Previous Article | Next Article 
Journal of Bacteriology, November 1999, p. 6844-6849, Vol. 181, No. 21
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
The IntI1 Integron Integrase Preferentially
Binds Single-Stranded DNA of the attC Site
M. Victoria
Francia,
Juan
C.
Zabala,
Fernando
de la
Cruz, and
Juan M.
García Lobo*
Departamento de Biología Molecular,
Facultad de Medicina, Universidad de Cantabria, Santander, Spain
Received 4 June 1999/Accepted 11 August 1999
 |
ABSTRACT |
IntI1 integrase is a member of the prokaryotic DNA integrase
superfamily. It is responsible for mobility of antibiotic resistance cassettes found in integrons. IntI1 protein, as well as IntI1-COOH, a
truncated form containing its carboxy-terminal domain, has been purified. Electrophoretic mobility shift assays were carried out to
study the ability of IntI1 to bind the integrase primary target sites
attI and aadA1 attC. When using double-stranded
DNA as a substrate, we observed IntI1 binding to attI but
not to attC. IntI1-COOH did not bind either
attI or attC, indicating that the N-terminal
domain of IntI1 was required for binding to double-stranded attI. On the other hand, when we used single-stranded (ss)
DNA substrates, IntI1 bound strongly and specifically to ss
attC DNA. Binding was strand specific, since only the
bottom DNA strand was bound. Protein IntI1-COOH bound ss
attC as well as did the complete integrase, indicating that
the ability of the protein to bind ss aadA1 attC was
contained in the region between amino acids 109 and 337 of IntI1.
Binding to ss attI DNA by the integrase, but not by
IntI1-COOH, was also observed and was specific for the attI
bottom strand, indicating similar capabilities of IntI1 for binding
attI DNA in either double-stranded or ss conformation. Footprinting analysis showed that IntI1 protected at least 40 bases of
aadA1 attC against DNase I attack. The protected sequence contained two of the four previously proposed IntI1 DNA binding sites,
including the crossover site. Preferential ssDNA binding can be a
significant activity of IntI1 integrase, which suggests the utilization
of extruded cruciforms in the reaction mechanisms leading to cassette
excision and integration.
 |
TEXT |
Since the introduction of
antibiotics in the treatment of human infectious diseases, antibiotic
resistance has spread quickly and dramatically among bacteria. Such
explosive dissemination is a consequence of the mobility of the
antibiotic-resistance-encoding genes, which are usually found in
plasmids, transposons, and integrons (12, 27). Integrons are
a class of site-specific recombination elements which consist of two
conserved sequence regions (5' and 3' conserved regions), flanking a
central variable region (Fig. 1), in
which antibiotic resistance genes are found organized as resistance
cassettes (14). The recombinative activity of integrons resides in an enzyme, the integrase, belonging to the broad family of
phage integrases (1, 6). The integrase gene is part of the
integron 5' conserved region (19, 20). The integrase acts mainly at two sites in DNA. The attI site is close to the
integrase gene. It signals the boundary of the integron 5' conserved
region (15). The attC sites flank each of the
inserted resistance cassettes in the central variable region of the
integron (13). While integron attI sites are well
conserved in type I integrons, attC sites, also called 59-bp
elements (13) and recombination hot spots (20),
are very heterogeneous in sequence and length. In the case of class I
integrons, recombination can occur across any pair of att
sites, but each att site is used at widely different frequencies (7, 15, 19). attI and attC
can be considered IntI1 primary sites. Besides, IntI1 can act on
secondary sites. The secondary sites consist of a degenerate
pentanucleotide with the sequence GWTMW (8). Integration of
gene cassettes into these secondary sites in naturally occurring
plasmids in vivo has been described elsewhere (22, 25).
Therefore, IntI1 seems to be quite flexible in the sequence that it
requires to carry out its site-specific recombination. IntI1-mediated
recombination across attI and attC sites results
in mobility of preexisting resistance cassettes among integrons.
Cassettes can be excised from integrons and be reintegrated by
attC-attI or attC-attC site-specific recombination (3, 14). Recombination at secondary sites may be important in the recruitment of chromosomal genes into cassettes, allowing the flux of chromosomal genes into mobile genetic elements (8, 9).

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 1.
