Previous Article | Next Article 
Journal of Bacteriology, November 1999, p. 6876-6881, Vol. 181, No. 22
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
CzcD Is a Heavy Metal Ion Transporter Involved in
Regulation of Heavy Metal Resistance in Ralstonia sp.
Strain CH34
Andreas
Anton,
Cornelia
Große,
Jana
Reißmann,
Thomas
Pribyl, and
Dietrich H.
Nies*
Institut für Mikrobiologie,
Martin-Luther-Universität Halle-Wittenberg, D-06099 Halle,
Germany
Received 13 July 1999/Accepted 31 August 1999
 |
ABSTRACT |
The Czc system of Ralstonia sp. strain CH34 mediates
resistance to cobalt, zinc, and cadmium through ion efflux catalyzed by
the CzcCB2A cation-proton antiporter. The CzcD protein is
involved in the regulation of the Czc system. It is a membrane-bound
protein with at least four transmembrane
-helices and is a member of a subfamily of the cation diffusion facilitator (CDF) protein family,
which occurs in all three domains of life. The deletion of
czcD in a Ralstonia sp. led to partially
constitutive expression of the Czc system due to an increased
transcription of the structural czcCBA genes, both in the
absence and presence of inducers. The czcD deletion could
be fully complemented in trans by CzcD and two other CDF
proteins from Saccharomyces cerevisiae, ZRC1p and COT1p.
All three proteins mediated a small but significant resistance to
cobalt, zinc, and cadmium in Ralstonia, and this resistance was based on a reduced accumulation of the cations. Thus, CzcD appeared
to repress the Czc system by an export of the inducing cations.
 |
INTRODUCTION |
CzcD from Ralstonia sp.
strain CH34 (formerly Alcaligenes eutrophus [1,
13]) and ZRC1p from Saccharomyces cerevisiae (6) were the first two published members of the cation
diffusion facilitator (CDF) protein family (17, 23). The
members of this family are all predicted to be membrane-bound proteins,
mostly with six assumed transmembrane-spanning
-helices. The CDF
proteins seem to interact with the divalent cations of zinc, cadmium,
and cobalt. The transport of divalent heavy metal cations has been shown for COT1p from S. cerevisiae (2), for some
mammalian ZnT proteins (21, 22), and for a CDF protein from
Staphylococcus aureus (28).
On the other hand, CDF proteins were found to be involved in regulatory
processes (5, 13): ZRC1p seems to regulate glutathione biosynthesis, and CzcD is involved in the regulation of a zinc, cobalt,
and cadmium efflux system, the Czc system, which mediates resistance to
these heavy metal cations in Ralstonia sp. strain CH34. The
Czc system probably transports the toxic heavy metals across both
membranes of the gram-negative bacterium (24). This transenvelope efflux is mediated by the CzcCB2A protein
complex, a proton-cation antiporter (12). The
czcCBA genes (16) are located on one of the two
megaplasmids of strain CH34, plasmid pMOL30, and are flanked by genes
encoding regulators, czcNI upstream and czcDRS
downstream of czcCBA (13, 27). Transcription
probably starts at four promoters, czcNp, czcIp,
czcCp, and czcDp, and leads to a variety of
transcripts in the czcNICBA region and to a tricistronic
czcDRS message (4). In the current model of Czc
system regulation (4), CzcN and CzcI may regulate the
activity of a hypothetical extracellular function sigma factor while
the two-component regulatory system made up of CzcR (response
regulator) and CzcS (sensor histidine kinase) regulates the expression
of CzcN.
CzcD is not essential for Czc system regulation but is needed to
regulate the expression of a czcC::lacZ
fusion when a constitutively expressed CzcCB2A efflux
complex diminishes the cytoplasmic inducer concentration
(13). In this publication, the function of CzcD in the Czc
regulatory network is defined.
 |
MATERIALS AND METHODS |
Bacterial strains and growth conditions.
