstR and ig-2 and consequently is expected to
have the same replicative and repressive properties as
CTXcalc
. As we have not yet generated a marked version
of CTXcalc
containing only ig-1calc, we used
this hybrid CTXcalc-Kn
in experiments requiring a
selectable Calcutta phage.
Cell-free supernatant from an AS207 CTXcalc::Kn
culture was used to transduce O395 to KAN resistance.
pCTXcalc-Kn was then purified from these KAN-resistant O395
cells. Its structure was confirmed by restriction mapping and by
sequencing of the ig-1 region. pCTXcalc-Ap was constructed
by ligating the XbaI fragment of pCTXcalc-Kn
(which lacks only the Knr cassette) to
XbaI-digested pGP704 (17). pCTXET-Ap
is an equivalent plasmid constructed from pCTXET-Kn and
pGP704; pGP704 has the same orientation, relative to the CTX
genes,
in pCTXcalc-Ap and pCTXET-Ap.
Phage transduction assays.
To transfer
CTXcalc-Kn
from AS207 CTXcalc::Kn
to O395, 50 µl of agglutinated O395 (grown at 30°C to induce
expression of the CTX
receptor, TCP [22]) was mixed
with 50 µl of filtered supernatant from a log-phase culture of AS207
CTXcalc::Kn. The mixture was shaken gently at
room temperature for 20 min, and transductants were selected on
Luria-Bertani plates containing KAN. In order to transfer phages to
O395 in the absence of antibiotic selection, 1 µl of agglutinated
O395 was mixed with 1.5 ml of filtered log-phase-donor (e.g., AS207)
supernatant. The mixture was grown overnight at 30°C, and phage
transfer was subsequently detected by Southern blotting of plasmid DNA
prepared from the culture.
Molecular biology methods. Southern hybridization was carried out using horseradish peroxidase-labelled DNA probes, which were prepared and hybridized using the ECL direct nucleic acid labelling and detection system (Amersham Pharmacia, Little Chalfont, Buckinghamshire, England) according to the manufacturer's instructions. The rstRcalc probe was a PCR product amplified with the primers rstR-10 and rstR-11; the rstRET probe was a PCR product amplified with the primers rstR-3 and rstR-8 (9). The PCR primers used for analysis of pCTX integration sites were TLCF1 (5' TGTCGGAGCTGCTTGGATTAAG 3') and RstR Rev (5' CGACCAAGCAAGATAATCGAC 3'). Other techniques were performed using standard protocols (2).
Nucleotide sequence accession number.
The sequence of the
CTXcalc
RS2 region has been assigned GenBank accession
no. AF110029.
| |
RESULTS |
|---|
|
|
|---|
Structure and sequence of CTX prophages within Calcutta strains of V. cholerae. The O139 strains of V. cholerae that emerged as a cause of widespread disease in Calcutta in 1996 were found by restriction mapping to contain two tandemly arranged copies of a novel CTX prophage (3, 8, 20). These prophages were integrated into the chromosome immediately downstream of an El Tor RS1 element and an El Tor CTX prophage (Fig. 1A). In order to sequence the RS2 region of the Calcutta prophage, we amplified and cloned a PCR product spanning this region from AS207, a representative O139 Calcutta strain (8). Comparison of the putative rstR and ig-2 from the Calcutta prophage with sequences from El Tor and classical prophages revealed striking differences (Fig. 1B). In contrast to rstA and subregions of ig-1, which are highly conserved among the three prophages, the putative Calcutta rstR and ig-2 share no extended sequence identity with the other prophages. In addition, the longest open reading frame (ORF) found within the rstR region of the Calcutta prophage is predicted to encode a protein that is significantly shorter (59 amino acids) than the El Tor and classical RstRs (113 and 112 amino acids, respectively). BLAST searches revealed no significant homology between the Calcutta rstR region and the sequences within the GenBank database, either at the nucleotide or amino acid level. In contrast, both RstRET and RstRclass show sequence similarity to a number of bacteriophage repressors (9), and both are predicted by the Dodd and Egan matrix to contain hth DNA binding motifs that start near their amino termini (4). We could not identify a similar hth domain within RstRcalc with the Dodd and Egan matrix. However, the protein motif analysis program fingerPRINTScan did identify RstRcalc as a repressor containing an hth DNA binding domain (hthrepressr fingerprint), but only if the stringency of analysis was reduced from the default value of 15% to 12%. Unlike in RstRET and RstRclass, the hth motif in RstRcalc is found near the carboxyl terminus of the protein.