(A) Simplified diagram of the type I integron in
Tn21 to illustrate integron organization and location of the
att sites. (B) Nucleotide sequence of the IntI1 primary
sites (attI and attC) in plasmids pSU18R2 and
pSU18R3. The DNA sequences show the GTTAG crossover site at the right
(3') end. This orientation defines the top and bottom nomenclature for
the ssDNAs. Filled vertical arrows indicate the crossover sites, and
open horizontal arrows point to the four putative pentanucleotide
components (boxed and numbered) of each att site. The
numbers below the bottom strand of the aadA1 attC site start
at the beginning of the reverse M13 priming site of the pSU18 vector
sequence and correspond to numbers in Fig. 6. The shaded area indicates
the region protected by IntI1 from DNase I attack.
|
|
Evidence from in vivo experiments indicates that IntI1 primary sites
may be seen as a composite of four single sites organized as two
inverted pairs at each att end and a central sequence with some degree of secondary structure (7, 26). The single sites could be the basic unit for integrase-DNA interaction. Some authors have identified this single site with a degenerate 7-bp site, GTTRRRY,
also called a core site (26). GWTMW pentanucleotides have
also been proposed as the single integrase binding sites (7,
9). The purification and DNA binding properties of IntI1 have
been recently reported (4, 10, 11). The results available indicated that the integrase bound efficiently to the attI
site in vitro but that no binding to attC was observed.
Regarding the integrase binding sites, in one study (4),
binding to attI was in a region quite separate from the
known integrase crossover site. In another study (11), four
clear-cut binding sites were reported, two of them, I and II, flanking
the crossover site while the other two, III and IV, were located three
and five helix turns, respectively, to the left of the crossover. Site
III could be the same strong binding site described in reference
4. Furthermore, sites I, II, and III overlap three
of the pentanucleotides proposed to be part of IntI1 primary sites. In
spite of these reports, we are still far from understanding the
biochemical details of IntI1-mediated site-specific reaction, and even
some basic aspects such as IntI1 interaction with attC are
obscure. In this work, we used an alternative approach to purify IntI
as well as a truncated form containing the IntI1 carboxy-terminal
domain (IntI1-COOH) and used these proteins to study the binding to Int
primary sites in both double-stranded (ds) and single-stranded (ss) forms.
Purification of native IntI1 and IntI1-COOH.
A DNA fragment
containing a complete intI1 gene was amplified by PCR from
plasmid pSU2056 (19) by using the primers PETInt (CCCCATATGAAAACCGCCACTGCGCC) and universal M13, digested
with NdeI and BamHI, and cloned into the same
sites of the pET3a plasmid (23) as described in reference
24. In the resulting plasmid, called pET3aInt, the
IntI1 open reading frame was expressed from the T7 promoter
(28). The in vivo activity of the integrase from plasmid
pET3aInt was checked in a conduction assay as described in reference
19. Plasmid pSU18R2, which contained the site
aadA1 attC, formed site-specific cointegrates with plasmid
R388 (5) at a frequency of 10
2, indicating
that the integrase produced by the plasmid pET3aInt was active in vivo.
Overexpression of the IntI1 protein from pET3aInt was assayed in five
different Escherichia coli BL21 derivatives, although we
obtained overexpression only in strain C41 (21). Following
IPTG (isopropyl-
-D-thiogalactopyranoside) induction, an
overexpressed band of approximately 38 kDa (calculated size, 38,357 Da)
was visualized on sodium dodecyl sulfate (SDS) gels. Most of the IntI1
protein produced in strain C41 grown at 37°C was present in the form
of insoluble inclusion bodies. These inclusion bodies were used as a
source of IntI1 protein to obtain IntI1-specific rabbit antiserum as
described in reference 16. Soluble IntI1 protein
could be obtained by growing and inducing the cultures at 25°C
(21, 28). E. coli C41 cells containing plasmid
pET3aInt were grown in 50 ml of Luria-Bertani medium (containing
ampicillin [100 µg ml
1]) with shaking at 25°C to an
optical density of 0.4 at 600 nm. Expression of the IntI1 protein was
induced by addition of IPTG to 1.0 mM for 4 h at the same
temperature (28). Cells were harvested by centrifugation and
resuspended in 5 ml of 50 mM Tris (pH 7.5)-5 mM EDTA-5%
sucrose-0.05 mg of lysozyme ml
1. After 20 min at room
temperature, the cells were pelleted and resuspended in 5 ml of
high-salt lysis buffer (50 mM Tris [pH 7.5], 500 mM NaCl, 1 mM EDTA,
1 mM dithiothreitol [DTT], 0.25% Triton X-100). After a 15-min
incubation at 4°C, the cells were disrupted by sonication. The cell
lysates were centrifuged at 18,000 × g for 20 min at 4°C.