Tris-buffered
mineral salts medium containing 2 g of sodium gluconate/liter was
used to cultivate Ralstonia strains, all derivatives of the
wild-type strain CH34(pMOL28, pMOL30) (9). Strain
AE128(pMOL30) harbors megaplasmid pMOL30 with the czc
determinant only, and strain AE104 is a plasmid-free, metal-sensitive
derivative of strain CH34 (9). Strain DN175(pMOL30-9) has an
insertion of a lacZ gene in the czcCBA operon
between czcC and czcB (4). The
czcD gene was cloned into the broad-host-range plasmid
pVDZ'2 (3) under the control of the lac promoter
which is constitutively expressed by Ralstonia
(16), leading to plasmid pDNA176. Additionally, the S. cerevisiae genes ZRC1 and COT1 were PCR
amplified and cloned into the same vector plasmid, leading to plasmids
pDNA178 and pDNA177, respectively. Analytical-grade salts of
CdCl2 · H2O, ZnCl2, and
CoCl2 · 6H2O were used to prepare 1 M
stock solutions, which were sterilized by filtration. Solid
Tris-buffered media contained 20 g of agar/liter. Uptake
experiments were performed by the filtration technique as described
previously (19), but 10 mM Tris-HCl (pH 7.0) containing 10 mM MgCl2 was used to wash the cells on the filters.
109CdCl2 (1 Ci/g) and
65ZnCl2 (1.84 Ci/g) were from NEN (Brussels,
Belgium), and 57CoCl2 (4,000 Ci/g) was from
Amersham (Braunschweig, Germany).
Genetic techniques.
Standard molecular genetic techniques
were used (10, 25). For conjugal gene transfer, overnight
cultures of donor strain Escherichia coli S17/1
(26) and of the Ralstonia recipient strains grown
at 30°C in complex medium were mixed (1:1) and plated onto nutrient
broth agar. After overnight growth, the bacteria were suspended in
saline (9 g of NaCl/liter), diluted, and plated onto selective media as
previously described (11). The total RNA of the
Ralstonia organisms was isolated as described previously (20). PCGENE (IntelliGenetics, Mountain View, Calif.) was
used as the standard computer program for the analysis of DNA sequences.
Reporter gene fusions.
Fusion vectors pECD499
(lacZ fusions) and pECD500 (phoA fusions)
(24) and E. coli CC118 were used (8).
The specific activities of alkaline phosphatase (8) and
-galactosidase (13) were determined in triplicate as
published previously (15). From each mean value, the
negative control value (vector control without insert) was subtracted.
The result was divided by the highest specific activity, which was 2.12 U/g (dry weight) for PhoA (fusion I-115) and 37.3 U/mg (dry weight)
(control of a nonfused lacZ gene without leader) for LacZ,
leading to the relative activities for each fusion point.
Construction of knockout mutations in czc genes
(4).
To prevent polar effects mediated by the deletion
of the czcD gene from megaplasmids pMOL30 containing
czcNICBADRS (9) and pMOL30-9 harboring
(czcNIC-lacZ-czcBADRS) (4), czcD
was exchanged for a small open reading frame encoding a polypeptide of
20 amino acids (aa). The first nine aa coded by this small open reading
frame were identical with the nine amino-terminal amino acids of CzcD,
and the last 9 aa were identical with the last carboxy-terminal amino
acids of CzcD. Residues 10 and 11 were E and L, respectively, and were
coded by the hexanucleotide recognition sequence CAATTG of
the restriction endonuclease MunI. Thus, the 500 bp upstream
of czcD were amplified by PCR, and this fragment ended with
the 27-bp sequence coding for the first 9 aa of the respective gene
product, followed by a MunI hexanucleotide. Secondly, the
500 bp downstream of czcD were amplified by PCR, and this
fragment started with the MunI recognition sequence and the
last 27 bp of the respective gene. Both fragments were fused by
MunI restriction and ligation, cloned, verified by DNA
sequencing, and finally cloned into pLO2 (7). The resulting
plasmid was used for mutating Ralstonia organisms as
described previously (4), leading to plasmid pMOL30-14 in
strain DN182(pMOL30-14) (czcNICBA
czcD czcRS) and plasmid
pMOL30-15 in strain DN183(pMOL30-15) [
(czcNIC-lacZ-czcBA)
czcD czcRS]. The
mutant genotypes were verified by PCR and DNA sequencing.