Allele-specific repression of rstAcalc by
RstRcalc.
We have previously shown that the different
RstRs expressed within classical and El Tor CTX
lysogens repress
rstA-lacZ reporters in a biotype-specific manner
(9). To assess whether Calcutta strains similarly
encode a repressor specific for the novel
rstAcalc promoter sequence, we coexpressed
the putative RstRcalc with a panel of rstA-lacZ
reporters in an E. coli K-12 strain, CC118 (12).
In addition, each reporter,
rstAET-lacZ,
rstAclass-lacZ, and
rstAcalc-lacZ, was coexpressed in
CC118 with RstRET and RstRclass. Production of
the RstRs was controlled by an ARA-inducible promoter (pBAD)
(7) as described previously (9). We found that
-galactosidase activity produced from
rstAcalc-lacZ was consistently high
when this reporter was maintained alone, maintained with a pBAD33
vector control, or maintained with RstRET- and
RstRclass-producing plasmids, both under inducing and
noninducing conditions (Table 2 and data
not shown). However, rstAcalc-lacZ
expression decreased 50-fold when production of RstRcalc
was induced with ARA (Table 2). Thus, the 59-amino-acid polypeptide encoded by the ORF underlined in Fig. 1B is sufficient to repress rstAcalc expression. No additional repression
was observed with a larger repressor construct containing an additional
ORF found downstream of rstRcalc, nor was
rstAcalc-lacZ expression repressed by
the downstream ORF alone (data not shown). The RstRcalc
repressor activity was specific; it did not reduce the
-galactosidase activity produced either from
rstAclass-lacZ or
rstRET-lacZ (Table 2). Specific
repression of the reporter constructs was also observed when the
reporter plasmids were transformed into V. cholerae strains
producing various repressors from their endogenous prophages (data not
shown). Thus, endogenous levels of RstR are sufficient to repress
expression of RstA; repression is not an artifact of overexpressing the
repressors in E. coli.
|
The CTXcalc prophage encodes an infectious
bacteriophage.
We next ascertained whether the CTXcalc
prophage gives rise to transmissible bacteriophage particles, or if,
like the classical CTX prophage, it lacks the capacity for independent
replication. We hypothesized that CTXcalc
transmission
to the classical strain O395 would result in production of
pCTXcalc (the plasmid, or replicative form [RF], of
CTXcalc
) as occurs following the infection of O395 with
CTXET
(22). Therefore, we incubated cell-free
supernatants from AS207 with O395, then prepared plasmid DNA from
potentially infected cells and used Southern hybridization analysis to
assay for transmission of CTXcalc
from AS207
supernatants to O395. Southern blots were probed sequentially with
rstRcalc and then with
rstRET. Control experiments revealed that no
rstRcalc-hybridizing species could be detected
in plasmid DNA prepared from O395 cultures (Fig.
2). However, an
rstRcalc-hybridizing plasmid species was
detected within plasmid DNA isolated from O395 cultured at 30°C in
the presence of filtered supernatants from AS207. An equally sized
rstRcalc-hybridizing species was detected in
plasmid DNA prepared from AS207. Restriction digests revealed these
plasmids to be the RF of CTXcalc, which probably forms in
AS207 as a replication intermediate during CTXcalc
production. Treatment of the AS207 cell-free culture supernatant with
DNase I did not prevent the transfer of pCTXcalc to O395
from AS207 supernatants (data not shown), thereby suggesting that AS207
gives rise to a bacteriophage, CTXcalc
, that is
competent to infect and replicate within O395. Rehybridization of these
Southern blots with an rstRET probe revealed
that AS207 also is capable of transfer of CTXET
, at a
level matching or exceeding that of an El Tor strain with two tandemly
arranged KAN-marked El Tor CTX prophages (2740-80 [CTXET-Kn]) (Fig. 2). Thus, the Calcutta strain AS207 of
V. cholerae can give rise to two distinct infectious
bacteriophages: CTXcalc
and CTXET
.