By this method, the majority of the integrase produced was recovered in
soluble form; however, it did not bind to any of the commonly used
ion-exchange media (phosphocellulose, carboxymethyl cellulose,
SP-Sepharose, DEAE-cellulose, or Mono Q-Sepharose [Amersham-Pharmacia
Biotech]) when assayed with different buffers and pH conditions. When
the lysis of the cells was done in low-salt lysis buffer containing 50 mM NaCl, most of the IntI1 protein was found in the pellet after a
low-speed centrifugation step. Thus, we decided to purify the IntI1
protein from this pellet. The pellet was washed with 2.5 ml of lysis
buffer containing 1% Triton X-100 for 15 min at 4°C, centrifuged as
before, and washed again for 15 min at 4°C with 2.5 ml of lysis
buffer containing 2 M NaCl. The washed pellet was resuspended in 2.5 ml
of 50 mM Tris (pH 7.5)-1 mM EDTA-1 mM DTT-1 M NaCl-10 mM CHAPS (3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate) and centrifuged at 100,000 × g for 15 min at 4°C to eliminate
insoluble material. The IntI1 protein thus purified was more than 80%
homogeneous as judged by SDS-polyacrylamide gel electrophoresis. Only
the major protein band showed a reaction with polyclonal antibody against the IntI1 integrase in Western blot assays (Fig.
2).

View larger version (90K):
[in this window]
[in a new window]
|
FIG. 2.
Western blot analysis of the IntI1 protein purified
fractions. (A) Coomassie blue-stained polyacrylamide-SDS gel. (B)
Western blot of a similar gel immunoprobed with the anti-IntI1
antibody. Lanes 1, control strain extract; lanes 2, purified IntI1-COOH
protein; lanes 3, purified IntI1 protein.
|
|
To obtain a truncated form of IntI1 similar to the C170
carboxy-terminal domain of

integrase, which contains most of the
protein catalytic functions (
29), we used a structure-based
alignment to locate the equivalent to

integrase helix F in IntI1
(
18). This

-helix stretch is at the beginning of the C170
carboxy-terminal
domain of

integrase. In this way, we selected the
primer PETCOOH
(CCCCATATGCCGTCGCGGCGCTTGCC) and used it
along with the universal
M13 primer to amplify by PCR an 862-bp DNA
fragment from plasmid
pSU2056 corresponding to the carboxy-terminal
domain of IntI1.
This PCR fragment was cloned as described above into
the expression
vector pET3a (
23) to yield the plasmid
pET3aCOOH. The cloned
region lacked 107 amino acids of the
amino-terminal half of IntI1
and presumably contained all the
structurally conserved elements
present in the carboxy-terminal domain
of members of the Int family
(
1,
6). The IntI1-COOH protein
was overexpressed in the
strain BL21(DE3) derivative C41
(
21).
E. coli C41(pET3aCOOH)
cells were grown at
37°C in 250 ml of Luria-Bertani medium (containing
ampicillin [100
µg ml
1]) to an optical density of 0.4 at 600 nm and
induced with IPTG
as described above. A protein with an apparent
molecular mass
of 26 kDa on SDS gels was overexpressed (predicted size,
25,493
Da). Cultures were lysed as described above. After sonication,
the cell debris was removed and the supernatants were centrifuged
at
100,000 ×
g for 15 min at 4°C. The clarified
supernatant was
applied to a phosphocellulose P11 (Whatman) column
equilibrated
in lysis buffer without Triton X-100. The protein bound to
the
phosphocellulose was washed with the same buffer containing 0.2
M
NaCl. A linear gradient of NaCl (0.3 to 0.5M) in the same buffer
was
applied to the column. The fractions containing the IntI1-COOH
protein
were pooled and concentrated 50 times by ultrafiltration
with Centricon
10 filters, before being applied to a high-resolution
gel filtration
column (Superdex 75-HR; Amersham-Pharmacia Biotech).
The fractions
containing the IntI1-COOH protein were again pooled
and stored. The
purified Int-COOH polypeptide showed a size of
46 kDa in the gel
filtration column, suggesting that in solution
it behaved as a dimer.
Only the major protein band in the preparation,
corresponding to the
IntI1-COOH protein, reacted with anti-Int
antibody in Western blots
(Fig.
2).
IntI1 protein binds specifically to ss att sites.
To determine the DNA binding specificity of purified IntI1, we studied
its behavior by gel mobility shift assays with two different DNA
fragments representing the two different IntI1 primary sites: a
fragment containing aadA1 attC from In2 and the other containing the attI site. As a source of aadA1
attC DNA, we constructed plasmid pSU18R2 by cloning a PCR product
obtained from plasmid pSU2068 (19) into the pSU18 vector
(2) by using primers R1 (GGGAATTCTCTAACAATTCGTTCAAGCCGACGCC) and R2
(GGGAATTCTCTAACGCTTGAGTTAAGCCGCGCC). Similarly, we obtained
plasmid pSU18R3 as a source of attI by cloning a PCR product
from the incW plasmid R388 (5), by using the
primers RHS31 (GGGAATTCAGCAACGATGTTACGCA) and RHS32
(GGGCATGCCTAACTTTGTTTTAGGG). The DNA sequence of interest in
plasmids pSU18R2 and pSU18R3 is shown in Fig. 1. dsDNA fragments for
binding assays were generated by PCR with the plasmids pSU18R2 and
pSU18R3 as templates and the oligonucleotides M13 and rM13 as primers.