Competitive RT-PCR (5).
DNase-treated total RNA
was isolated from cells of Ralstonia sp. strains
AE128(pMOL30) (9) and DN182(pMOL30-14) (
czcD) either without induction or after induction for 10 min with 300 µM
Zn2+. One microgram of this total RNA was reverse
transcribed with 100 U of Superscript II RT (Gibco BRL, Karlsruhe,
Germany) and 50 pmol of random primer in a total volume of 20 µl. To
determine the amount of czcCBA mRNA-specific cDNA for each
strain and induction condition, different amounts of an internal DNA
standard were added to 0.5 µl of the resulting cDNA solution, and the
mixture was amplified with 100 µM concentrations of deoxynucleoside
triphosphates, 10 pmol of primers (3' antisense primer B,
ATGCCACCGATTACCACCGTTGCGA, positions 7144 to 7120 [gbX98451] in czcA [positions 4092 to 7283], and 5'
sense primer A, ATTGGTTCATTCGTGCCCG, positions 6615 to 6633 in czcA] and 1 U of Taq polymerase (Qiagen,
Hilden, Germany) in a total volume of 50 µl by the following PCR
program: 2.30 min at 94°C, 1 min at 60°C, and 1 min at 72°C as
the initial cycle, and a further 28 cycles of 1 min at 94°C, 1 min at
60°C, and 1 min at 72°C, with final extension for 5 min at 72°C.
A 10-µl amount of each PCR product was analyzed on a 1.5% agarose
gel stained with ethidium bromide. The relative amounts of
czcCBA cDNA (529 bp) and internal DNA standard (237 bp)
products were quantified after densitometric analysis with ScanPack 2.0 software (Biometra, Göttingen, Germany). For each lane, which
represents cDNA with one of the internal DNA standards, the resulting
spot intensities were first normalized for the lengths of the cDNA (529 and 237 bp, respectively, for czcCBA cDNA and the internal
standard), and then the normalized czcCBA cDNA intensity was
divided by the normalized density of the internal standard. For all
lanes, the logarithm of this quotient was plotted against the logarithm
of the amount of the internal standard used in the respective
competition experiment. A linear regression was calculated for these
points, and this line intercepts the x axis exactly at the
point where the amount of the internal standard is identical with the
amount of the czcCBA-specific cDNA in the reverse
transcription (RT) probe. This value was used to calculate the
czcCBA-specific cDNA per microgram of total RNA used.
Control assays were as follows: a complete assay without template, a
complete assay with RNA template but without RT, and a complete assay
with total RNA isolated from the plasmid-free Ralstonia
strain AE104. All controls were negative.
For the construction of a specific internal standard, a 529-bp part of
czcA was amplified with primers A and B. This fragment
was
purified and used as the template in a PCR experiment with
a loop-out
primer
(
ATTGGTTCATTCGTGCCCGGGCGGTGCTCAATGGTCTG)
and primer B. The loop-out primer was identical in the first 19
nucleotides (underlined) to primer A, and the remaining 19 nucleotides
(bold) were the base pairs in positions 6926 to 6944 (gbX98451)
of
czcA, which are located between the positions of primers A
and B. Thus, a 237-bp PCR product which could be clearly differentiated
from the 529-bp
czcCBA cDNA product was amplified, but it
had
the same ends as the 529-bp fragment. The 237-bp PCR product was
isolated, cleaned with QIAquick, quantified (GeneQuant; Pharmacia,
Uppsala, Sweden), diluted, and used for competitive RT-PCR.
 |
RESULTS |
Topological analysis of CzcD.
The structure of the CzcD
protein from Ralstonia was investigated by using
translational lacZ and phoA fusions. Starting
with the 5' end, variously sized parts of the respective
czcD gene were amplified and cloned into the fusion vectors
pECD499 and pECD500 (24).
The amino terminus of CzcD is followed by four hydrophobic peaks (Fig.
