Previous Article | Next Article ![]()
Journal of Bacteriology, November 1999, p. 6828-6831, Vol. 181, No. 21
Centre National de la Recherche Scientifique,
Institut des Sciences Végétales, 91190 Gif-sur-Yvette,
France
Received 20 May 1999/Accepted 3 July 1999
hrpG is a key regulatory gene for transcriptional
activation of pathogenicity genes (hrp) of
Xanthomonas campestris pv. vesicatoria. We identified three
mutations in hrpG which render hrp gene
expression constitutive in normally suppressing medium. The mutations
in hrpG result in novel amino acid substitutions compared
to mutations in related proteins, such as OmpR. In addition, mutated
hrpG enhances the timing and intensity of plant reactions
in infection assays.
The interaction of the gram-negative
bacterium Xanthomonas campestris pv. vesicatoria (hereafter
X. campestris) with its host plants pepper and tomato is
controlled by hrp (hypersensitive reaction and
pathogenicity) genes (3), some of which are predicted to
encode components of a type III protein secretion system (1, 5). hrp gene expression is suppressed in complex
medium (NYG [5 g of peptone, 3 g of yeast extract, and 20 g of
glycerol per liter]), but is induced in planta and in the synthetic
XVM2 medium (16, 19) and is regulated by two genes,
hrpX and hrpG. hrpX encodes a protein
of the AraC family and activates transcription of the operons
hrpB to hrpF (18). Expression of
hrpX and hrpA depends on hrpG, which
encodes a putative response regulator protein of two-component signal
transduction systems (20). The predicted HrpG protein is
most similar to proteins of a subclass containing Escherichia
coli OmpR (4, 22) and Agrobacterium
tumefaciens VirG (21). The X. campestris
hrpG gene is expressed at a low level in NYG medium but requires
hrp gene-inducing conditions for the activation of
downstream genes (20). To achieve hrp gene
expression in noninducing media, we performed a random mutagenesis of
hrpG and selected for mutations rendering expression of all hrp genes constitutive in NYG medium.
First, a suitable reporter plasmid, pPCspec, was constructed by fusing
a 320-bp fragment encompassing the hrpG-regulated X. campestris hrpC promoter to a promoterless aadA gene in
pLAFR6 (2). The aadA gene, which confers
resistance to spectinomycin, was amplified by PCR from the omega
cassette (14) by using oligonucleotides 161 (5'
GGGGAGCTCAAACAAAGTTAAACATC 3') and 162 (5'
GGGGAATTCATTATTTGCCGACTACC 3') (restriction sites
used for cloning are underlined). For mutagenesis of
hrpG, plasmid pFG72, which carries hrpG on a
1.7-kb BamHI-KpnI fragment in the low-copy
plasmid pUFR043 (gift from D. Gabriel, University of Florida,
Gainesville), was transformed into the E. coli mutator
strain Epicurian Coli XL1-Red (Stratagene, La Jolla, Calif.). Plasmid
DNA was isolated at different time points and transformed into E. coli DH5
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Mutations in the Regulatory Gene hrpG of
Xanthomonas campestris pv. vesicatoria Result in
Constitutive Expression of All hrp Genes

and
![]()
ABSTRACT
Top
Abstract
Text
References
![]()
TEXT
Top
Abstract
Text
References
. Transformants were conjugated en masse with X. campestris 85-10 (11) carrying pPCspec and plated on
NYG agar containing 400 µg of spectinomycin per ml. Eleven
spectinomycin-resistant transconjugants, obtained at a frequency of
10
4, were analyzed further. To test the effect of the
mutated pFG72 derivatives on hrp promoter activity, they
were first introduced into X. campestris 85-10 carrying
pPC490, an hrpC promoter-uidA fusion in pL6GUSB
(2).
-Glucuronidase (GUS) activities were determined
after growth of bacteria in NYG and in hrp gene-inducing XVM2 medium. All 11 mutated hrpG plasmids (designated
pFG72-1 to pFG72-11) activated the hrpC promoter in NYG. To
determine the activity of all other known hrp promoters in
presence of the mutated hrpG gene, pFG72-1 (hrpG
herein referred to as hrpG*) was conjugated into X. campestris strains carrying hrp
promoter-uidA fusion plasmids pPA2, pPB1, pPD3, pPFI42,
pPG1, and pPX2 (2, 6, 18-20), which express the
uidA gene under the control of the hrpA,
hrpB, hrpD, hrpF, hrpG, and
hrpX promoters, respectively. hrpE promoter
activity was determined by using pXV4::E525 (18). As shown in Fig. 1A, additional copies of
the wild-type hrpG plasmid pFG72 resulted in somewhat higher
GUS activities of bacteria grown in NYG medium compared to 85-10. However, in the presence of hrpG*, all hrp
promoters, except for the hrpG promoter, exhibited 20- to
1,000-fold higher activities in NYG compared to wild-type strain 85-10. In XVM2 medium, GUS activities in the presence of hrpG* were
in the same order of magnitude as those with additional copies of the
wild-type gene and were 10-fold higher than those for strains containing only the genomic copy (Fig. 1B).