The PCR products were labeled with [
-32P]dCTP
(Amersham) and separated in an agarose gel, and excised bands were
eluted with the QiaQuick gel extraction kit (Qiagen). Labeled purified
DNA fragments (1 pmol) were incubated with either IntI1, IntI1-COOH, or
control extracts for 15 min at 30°C in a 20-µl final volume
containing 50 mM Tris (pH 7.5), 100 mM NaCl, 1 mM CHAPS, 0.2 mM EDTA,
5% glycerol, 1 mM DTT, 1.5 µg of poly(dI-dC) DNA, and 0.7 µg of
bovine serum albumin. After this incubation period, the binding
reaction mixtures were electrophoresed at room temperature in 5%
polyacrylamide gels in 0.5× Tris-borate-EDTA buffer. When the purified
IntI1 protein was added to the 112-bp DNA fragment containing
attI, the mobility of the fragment was specifically lowered,
indicating IntI1 binding to this sequence (Fig.
3). On the other hand, no retardation was
observed with the 167-bp aadA1 attC fragment. The purified
IntI1-COOH protein was unable to bind to either attI or
attC dsDNA (Fig. 3). IntI1 binding to attI but
not to attC was expected from previous publications (4,
11), although it was surprising, taking into account that IntI1
from the pET3aInt plasmid exhibited a high in vivo recombination
activity at attC. Trying to find an explanation for this
apparent paradox, we thought that IntI1 could bind to DNA forms
different from the standard double helix. To investigate this
possibility, we decided to perform gel retardation assays with ssDNA
corresponding to aadA1 attC. To obtain ssDNA fragments, an
asymmetric PCR in which the primer for the desired strand was 10 times
more concentrated than the other was used. After amplification, two
products were observed on agarose gels. One of them showed the mobility
of the dsDNA product. The other was the ssDNA strand as corroborated by
susceptibility to S1 nuclease, resistance to restriction endonucleases,
hybridization in native Southern blots (17), and DNA
sequencing. ssDNA fragments were radiolabeled at the 5' end with T4
polynucleotide kinase (New England Biolabs) and
[
-32P]ATP. Labeled purified ssDNA was used in band
shift assays in the conditions described above. We labeled and purified
each of the two strands of attC and incubated them with
IntI1. As shown in the left panel of Fig.
4, IntI1 specifically retarded the bottom strand of aadA1 attC. This retardation was also observed
with IntI1-COOH but not when control extracts were tested. To confirm that the protein responsible for this band shift was really IntI1, Int
proteins were synthesized by using an in vitro transcription and
translation reticulocyte system (TNT T7 reticulocyte lysate system
[Promega]), in the presence of [35S]methionine. In
vitro-synthesized IntI1 exhibited the same site-specific ssDNA binding
activity as the protein overproduced in E. coli C41 (data
not shown). As the IntI1 protein produced in the reticulocyte lysate is
free of other E. coli proteins, we can conclude that IntI1
was responsible for the binding to the aadA1 attC bottom strand. Furthermore, since the IntI1-COOH protein also exhibited the
same ssDNA binding activity, it can be deduced that the ability of
IntI1 to bind attC ssDNA resided in its C-terminal domain. To demonstrate the specificity of IntI1 binding to ssDNA, competition experiments were carried out with an excess of nonlabeled identical DNA
(Fig. 5). This resulted in partial
inhibition of the IntI1 binding. A more-than-40-fold excess of
competitor DNA was necessary to completely displace the labeled ssDNA
from the complexes (Fig. 5, lanes 3 to 6). Addition of an equimolar or
a twofold excess of the nonlabeled opposite single strand also
diminished the formation of specific retardation bands, due to the
production of the dsDNA form by annealing of the two complementary
ssDNAs (Fig. 5, lanes 7 and 8). On the other hand, binding to
attC was not abolished when unrelated competitor DNA was
added (Fig. 5, lanes 9 and 10). These results support the idea that
IntI1 binds to ssDNA in a sequence-specific manner. Furthermore, the
addition of polyclonal anti-IntI1 antibody to the binding reaction
supershifted the IntI1-DNA complex, and a large proportion of the
radioactivity remained in the well of the gel, presumably because the
complex of DNA with the integrase and the antibody could not enter the
gel matrix (Fig. 5, lanes 11 and 12). This effect was not observed with
preimmune serum (Fig. 5, lane 13). It is interesting to note that the
antibody did not inhibit IntI1 DNA-binding function.