Consequently, CTXET
is not the sole phage capable of
conveying the genes encoding CT to nonpathogenic V. cholerae.
|
(pCTXcalc-Kn) into
CTX
strains yielded Knr transformants that
produce CTXcalc-Kn
particles (data not shown). This
result confirmis that CTXcalc
is infectious; in
addition, it demonstrates that the production of infectious
CTXcalc
particles by AS207 and other Calcutta strains is
not dependent upon the CTXET prophage also present in these strains.
Immunity and heteroimmunity of a CTXcalc-Kn
lysogen.
We previously found that strains harboring a
CTXET prophage are significantly resistant to further
infection with CTXET-Kn
. This immunity results from the
repression of rstAET expression by
RstRET, as RstA is essential for phage replication. The
data presented above indicate that RstRET does not repress
RstAcalc production, and similarly, RstRcalc
does not repress RstAET production (Table 2). Therefore we
tested, with marked CTXcalc
derivatives, whether a
lysogen harboring a CTXcalc prophage is immune to
CTXcalc
superinfection and heteroimmune to
CTXET
infection. Since immunity results from inhibition
of phage replication following infection rather than from inhibition of
the initial steps of infection, and since El Tor strains cannot be
efficiently infected with CTXcalc
in vitro (due to lack
of expression of TCP, the phage receptor), we developed a
transformation assay to study the immunity properties of the
CTXcalc prophage. For these assays, 2740-80, an El Tor,
CTX
, attRS+ strain, and 2740-80 lysogens of marked CTXcalc
and CTXET
were
electroporated with differentially marked CTXcalc or
CTXET plasmid DNA.
variants. Thus, pCTXcalc-Ap accounted for 58% of
all 2740-80 transformants, but only 19% of
2740-80(CTXcalc-Kn) transformants. Similarly,
pCTXET-Ap accounted for 42% of all 2740-80 transformants,
but only 3% of 2740-80 (CTXET-Kn) transformants (Fig. 3).
These data suggest that CTXcalc
lysogens are immune to
further infection by CTXcalc
, just as
CTXET
lysogens are immune to further infection by
CTXET
. These data also suggest that
CTXcalc
and CTXET
lysogens are not immune
to infection by CTXET and CTXcalc phages,
respectively. Consequently, V. cholerae can be lysogenized by multiple distinct CTX phages; in fact, this process probably accounts for the development of Calcutta strains such as AS207, which
contain both El Tor and Calcutta prophages.
|
Integration site preference and evolution of V. cholerae O139 Calcutta.
We used 2740-80 harboring either
marked El Tor or Calcutta CTX prophages to explore potential steps in
the evolution of Calcutta strains such as AS207. In these experiments,
we determined where the DNA of CTXET
and
CTXcalc
integrates on the chromosome in strains
harboring either the CTXcalc prophage or the
CTXET prophage, respectively. We have found that CTX phage
DNA reliably integrates into attRS following infection of
attRS+, CTX
El Tor strains, such
as 2740-80. However, integration regenerates the 18-bp core of
attRS or the very similar ER sequence on both ends of the
prophage (16). Thus, a subsequently infecting phage has two
or more potential integration targets; the precise number of
integration targets is determined by the length of the prophage array.
To determine the site of CTX
integration following infection of a
CTX
lysogen, we developed a PCR and restriction-digest-based assay.
For the PCR reaction, one primer was complementary to DNA 5' of
attRS on the 2740-80 chromosome and the other primer was complementary to a conserved sequence within rstA (Fig.
4). PCR products were digested with
enzymes that cleave either the El Tor or the Calcutta rstR,
thereby allowing us to identify the furthest 5' prophage within an
array of prophages. We found that the initial phage integrated on the
2740-80 chromosome always retained the most 5' position on the
chromosome (Fig. 4); thus, CTXcalc-Kn,
CTXET-Kn, CTXcalc-Ap, and CTXET-Ap
were each maintained as the most 5' prophage if their DNA was the first
in a series to be electroporated into 2740-80. Subsequent integrations,
regardless of which particular phage's DNA was tested, occurred 3' of
an integrated prophage (Fig. 4 and data not shown). In other words, DNA
from the second antibiotic-marked phage always integrated either
between tandem prophages or between an integrated prophage and 3'
chromosomal DNA. This unambiguous insertion site preference in
sequentially transformed strains (and presumably also in sequentially
infected strains) strongly suggests that Calcutta strains such as AS207
arose by infection of a V. cholerae CTXET
lysogen by CTXcalc
.
|
| |
DISCUSSION |
|---|
|
|
|---|
We have investigated the repressive and replicative capabilities
of a novel variant of CTX
, which was found as a prophage within
epidemic-linked strains of O139 V. cholerae isolated from Calcutta. This prophage gives rise to CTXcalc
virions
that infect and/or lysogenize both relatively nonpathogenic (lacking
ctxAB) V. cholerae strains, such as 2740-80, as
well as classical and El Tor strains that already contain CTX
prophages. These findings demonstrate that CTXET
is not
the sole viable, CT-encoding, filamentous phage capable of transmitting
ctxAB within V. cholerae populations.