View larger version (33K):
[in a new window]
FIG. 1.
Activity of X. campestris hrp promoters in
the presence of wild-type hrpG and hrpG*.
Wild-type strain 85-10 carrying plasmid-borne transcriptional
hrp promoter-uidA fusions and no additional
hrpG, plasmid-borne hrpG (pFG72), and
hrpG* (pFG72-1), respectively, were grown for 16 h in
NYG (A) and XVM2 (B). For technical reasons, hrpE promoter
activity was determined with hrpG* expressed in pDSK600. GUS
assays were performed as described previously (16). Specific
GUS activities are the average of two experiments and are graphically
displayed with a logarithmic scale (1 U = 1 nmol of
4-methyl-umbelliferyl-
-D-glucuronide released per
bacterium per min).
DNA sequencing of hrpG* in pFG72-1 revealed a single G-to-A mutation at position 130 of the hrpG coding sequence, leading to an E44K exchange in the translation product. Since this mutation destroys a SacI restriction site, the remaining 10 pFG72 derivatives were tested for presence or absence of this site. While eight of them had lost the SacI site and probably carry the same mutation as pFG72-1, the SacI site was present in two plasmids, pFG72-2 and pFG72-3. Sequence analysis revealed a G-to-A exchange at position 595 of hrpG in pFG72-2, leading to a D199N substitution, and an A-to-G mutation at position 581 in pFG72-3, resulting in an H194R exchange. All three hrpG mutations had identical effects on the activity of the hrpG-dependent promoters (data not shown).
Only a few known mutations in OmpR-type transcriptional activators
render the protein constitutively active. These mutations have all been
mapped to the N-terminal domain of a given protein (Table
1 and Fig.
2). For example, in the
Agrobacterium irG protein, N54E or I106L substitutions (N80
or I132 in Fig. 2) resulted in constitutive vir gene
expression (12). A D55E substitution in the E. coli OmpR protein rendered it active independent of the sensor
kinase EnvZ (8). Whether the E44K mutation in the
N-terminal domain of HrpG mimics the predicted phosphorylation of the
D60 residue in HrpG (20) is a matter of speculation.
Interestingly, the other two mutations in X. campestris HrpG
identified here, H194R and D199N, are located in the C-terminal domain
of the protein. In contrast to HrpG, substitutions at corresponding
positions in E. coli OmpR (E193K and E198K) and PhoB (D192G)
led to loss of function (9, 13, 15). It has been shown for
OmpR that the region from amino acid 192 to amino acid 199 forms a loop exposed at the protein surface, which has been proposed to control RNA
polymerase activity by direct interaction with its
-subunit (10). The H194R and D199N substitutions in HrpG might,
therefore, lead to transcriptional activation due to alteration of
contact with RNA polymerase.
|
|
Because hrpG is a key regulator for the interaction of
X. campestris with plants, we wondered whether the three
mutations in hrpG alter the plant reaction after infection.
To avoid interference of mutated hrpG with the wild-type
gene, a 950-bp SacI fragment spanning most of the
hrpG coding region was deleted. The mutation was introduced
into the chromosome of X. campestris wild-type strain 85-10 using suicide plasmid pOK1 (7), resulting in mutant 85
G.
Transconjugants of 85
G harboring pFG72, pFG72-1, pFG72-2, or pFG72-3
were inoculated into leaves of susceptible (ECW) and resistant
(ECW-10R) pepper plants (11). Symptoms caused by wild-type and mutated hrpG bacteria in ECW were indistinguishable. On
pepper ECW-10R, strain 85-10 induces the hypersensitive reaction (HR), a rapid, localized cell death reaction, approximately 8 to 10 h
after inoculation. Bacteria expressing hrpG* induced a
complete, confluent collapse (earliest macroscopically visible
reaction) on ECW-10R as soon as 4 h after inoculation (Fig.