View larger version (112K):
[in this window]
[in a new window]
|
FIG. 3.
Gel mobility shift assays with dsDNA fragments
containing aadA1 attC (left) or the attI site
(right). Lanes 1, control dsDNA; lanes 2, dsDNA plus E. coli
C41 control extract; lanes 3, dsDNA plus pure IntI1-COOH; lanes 4, dsDNA plus purified IntI1. F, free dsDNA; B, DNA-protein complex.
|
|

View larger version (68K):
[in this window]
[in a new window]
|
FIG. 4.
Gel retardation assays with ssDNA fragments containing
either the top or the bottom strands of the aadA1 attC site
(left) or the attI site (right). The substrate DNA used is
indicated at the top of the figure. Protein extracts in each lane are
as follows: left panel, lane 1, control DNA; lane 2, E. coli
C41 control extract; lane 3, IntI1-COOH; lane 4, IntI1; lane 5 E. coli C41 control extract; lane 6, IntI1-COOH; lane 7, IntI1; lane
8, control DNA; right panel, lane 1, DNA alone; lane 2, purified IntI1;
lane 3, IntI1-COOH; lane 4, E. coli C41 control extract;
lane 5, IntI1; lane 6, IntI1-COOH; lane 7, E. coli C41
control extract; lane 8, control DNA. F, free DNA.
|
|

View larger version (110K):
[in this window]
[in a new window]
|
FIG. 5.
Competition of IntI1 binding to the bottom strand of the
aadA1 attC site and supershift experiments with anti-IntI1
antibody. Lane 1, control DNA; lane 2, IntI1 control binding reaction;
lanes 3 to 6, competition by the unlabeled attC bottom
strand; addition of 2-, 10-, 20-, and 40-fold excess unlabeled
bottom-strand aadA1 attC, respectively; lanes 7 and 8, competition by attC top strand; addition of an identical
(lane 7) or twofold (lane 8) excess amount of the top attC
aadA1 strand; lanes 9 and 10, heterologous DNA competition;
addition of an identical (lane 9) or twofold (lane 10) excess amount of
the unrelated competitor (an oligonucleotide mix); lanes 11 to 13, supershift assays with specific antisera; lane 11, incubation of IntI1
with polyclonal anti-IntI1 antibody before binding reaction; lane 12, incubation with polyclonal anti-IntI1 antibody after binding reaction;
lane 13, incubation with preimmune serum after binding reaction. ds,
dsDNA; ss, ssDNA; I and II, different protein-DNA complexes.
|
|
In addition to
aadA1 attC, IntI1 binding to a different
attC site,
aadB attC from the plasmid pRAY
(
25), was also analyzed.
Purified IntI1 was able to bind to
the bottom strand of
aadB attC but not to the ds form (data
not
shown).
IntI1 could also recognize and bind to the
attI site in ss
form (Fig.
4, right), but the proportion of the total DNA retarded
was
less than that for ss
aadA1 attC. IntI1 binding to ss
attI showed the same strand specificity observed for the
attC site.
Only the
attI bottom strand was
significantly bound to the integrase.
This binding was not observed
with IntI1-COOH. From these results,
we can reasonably conclude that
IntI1 bound both ds and ss
attI but that only ss
attC was efficiently bound by IntI1 in vitro.
The binding to
both ss primary sites was specific for the bottom
DNA strand. This
strand specificity is difficult to interpret;
however, it could be
related to the peculiar asymmetry of the
IntI1 primary sites which show
the crossover position being near
the 3' end. In previously published
works (
4,
10,
11),
the DNA used for the binding experiments
was linearly ds. In these
conditions, IntI1 binds only to
attI. The use of ss substrates
allowed us to detect binding
to
attC, an activity that was necessary
to explain IntI1
activity. Our results combine well with in vivo
observations,
suggesting that IntI1 may bind to
attI and
attC in different ways. It could be that
attI is recognized and
bound
by IntI1 in ds form but that
attC is more easily used
if it is
denatured than if it is present in ds form. Binding of enzymes
in the integrase family to ssDNA has been described previously.
Both
the Flp and Cre proteins are capable of binding ssDNA. However,
in the
case of Flp, the sequence of the ssDNA binding site was
different from
that of the ds Flp recognition target, probably
suggesting that this
capability is unrelated to the site-specific
recombination
(
30). In the case of IntI1, the ssDNA binding
site included
the recombination crossover point, indicating a
relationship with the
recombining activity and probably revealing
some structural requirement
of the target DNAs as discussed
below.
Footprinting analysis of IntI1-aadA1 binding.