CTXcalc
lysogens are immune to infection by
CTXcalc
due to the production by these lysogens of a new
repressor, RstRcalc, that inhibits expression from the
adjacent rstAcalc promoter. Like
RstRET and RstRclass, the transcriptional
repressor activity of RstRcalc is sequence specific;
RstRcalc does not inhibit the activity of either the
rstAclass or the rstAET
promoter. Similarly, the rstAcalc promoter is
not repressed by RstRclass or RstRET.
Despite the functional similarity of the three CTX
repressors, the
RstRcalc amino acid sequence is unrelated to the sequences
of RstRclass, RstRET, and the known repressor
proteins of other lysogenic phages. In fact, BLAST searches using the
nucleotide and predicted amino acid sequences of this repressor
revealed no significant homology to any sequence within the GenBank
databases. It is therefore not surprising that most protein analysis
algorithms that we tested did not predict any repressor or DNA binding
activity for RstRcalc. However, the motif-detecting program
fingerPRINTScan does detect a low level of similarity between
RstRcalc and the hth domain found in lambdoid repressors
and in a subset of homeotic proteins (hthrepressr fingerprint).
Interestingly, fingerPRINTScan assigns RstRclass and
RstRET to different hth categories (homeobox and hthLysR
fingerprints, respectively), suggesting that the three V. cholerae repressors may be more closely related to proteins from
other species than they are to each other. The genetic mechanism(s) by
which the unrelated RstR-RstR operator pairs became associated with
otherwise very similar CTX
s has not been explored. However,
recombination between a CTX
containing a particular
repressor-operator pair and repressor-operator sequences within other
temperate bacteriophages or even within other genetic elements is
clearly one possibility.
Production of RstRcalc enables the CTXcalc
prophage both to control its own replication and to inhibit
RstA-mediated replication of any newly introduced DNA that relies upon
the rstAcalc promoter. This confers upon a
lysogen a degree of immunity to secondary infections by identical
phages, similar to the immunity produced by
prophages within
E. coli. Also like lambdoid prophages, CTXcalc
lysogens are susceptible to infection
(heteroimmune) by CTX
with different immunity regions
(rstR/RstR operator sequences). In addition, results from
our transformation efficiency assay suggest that CTXET
lysogens are heteroimmune to CTXcalc
infection.
Integrated CTXcalc-Kn does not completely inhibit
replication of the related replicon, CTXcalc-Ap; however,
it does significantly diminish CTXcalc-Ap replication
relative to that of CTXET-Ap. In the transformation
efficiency assay system, CTXcalc-Kn is less effective at
providing immunity than is CTXET-Kn. This finding could
reflect the relative weakness of RstRcalc as a repressor;
alternatively, it may indicate the strength of the
rstAcalc promoter. When assayed in CC118, an
rstAcalc-lacZ reporter fusion has
higher activity than either
rstAclass-lacZ or
rstAET-lacZ reporters, so even if
repressed to the same degree as the other promoters,
rstAcalc may maintain higher residual activity.
Residual production of RstA, either from the prophage or from the RF,
presumably enables some plasmids to replicate and subsequently
integrate. Although our assay measures immunity indirectly, by
monitoring transformation of lysogens with the RF of the CTX
genomes, these experiments yielded results similar to those obtained
when CTXET
immunity was assayed directly, using an
intraintestinal transduction assay (9).