3A). No difference was observed between
hrpG* and mutated hrpG present in pFG72-2 and
pFG72-3. The minimal concentration of hrpG* bacteria needed to induce the HR on ECW-10R was two- to fourfold lower than those for
85-10 and 85
G(pFG72). Thus, hrpG* enhances the HR
induction with respect to both time and efficiency. We then tested
whether a stronger HR was also observed in the nonhost plant tobacco, which is resistant to X. campestris. Different densities of
bacterial suspensions were inoculated into leaves of Nicotiana
tabaci cv. Xanthi plants (Fig. 3B). Inoculation of the
hrpG* strain induced a confluent HR 1 day after inoculation.
In contrast, strains 85
G(pFG72) and 85-10 induced only a weak
chlorotic and necrotic reaction 2 to 3 days after infection.
|
To reexamine the effect of hrpG* on susceptible plants in a bacterial genetic background resembling the natural situation, the wild-type copy was replaced by hrpG* in strains 85-10 and 82-8 (11) with pOK1 (7) to generate 85* and 82*. Chromosomal hrpG* accelerated the HR induction, as described above for hrpG* expressed from a plasmid. However, there was a clear difference in timing and intensity of disease symptoms on the susceptible plant, ECW. Water-soaked lesions, typical early disease symptoms, appeared much earlier (49 h) and were stronger than with the wild-type strains (65 to 72 h). These effects were not due to increased bacterial growth in the presence of hrpG*, as determined by bacterial growth curves in planta (data not shown).
In conclusion, we identified three mutations in the key hrp regulatory gene hrpG rendering expression of downstream genes constitutive. The mutations residing in the C-terminal domain of HrpG are particularly interesting, because similar mutations in homologous proteins lead to inactivation. The amplifying effect of mutated hrpG on both disease symptoms and cell death is intriguing and might be indicative of more efficient Hrp type III protein delivery into the plant tissue.
| |
ACKNOWLEDGMENTS |
|---|
We thank R. Koebnik for helpful suggestions for the manuscript.
This study was in part funded by an EC grant (BIO4-CT97-2244) to U.B. K.W. and O.R. were supported by the Human Capital and Mobility program of the European Union and by a grant from the Ministère de l'Education Nationale et de la Recherche, respectively.
| |
FOOTNOTES |
|---|
* Corresponding author. Present address: Institut für Genetik, Martin-Luther-Universität, 06099 Halle, Germany. Phone: 49 345 55 26 290. Fax: 49 345 55 27 259. E-mail: bonas{at}genetik.uni-halle.de.
Present address: Imperial College, Department of Biology, London
SW7-2AZ, United Kingdom.
Present address: Institut für Genetik,
Martin-Luther-Universität, 06099 Halle, Germany.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Bogdanove, A., S. V. Beer, U. Bonas, C. A. Boucher, A. Collmer, D. L. Coplin, G. R. Cornelis, H.-C. Huang, S. W. Hutcheson, N. J. Panopoulos, and F. Van Gijsegem. 1996. Unified nomenclature for broadly conserved hrp genes of phytopathogenic bacteria. Mol. Microbiol. 20:681-683[Medline]. |
| 2. | Bonas, U. Unpublished data. |
| 3. | Bonas, U., R. Schulte, S. Fenselau, G. V. Minsavage, and B. J. Staskawicz. 1991. Isolation of a gene cluster from Xanthomonas campestris pv. vesicatoria that determines pathogenicity and the hypersensitive response on pepper and tomato. Mol. Plant-Microbe Interact. 4:81-88. |
| 4. |
Comeau, D. E.,
K. Ikenaka,
K. Tsung, and M. Inouye.
1985.
Primary characterization of the protein products of the Escherichia coli ompB locus: structure and regulation of synthesis of the OmpR and EnvZ proteins.
J. Bacteriol.
164:578-584 |
| 5. | Fenselau, S., I. Balbo, and U. Bonas. 1992. Determinants of pathogenicity in Xanthomonas campestris pv. vesicatoria are related to proteins involved in secretion in bacterial pathogens of animals. Mol. Plant-Microbe Interact. 5:390-396[Medline]. |
| 6. | Fenselau, S., and U. Bonas. 1995. Sequence and expression analysis of the hrpB pathogenicity operon of Xanthomonas campestris pv. vesicatoria which encodes eight proteins with similarity to components of the Hrp, Ysc, Spa, and Fli secretion systems. Mol. Plant-Microbe Interact. 8:845-854[Medline]. |
| 7. | Huguet, E., K. Hahn, K. Wengelnik, and U. Bonas. 1998. hpaA mutants of Xanthomonas campestris pv. vesicatoria are affected in pathogenicity but retain the ability to induce host-specific hypersensitive reaction. Mol. Microbiol. 29:1379-1390[Medline]. |
| 8. |
Lan, C.-Y., and M. M. Igo.