DNase I protection experiments were used to localize the precise IntI1
binding sites on the attC ssDNA fragment. Two picomoles of
5'-end-labeled ssDNA aliquots was incubated with 0.1 and 0.5 µg of
purified IntI1, in a buffer containing 50 mM Tris (pH 7.5), 100 mM
NaCl, 5 mM MgCl2, 1 mM CaCl2, 5% glycerol, 1 mM DTT, 0.2 mM EDTA, and 1.5 µg of poly(dI-dC) DNA in a 20-µl final
volume, for 15 to 20 min at 30°C. Then, 10
1 DNase I
Kunitz units was added to each binding reaction mixture and incubated
for 15 min at 30°C. The resulting products were separated on 6%
polyacrylamide sequencing gels and visualized by autoradiography (Fig.
6). About 40 bases, including most of the
attC sequence, were protected. Some faint bands were
observed, probably indicating sites of incomplete protection, and some
new DNase I-hypersensitive sites appeared close to the 5' end of the protected fragment. Protection was essentially complete between nucleotides 31 and 70 (Fig. 1 and 6), possibly indicating that the DNA
was so covered by protein that DNase I had no access to it. The
protected region included two of the four putative single IntI1 binding
sites proposed previously (7, 26), considered either
pentanucleotides (GWTWM) or heptanucleotides (GTTRRRY). The two sites
in the 3' end of attC (pentanucleotides 3 and 4 [Fig. 1])
were completely protected. Pentanucleotide 1 was out of the protected
region, and the condition of pentanucleotide 2 is unknown due to the
the lack of DNase I-hypersensitive sites in this region. If we accept
the structural similarities between attI and attC
sites, we can try to compare these results with the data available for
IntI1 binding to attI (4, 11). Gravel et al.
showed that three single sites defined as GTTR were found in the part
of attI protected by IntI1 (11). These sites are equivalent to pentanucleotides 2, 3, and 4 of aadA1 attC.
Collis et al. (4) showed protection of a single site,
GTTACGC, corresponding to pentanucleotide 2. Taking
this data into account, we could assume that pentanucleotide 2 of
attC is also protected, even when we cannot draw this
conclusion from our results.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 6.
DNase I footprinting analysis of the aadA1
attC bottom strand. The ssDNA was labeled at the 5' end, incubated
with purified IntI1 protein, subjected to limited cleavage by DNase I,
and electrophoresed on a 6% sequencing gel. Lane 1, DNase I cleavage
pattern of the DNA alone; lane 2, binding reaction without DNase I
treatment; lane 3, DNase I cleavage pattern of the DNA incubated with
0.1 µg of IntI1; lane 4, DNase I cleavage pattern of the DNA
incubated with 0.5 µg of IntI1. Nucleotide numbering starts from the
5' end of the labeled fragment, as indicated in Fig. 1. Locations of
the pentanucleotides previously proposed as IntI1 binding sites are
shown by vertical arrows and numbered as in Fig. 1.
|
|
An interesting property of IntI1 primary sites is that they are large
palindromic sequences, and they could be denatured or
extruded as
cruciforms from supercoiled DNA molecules. The ssDNA
could equally fold
back as hairpins in our in vitro binding assays.
This property could
justify the IntI1 capability of binding ssDNA.
Furthermore, processes
that stabilize cruciforms or involve transient
denaturation of DNA,
such as replication or transcription, could
be favorable for
IntI1-mediated reactions, especially at sites
with poor sequence
symmetry (
9). More speculative interpretations
of the
observed ssDNA binding ability are possible, especially
in the context
of the already-proposed theory of an RNA origin
for the cassettes. In
this scenario, IntI1 should be able to bind
to RNA or to ssDNA as a
preliminary step for integration. Specific
binding of Int to ssDNA, or
to RNA, could also be important in
regulation of integron gene
expression.
Finally, we should mention that, in spite of the availability of IntI1
purified protein, we have been unable to reproduce
any biochemical
activity of IntI1 related to recombination. We
have assayed for DNA
nicking and topoisomerase activities of IntI1
with negative results.
This suggests that the Int-DNA complexes
described so far seem to be
incomplete. Accordingly, we should
wait until some activity is
reproduced in vitro before drawing
conclusions on the molecular
mechanism of IntI1-mediated
recombination.
 |
ACKNOWLEDGMENTS |
This work was supported by a grant to J.M.G.L. from the Spanish
"Fondo de Investigación Sanitaria."
We are grateful to J. E. Walker for the E. coli BL21
derivatives and to Don B. Clewell for critical reading of the manuscript.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Departamento de
Biología Molecular, Facultad de Medicina, Universidad de
Cantabria, Cardenal Herrera Oria s/n, 39011-Santander, Spain. Phone: 34 942 201948. Fax: 34 942 201945. E-mail:
jmglobo{at}medi.unican.es.