Our results support the hypothesis that AS207 and related Calcutta
strains arose via infection of an O139 CTXET
lysogen by
the previously unknown CTXcalc
. Epidemic O139 V. cholerae strains isolated prior to 1996 contain only El Tor CTX
prophages but otherwise are very similar to Calcutta O139 strains
(3, 20) and thus are likely AS207 progenitors. Our
experiments indicate that CTXcalc
infection and
lysogenization of such a progenitor strain would result in the same
arrangement of CTX prophages as is seen in Calcutta O139 strains such
as AS207. A recent survey of environmental V. cholerae
strains in Calcutta detected a prophage encoding RstRcalc
(presumably integrated CTXcalc
) in a non-O1, non-O139
strain of V. cholerae (3a). This may indicate
that CTXcalc
is transmitted within the estuarine
environment as well as within the laboratory; it also reveals a
potential source of CTXcalc
. Thus, it seems probable
that AS207 and other Calcutta strains arose via infection of an
earlier, epidemic-linked O139 strain with CTXcalc
. It is
also possible that recombination between a CTXET prophage
within an O139 strain and a repressor-operator from an unrelated
genetic element gave rise to O139 Calcutta strains, but such a
mechanism seems less likely to account for the origin of these strains.
When we proposed using rstRET to protect
classical and El Tor live-attenuated V. cholerae vaccine
strains from reversion to toxigenicity mediated by CTX
infection
(9), the only described infectious CTX
was
CTXET
. Nucleotide sequence analysis of the
rstR/ig-2 immunity regions in multiple El Tor clinical
isolates from around the world had revealed that they are identical
(9), lending credence to this approach. However, the current
description of the infectious CTXcalc
, which encodes the
novel RstRcalc, suggests that rstR-mediated
immunity to CTX
infection may not constitute a useful method of
enhancing the biosafety of live-attenuated V. cholerae
vaccines. Besides rstRcalc, two additional
putative rstRs have been identified recently in
environmental, non-O1/O139 V. cholerae isolates (3a,
3b), and more alleles probably remain to be detected. Thus,
introduction of a comprehensive immunizing library of rstRs
into vaccine strains may not be practical. Ongoing studies are
exploring alternative mechanisms for preventing CTX
-mediated
transfer of ctxA and -B to vaccine strains.
| |
ACKNOWLEDGMENTS |
|---|
We thank K. Moyer, B. Hochhut, and E. F. Boyd for critical reading of this manuscript. We are grateful to G. B. Nair and A. Ghosh for providing Calcutta O139 strains. We thank A. Kane and the New England Medical Center GRASP Center for preparation of the media and M. Byrne of the Tufts Core Facility for carrying out DNA sequencing.
This work was supported by grants AI-42347 to M.K.W. and grant P30DK-34928 for the New England Medical Center GRASP Digestive Center. M.K.W. is a Pew Scholar in the Biomedical Sciences. H.H.K. was supported by grant T32 AI07329.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Tufts University School of Medicine and Division of Geographic Medicine and Infectious Diseases, Tupper Research Institute, Tufts-New England Medical Center 041, 750 Washington St., Boston, MA 02111. Phone: (617) 636-7618. Fax: (617) 636-5292. E-mail: matthew.waldor{at}es.nemc.org.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Altschul, S. F.,
T. L. Madden,
A. A. Schaffer,
J. Zhang,
Z. Zhang,
W. Miller, and D. J. Lipman.
1997.
Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res.
25:3389-3402 |
| 2. | Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidmann, J. A. Smith, and K. Struhl. 1990. Current protocols in molecular biology. Greene Publishing and Wiley-Interscience, New York, N.Y |
| 3. | Basu, A., A. K. Mukhopadhyay, C. Sharma, J. Jyot, N. Gupta, A. Ghosh, S. K. Bhattacharya, Y. Takeda, A. S. Faruque, M. J. Albert, and G. Balakrish Nair. 1998. Heterogeneity in the organization of the CTX genetic element in strains of Vibrio cholerae O139 Bengal isolated from Calcutta, India and Dhaka, Bangladesh and its possible link to the dissimilar incidence of O139 cholera in the two locales. Microb. Pathog. 24:175-183[Medline]. |
| 3a. | Berg, D. Personal communication. |
| 3b. | Boyd, E. F. Unpublished data. |
| 4. |
Dodd, I. B., and J. B. Egan.
1990.
Improved detection of helix-turn-helix DNA-binding motifs in protein sequences.
Nucleic Acids Res.
18:5019-5026 |
| 5. | FingerPRINTScan Website. [Online.] http://www.biochem.ucl.ac.uk/cgi-bin/fingerPRINTScan/fps/PathForm.cgi. [7 May 1999, last date accessed.] |
| 6. |
Goldberg, I., and J. J. Mekalanos.