1998.
Differential expression of the OmpF and OmpC porin proteins in Escherichia coli K-12 depends upon the level of active OmpR.
J. Bacteriol.
180:171-174 |
| 9. | Makino, K., M. Amemura, T. Kawamoto, S. Kimura, H. Shinagawa, A. Nakata, and M. Suzuki. 1996. DNA binding of PhoB and its interaction with RNA polymerase. J. Mol. Biol. 259:15-26[Medline]. |
| 10. | Martinez-Hackert, E., and A. M. Stock. 1997. Structural relationships in the OmpR family of winged-helix transcription factors. J. Mol. Biol. 239:301-312. |
| 11. | Minsavage, G. V., D. Dahlbeck, M. C. Whalen, B. Kearney, U. Bonas, B. J. Staskawicz, and R. E. Stall. 1990. Gene-for-gene relationships specifying disease resistance in Xanthomonas campestris pv. vesicatoria-pepper interactions. Mol. Plant-Microbe Interact. 3:41-47. |
| 12. |
Pazour, G. J.,
C. N. Ta, and A. Das.
1992.
Constitutive mutations of Agrobacterium tumefaciens transcriptional activator virG.
J. Bacteriol.
174:4169-4174 |
| 13. | Pratt, L. A., and T. J. Silhavy. 1994. OmpR mutants specifically defective for transcriptional activation. J. Mol. Biol. 243:579-594[Medline]. |
| 14. | Prentki, P., and H. M. Krisch. 1984. In vitro insertion mutagenesis with a selectable DNA fragment. Gene 29:303-313[Medline]. |
| 15. | Russo, F. D., J. M. Slauch, and T. J. Silhavy. 1993. Mutations that affect separate functions of OmpR the phosphorylated regulator of porin transcription in Escherichia coli. J. Mol. Biol. 231:261-273[Medline]. |
| 16. |
Schulte, R., and U. Bonas.
1992.
Expression of the Xanthomonas campestris pv. vesicatoria hrp gene cluster, which determines pathogenicity and hypersensitivity on pepper and tomato, is plant inducible.
J. Bacteriol.
174:815-823 |
| 17. |
Vidal, O.,
R. Longin,
C. Prigent-Combaret,
C. Dorel,
M. Hooreman, and P. Lejeune.
1998.
Isolation of an Escherichia coli K-12 mutant strain able to form biofilms on inert surfaces: involvement of a new ompR allele that increases curli expression.
J. Bacteriol.
180:2442-2449 |
| 18. |
Wengelnik, K., and U. Bonas.
1996.
HrpXv, an AraC-type regulator, activates expression of five out of six loci in the hrp cluster of Xanthomonas campestris pv. vesicatoria.
J. Bacteriol.
178:3462-3469 |
| 19. |
Wengelnik, K.,
C. Marie,
M. Russel, and U. Bonas.
1996.
Expression and localization of HrpA1, a protein of Xanthomonas campestris pv. vesicatoria essential for pathogenicity and induction of the hypersensitive reaction.
J. Bacteriol.
178:1061-1069 |
| 20. | Wengelnik, K., G. Van den Ackerveken, and U. Bonas. 1996. HrpG, a key hrp regulatory protein of Xanthomonas campestris pv. vesicatoria is homologous to two-component response regulators. Mol. Plant-Microbe Interact. 9:704-712[Medline]. |
| 21. |
Winans, S. C.,
P. R. Ebert,
S. E. Stachel,
M. P. Gordon, and E. W. Nester.
1986.
A gene essential for Agrobacterium virulence is homologous to a family of positive regulatory loci.
Proc. Natl. Acad. Sci. USA
83:8278-8282 |
| 22. |
Wurtzel, E. T.,
M. Y. Chou, and M. Inouye.
1982.
Osmoregulation of gene expression. I. DNA sequence of the ompR gene of the ompB operon of Escherichia coli and characterization of its gene product.
J. Biol. Chem.
257:13685-13691 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»