Present address: Department of Biologic and Material Sciences,
School of Dentistry, University of Michigan, Ann Arbor, MI 48109.
 |
REFERENCES |
| 1.
|
Argos, P.,
A. Landy,
K. Abremski,
J. B. Egan,
E. Haggard-Ljungquist,
R. H. Hoess,
M. L. Kahn,
B. Kalionis,
S. V. Narayana,
L. S. Pierson III,
N. Stenberg, and J. M. Leong.
1986.
The integrase family of site-specific recombinases: regional similarities and global diversity.
EMBO J.
5:433-440[Medline].
|
| 2.
|
Bartolomé, B.,
Y. Jubete,
E. Martínez, and F. de la Cruz.
1991.
Construction and properties of a family of pACYC184-derived cloning vectors compatible with pBR322 and its derivatives.
Gene
102:75-78[Medline].
|
| 3.
|
Collis, C. M.,
G. Grammaticopoulos,
J. Briton,
H. W. Stokes, and R. M. Hall.
1993.
Site-specific insertion of gene cassettes into integrons.
Mol. Microbiol.
9:41-52[Medline].
|
| 4.
|
Collis, C. M.,
M. J. Kim,
H. W. Stokes, and R. M. Hall.
1998.
Binding of the purified integron DNA integrase IntI1 to integron- and cassette-associated recombination sites.
Mol. Microbiol.
29:477-490[Medline].
|
| 5.
|
Datta, N., and R. W. Hedges.
1972.
Trimethoprim resistance conferred by W plasmids in Enterobacteriaceae.
J. Gen. Microbiol.
72:349-355[Abstract/Free Full Text].
|
| 6.
|
Esposito, D., and J. J. Scocca.
1997.
The integrase family of tyrosine recombinases: evolution of a conserved active site domain.
Nucleic Acids Res.
25:3605-3614[Abstract/Free Full Text].
|
| 7.
|
Francia, M. V.,
P. Avila,
F. de la Cruz, and J. M. García Lobo.
1997.
A hot spot in plasmid F for site-specific recombination mediated by Tn21 integron integrase.
J. Bacteriol.
179:4419-4425[Abstract/Free Full Text].
|
| 8.
|
Francia, M. V.,
F. de la Cruz, and J. M. García Lobo.
1993.
Secondary-sites for integration mediated by the Tn21 integrase.
Mol. Microbiol.
10:823-828[Medline].
|
| 9.
|
Francia, M. V., and J. M. García Lobo.
1996.
Gene integration in the Escherichia coli chromosome mediated by Tn21 integrase (Int21).
J. Bacteriol.
178:894-898[Abstract/Free Full Text].
|
| 10.
|
Gravel, A.,
N. Messier, and P. H. Roy.
1998.
Point mutations in the integron integrase IntI1 that affect recombination and/or substrate recognition.
J. Bacteriol.
180:5437-5442[Abstract/Free Full Text].
|
| 11.
|
Gravel, A.,
B. Fournier, and P. H. Roy.
1998.
DNA complexes obtained with the integron integrase IntI1 at the attI site.
Nucleic Acids Res.
26:4347-4355[Abstract/Free Full Text].
|
| 12.
|
Grinsted, J.,
F. de la Cruz, and R. Schmitt.
1990.
The Tn21 subgroup of bacterial transposable elements.
Plasmid
24:163-189[Medline].
|
| 13.
|
Hall, R. M.,
D. E. Brookes, and H. W. Stokes.
1991.
Site-specific insertion of genes into integrons: role of the 59-base element and determination of the recombination cross-over point.
Mol. Microbiol.
5:1941-1959[Medline].
|
| 14.
|
Hall, R. M., and C. M. Collis.
1995.
Mobile gene cassettes and integrons: capture and spread of genes by site-specific recombination.
Mol. Microbiol.
15:593-600[Medline].
|
| 15.
|
Hansson, K.,
O. Skold, and L. Sundstrom.
1997.
Non-palindromic attI sites of integrons are capable of site-specific recombination with one another and with secondary targets.
Mol. Microbiol.
26:441-453[Medline].
|
| 16.
|
Harlow, E., and D. Lane.
1988.
Antibodies: a laboratory manual.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y
|
| 17.
|
Hill, S. A.,
M. M. Stahl, and F. W. Stahl.
1997.
Single-strand DNA intermediates in phage lambda's Red recombination pathway.
Proc. Natl. Acad. Sci. USA
94:2951-2956[Abstract/Free Full Text].
|
| 18.
|
Kwon, H. J.,
R. Tirumalai,
A. Landy, and T. Ellenberger.
1997.