1986.
Effect of a recA mutation on cholera toxin gene amplification and deletion events.
J. Bacteriol.
165:723-731 |
| 7. |
Guzman, L. M.,
D. Belin,
M. J. Carson, and J. Beckwith.
1995.
Tight regulation, modulation, and high-level expression by vectors containing the arabinose pBAD promoter.
J. Bacteriol.
177:4121-4130 |
| 8. |
Kimsey, H. H.,
G. B. Nair,
A. Ghosh, and M. K. Waldor.
1998.
Diverse CTX and evolution of new pathogenic Vibrio cholerae.
Lancet
352:457-458[Medline].
|
| 9. |
Kimsey, H. H., and M. K. Waldor.
1998.
CTX immunity: application in the development of cholera vaccines.
Proc. Natl. Acad. Sci. USA
95:7035-7039 |
| 10. |
Kimsey, H. H., and M. K. Waldor.
1998.
Vibrio cholerae hemagglutinin/protease inactivates CTX .
Infect. Immun.
66:4025-4029 |
| 11. |
Levine, M. M.,
J. B. Kaper,
R. E. Black, and M. L. Clements.
1983.
New knowledge on pathogenesis of bacterial enteric infections as applied to vaccine development.
Microbiol. Rev.
47:510-550 |
| 12. |
Manoil, C., and J. Beckwith.
1985.
TnphoA: a transposon probe for protein export signals.
Proc. Natl. Acad. Sci. USA
82:8129-8133 |
| 13. | Mekalanos, J. J. 1983. Duplication and amplification of toxin genes in Vibrio cholerae. Cell 35:253-263[Medline]. |
| 14. | Miller, J. H. 1992. A short course in bacterial genetics: a laboratory manual and handbook for Escherichia coli and relative bacteria. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y |
| 15. |
Miller, V. L., and J. J. Mekalanos.
1988.
A novel suicide vector and its use in construction of insertion mutations: osmoregulation of outer membrane proteins and virulence determinants in Vibrio cholerae requires toxR.
J. Bacteriol.
170:2575-2583 |
| 16. |
Pearson, G. D.,
A. Woods,
S. L. Chiang, and J. J. Mekalanos.
1993.
CTX genetic element encodes a site-specific recombination system and an intestinal colonization factor.
Proc. Natl. Acad. Sci. USA
90:3750-3754 |
| 17. | Pearson, G. D. N. 1989. Ph.D. thesis. Harvard University Medical School, Cambridge, Mass |
| 18. | Schneider, K., and C. F. Beck. 1986. Promoter-probe vectors for the analysis of divergently arranged promoters. Gene 42:37-48[Medline]. |
| 19. |
Sears, C. L., and J. B. Kaper.
1996.
Enteric bacterial toxins: mechanisms of action and linkage to intestinal secretion.
Microbiol. Rev.
60:167-215 |
| 20. | Sharma, C., S. Maiti, A. K. Mukhopadhyay, A. Basu, I. Basu, G. B. Nair, R. Mukhopadhyaya, B. Das, S. Kar, R. K. Ghosh, and A. Ghosh. 1997. Unique organization of the CTX genetic element in Vibrio cholerae O139 strains which reemerged in Calcutta, India, in September 1996. J. Clin. Microbiol. 35:3348-3350[Abstract]. |
| 21. |
Trucksis, M.,
J. Michalski,
Y. K. Deng, and J. B. Kaper.
1998.
The Vibrio cholerae genome contains two unique circular chromosomes.
Proc. Natl. Acad. Sci. USA
95:14464-14469 |
| 22. | Waldor, M. K., and J. J. Mekalanos. 1996. Lysogenic conversion by a filamentous phage encoding cholera toxin. Science 272:1910-1914[Abstract]. |
| 23. |
Waldor, M. K.,
E. J. Rubin,
G. D. Pearson,
H. Kimsey, and J. J. Mekalanos.
1997.
Regulation, replication, and integration functions of the Vibrio cholerae CTX are encoded by region RS2.
Mol. Microbiol.
24:917-926[Medline].
|
| 24. |
Waldor, M. K.,
H. Tschape, and J. J. Mekalanos.
1996.
A new type of conjugative transposon encodes resistance to sulfamethoxazole, trimethoprim, and streptomycin in Vibrio cholerae O139.
J. Bacteriol.
178:4157-4165 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»