1). Fusions between those peaks gave
evidence for an
alternation between periplasmic and cytoplasmic
localizations
of the fusion points (Fig.
1). Thus, the amino terminus
of CzcD
is followed by four transmembrane

-helices, I, II, III, and
IV.
The activity of the fusions plus the pattern of positively charged
amino acid residues indicate a cytoplasmic localization of the
N
terminus and of the regions between helices II and III and downstream
of helix IV. After these four spans (fusion position Y152), two
more
hydrophobic peaks occur. Although the fusions at position
S203 after
both peaks strongly indicate a cytoplasmic localization,
two
independent fusions between both peaks (T175 and W177) gave
no evidence
for a periplasmic localization (Fig.
1). LacZ and
PhoA fusions at the
carboxy terminus of CzcD had a very low specific
activity. However, the
absence of hydrophobic peaks downstream
of S203 and the high LacZ
activity of the S203 fusion could mean
a cytoplasmic localization of
the C terminus of CzcD.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 1.
Topological structure of CzcD. Parts of the
czcD gene of Ralstonia were fused with the
lacZ or phoA topological reporter gene. The
czcD parts were from the 5' end of the gene up to the points
indicated by the positions of the bars. The relative activities of the
reporter enzymes are indicated by overlapping white (LacZ) and black
bars (PhoA), with error bars representing standard deviations. Above
the hydrophobicity plot are the positions of putative metal-binding
amino acid residues (in panel M, residues H [full-size bars] and C
[half bars]), acidic amino acid residues (in panel A, residues D
[two-thirds bars] and E [full-size bars]), and basic amino acid
residues (in panel B, residues H [half bars], R [full-size bars],
and K [two-thirds bars]).
|
|
Thus, both termini of CzcD are probably in the cytoplasm and the amino
terminus is clearly followed by four transmembrane

-helices. The
existence of the two subsequent transmembrane spans
could not be
proven; this may be the result of a limitation of
the method used, or
spans V and VI may be reversibly integrated
into the membrane as part
of the catalytic cycle or a regulatory
event. However, CzcD should be
an integral protein of the cytoplasmic
membrane, with at least four and
a maximum of six transmembrane

-helices.
A
czcD mutant is impaired in metal sensing.
Mutants with in-frame
czcD deletions were constructed
from Ralstonia strains AE128(pMOL30)
(czcNICBADRS) (9) and DN175(pMOL30-9) [
(czcNIC-lacZ-czcBADRS)] (4), leading to
strains DN182(pMOL30-14) (czcNICBA
czcD czcRS) and
DN183(pMOL30-15) [
(czcNIC-lacZ-czcBA)
czcD
czcRS], respectively. As judged from the MICs, the resistances of
the
czcD strains DN182 and DN183 to zinc were slightly
lower than those of their isogenic CzcD+ strains, AE128 and
DN175, respectively. In the presence of 7 mM Zn2+, both
czcD deletion strains produced only a few single colonies on solid medium while the wild-type strains displayed full growth (data
not shown). There was no effect on the MICs of cobalt and cadmium and
no significant difference in the induction of the
-galactosidase
reporter gene at most metal cation concentrations when strains DN175
and DN183 were compared (data not shown). However, when the
-galactosidase activities of the
czcD strain and the wild-type strain were compared after induction by 300 µM
Co2+, 100 µM Cd2+, or 10 µM
Zn2+, the
czcD strain reached a higher
expression level after 2 h (Table
1). In addition, the
-galactosidase
activity in uninduced cells of the
czcD strain was twice
as high as the activity in uninduced wild-type cells (Table 1).
When strains AE128(pMOL30) and DN182(pMOL30-14) (
czcD)
were precultivated in the absence of Zn
2+ or in 300 µM
Zn
2+ and then transferred to a liquid medium containing 2.5 mM Zn
2+, the
czcD deletion strain started to
grow immediately in both
cases but the wild-type strain grew only
without a lag phase when
it was preadapted in the presence of 300 µM
Zn
2+ (Fig.