Flexibility in DNA recombination: structure of the lambda integrase catalytic core.
Science
276:126-131[Abstract/Free Full Text].
|
| 19.
|
Martínez, E., and F. de la Cruz.
1990.
Genetic elements involved in Tn21 site-specific integration, a novel mechanism for the dissemination of antibiotic resistance genes.
EMBO J.
9:1275-1281[Medline].
|
| 20.
|
Martínez, E., and F. de la Cruz.
1988.
Transposon Tn21 encodes a RecA-independent site-specific integration system.
Mol. Gen. Genet.
211:320-325[Medline].
|
| 21.
|
Miroux, B., and J. E. Walker.
1996.
Over-production of proteins in Escherichia coli: mutant hosts that allow synthesis of some membrane proteins and globular proteins at high levels.
J. Mol. Biol.
260:289-298[Medline].
|
| 22.
|
Recchia, G. D., and R. M. Hall.
1995.
Plasmid evolution by acquisition of mobile gene cassettes: plasmid pIE723 contains the aadB gene cassette precisely inserted at a secondary site in the incQ plasmid RSF1010.
Mol. Microbiol.
15:179-187[Medline].
|
| 23.
|
Rosenberg, A. H.,
B. N. Lade,
D. S. Chui,
S. W. Lin,
J. J. Dunn, and F. W. Studier.
1987.
Vectors for selective expression of cloned DNAs by T7 RNA polymerase.
Gene
56:125-135[Medline].
|
| 24.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y
|
| 25.
|
Segal, H., and B. G. Elisha.
1997.
Identification and characterization of an aadB gene cassette at a secondary site in a plasmid from Acinetobacter.
FEMS Microbiol. Lett.
153:321-326[Medline].
|
| 26.
|
Stokes, H. W.,
D. B. O'Gorman,
G. D. Recchia,
M. Parsekhian, and R. M. Hall.
1997.
Structure and function of 59-base element recombination sites associated with mobile gene cassettes.
Mol. Microbiol.
26:731-745[Medline].
|
| 27.
|
Stokes, H. W., and R. M. Hall.
1989.
A novel family of potentially mobile DNA elements encoding site-specific gene-integration functions: integrons.
Mol. Microbiol.
3:1669-1683[Medline].
|
| 28.
|
Studier, F. W.,
A. H. Rosenberg,
J. J. Dunn, and J. W. Dubendorff.
1990.
Use of T7 RNA polymerase to direct expression of cloned genes.
Methods Enzymol.
185:60-89[Medline].
|
| 29.
|
Tirumalai, R. S.,
E. Healey, and A. Landy.
1997.
The catalytic domain of site-specific recombinase.
Proc. Natl. Acad. Sci. USA
94:6104-6109[Abstract/Free Full Text].
|
| 30.
|
Zhu, X. D., and P. D. Sadowski.
1998.
Selection of novel, specific single-stranded DNA sequences by Flp, a duplex-specific DNA binding protein.
Nucleic Acids Res.
26:1329-1336[Abstract/Free Full Text].
|
Journal of Bacteriology, November 1999, p. 6844-6849, Vol. 181, No. 21
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Francia, M. V., Weaver, K. E., Goicoechea, P., Tille, P., Clewell, D. B.
(2007). Characterization of an Active Partition System for the Enterococcus faecalis Pheromone-Responding Plasmid pAD1. J. Bacteriol.
189: 8546-8555
[Abstract]
[Full Text]
-
Demarre, G., Frumerie, C., Gopaul, D. N., Mazel, D.
(2007). Identification of key structural determinants of the IntI1 integron integrase that influence attC x attI1 recombination efficiency. Nucleic Acids Res
35: 6475-6489
[Abstract]
[Full Text]
-
Johansson, C., Kamali-Moghaddam, M., Sundstrom, L.
(2004). Integron integrase binds to bulged hairpin DNA. Nucleic Acids Res
32: 4033-4043
[Abstract]
[Full Text]
-
Francia, M. V., Fujimoto, S., Tille, P., Weaver, K. E., Clewell, D. B.
(2004). Replication of Enterococcus faecalis Pheromone-Responding Plasmid pAD1: Location of the Minimal Replicon and oriV Site and RepA Involvement in Initiation of Replication. J. Bacteriol.
186: 5003-5016
[Abstract]
[Full Text]
-
Moore, R. B., Ferguson, K. M., Loh, W. K. W., Hoegh-Guldberg, O., Carter, D. A.
(2003). Highly organized structure in the non-coding region of the psbA minicircle from clade C Symbiodinium. Int. J. Syst. Evol. Microbiol.
53: 1725-1734
[Abstract]
[Full Text]