2A). To examine
this effect more closely, the concentration
of
czcCBA mRNA
in both strains was judged by the amount of respective
cDNA measured by
competitive RT-PCR (Table
2). In both the
deletion
and wild-type strains,
czcCBA was inducible, but
the mRNA level
in the deletion strain was 10-fold higher than that in
the wild-type
strain under noninduced and induced conditions (Table
2).
Thus,
CzcD represses
czc induction either by inducer
exclusion or by
some kind of protein-protein interaction.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 2.
Effect of czcD mutation on growth in
presence of zinc. Cells of strain AE128(pMOL30) ( and ), its
czcD mutant strain DN182(pMOL30-14) ( and ), strain
DN182 complemented in trans with pDNA176 containing
czcD ( and ), pDNA178 containing ZRC1 ( and ), and pDNA177 containing COT1 ( and ) were
cultivated for 48 h at 30°C in Tris-buffered mineral salts
medium containing 2 g of sodium gluconate/liter as the carbon
source. The cells were diluted in fresh medium containing 300 µM
Zn2+ as the inducer (closed symbols) or no inducer (open
symbols). Incubation was continued for 10 h, and then the cells
were diluted to a cell density of up to 10 Klett units in fresh medium
containing 2.5 mM Zn2+.
|
|
By comparing the mRNA data and the growth curves, it was found that a
15-fold overexpression of
czcCBA in the
czcD
deletion
strain was sufficient for the cells to start growing
immediately
in the presence of 2.5 mM Zn
2+. However,
differences in the

-galactosidase activity were visible
only in the
presence of 10 µM Zn
2+. This difference cannot be
explained at the
moment.
CzcD mediates a low-level metal ion resistance, probably by
efflux.
To determine if CzcD transports cations, the
czcD gene was cloned into plasmid pVDZ'2 (3),
leading to plasmid pDNA176. This plasmid was transferred to
plasmid-free Ralstonia strain AE104. At most metal ion
concentrations, no difference in metal ion resistance between
AE104(pDNA176) and the negative control strain AE104(pVDZ'2) (data not
shown) was observed. However, with 100 µM cobalt, 100 µM cadmium,
or 200 µM zinc, the control strain AE104(pVDZ'2) was not able to
grow, in contrast to AE104(pDNA176) (Fig.
3). Thus, the expression of CzcD mediates
a small degree of metal ion resistance which is below the resistance
level obtained when the protein CzcA is expressed alone
(24). With the protection of CzcA, it took the cells 20 h to grow up to 300 Klett units in the presence of 200 µM
Zn2+ (24); with CzcD, it took 125 h for the
cells to reach 200 Klett units (Fig. 3). In both cases, the negative
control strain did not grow.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 3.
CDF proteins mediate metal ion resistance.
Ralstonia strain AE104 containing plasmids pVDZ'2 without an
insert ( ), pDNA176 with czcD ( ), pDNA177 with
COT1 ( ), or pDNA178 with ZRC1 ( ) was
cultivated in the presence of 100 µM Co2+ (A), 200 µM
Zn2+ (B), or 100 µM Cd2+ (C), and the optical
density over time was monitored. For each strain and metal ion, the
results of two independent experiments are shown.
|
|
Resistance mediated by a membrane-integrated histidine-rich protein may
be based on the binding of the metal by the histidine
residues and/or
metal ion efflux. Binding should increase the
amount of metal ions in
resistant cells compared to that in sensitive
ones, while efflux should
decrease the amount of cell-bound metal
ions. When levels of cell-bound
metal ions in cells with and without
overexpressed CzcD were compared,
resistant cells contained only
20 to 50% of the cobalt, zinc, or
cadmium that the respective
control cells contained (Fig.
4). There was no difference in the
initial velocity of zinc or cadmium entry between cells of both
strains
(Fig.
5A and C). The uptake of cobalt in
the first minutes
was slow, with strong fluctuations between different
experiments
(Fig.
5B). Thus, CzcD mediates a reduced accumulation of
Zn
2+, Co
2+, and Cd
2+. Since the
initial velocities of metal cation uptake with and
without CzcD were
identical, this reduced accumulation is probably
based on the efflux of
metal cations, at least in the cases of
zinc and cadmium. Since CzcD is
located in the cytoplasmic membrane,
indicated by the fusion data, this
efflux is across the cytoplasmic
membrane.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 4.
Accumulation of heavy metal ions by Ralstonia
strains expressing various CDF genes. Ralstonia strain AE104
containing plasmids pVDZ'2 without an insert ( ), pDNA176 with
czcD ( ), pDNA177 with COT1 ( ), or pDNA178
with ZRC1 ( ) was cultivated in Tris-buffered mineral
salts medium containing 2 g of sodium gluconate/liter. The cells
were harvested, washed, and suspended in 10 mM Tris-HCl buffer (pH 7.0)
containing 2 g of sodium gluconate/liter. Radioactive metal
isotopes at 1 or 100 µM were added, and incubation was continued with
shaking at 30°C. Samples of 200 µl were removed, filtered (pore
diameter, 0.45 µm), and washed twice on the filter with 2 ml of 10 mM
Tris-HCl (pH 7.0) containing 10 mM MgCl2. Radioactivity was
determined with a scintillation counter (Beckman, Munich, Germany), and
the dry weight (dw) was determined from the optical density with a
calibration curve.
|
|

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 5.
Fast uptake of heavy metal ions by Ralstonia
strains expressing various CDF genes. Ralstonia strain AE104
containing plasmids pVDZ'2 without an insert ( ), pDNA176 with
czcD ( ), pDNA177 with COT1 ( ), or pDNA178
with ZRC1 ( ) was cultivated in Tris-buffered mineral
salts medium containing 2 g of sodium gluconate/liter. The cells
were harvested, washed, and suspended in 10 mM Tris-HCl buffer (pH 7.0)
containing 2 g of sodium gluconate/liter. The radioactive metal
isotopes 65Zn2+ (A),
57Co2+ (B), and 109Cd2+
(C) at 100 µM were added, and metal uptake was measured as described
for Fig. 4. d.w., dry weight.
|
|
ZRC1p and COT1p mediate a low-level metal ion resistance.
The
genes of the two CDF proteins from yeast were cloned into plasmid
pVDZ'2, leading to plasmids pDNA178 (containing ZRC1) and
pDNA177 (containing COT1). Both plasmids mediated a degree of metal ion resistance comparable to that mediated by pDNA176 containing czcD (Fig. 3).
ZRC1p expression led to effects similar to CzcD expression concerning
zinc and cadmium (Fig.
4 and
5), but ZRC1p was not as
efficient as CzcD
concerning the reduced accumulation of cobalt.
If CzcD constitutes an
efflux system for zinc, cobalt, and cadmium,
then ZRC1p should function
in the same manner. Although COT1p
provided the same degree of metal
resistance as ZRC1p and CzcD,
the effect obtained by COT1p expression
varied with the metal
ion and its concentration (Fig.
4). With 100 µM
Zn
2+ or 1 µM Co
2+, COT1p mediated a reduced
accumulation, and it is probably an
efflux system. In contrast, with 1 µM Zn
2+, COT1p-containing cells accumulated more zinc
than control cells,
so COT1p should enhance the uptake and/or binding
of zinc (Fig.
4A). Moreover, the uptake of 100 µM Zn
2+
was faster in COT1p-containing cells than in CzcD- or ZRC1p-containing
cells or control cells (Fig.
5A). Thus, the yeast CDF proteins
work
similarly to CzcD; however, the transport of cations across
the
cytoplasmic membrane may be in both directions, depending
on the
concentration.
Expression of ZRC1p and COT1p complements a czcD
mutation.
To analyze the complementation of the
czcD
mutation by czcD in trans, plasmid pDNA176 was
transferred into DN182. The resulting transconjugant strain showed a
lag phase of growth in the presence of 2.5 mM Zn2+ when the
cells were not adapted by precultivation in 300 µM Zn2+
(Fig. 2B). Similarly to pDNA176, the ZRC1- and
COT1-containing plasmids pDNA178 and pDNA177 were
transferred into DN182(pMOL30-14) (
czcD). Both
plasmids complemented the
czcD mutation as well as the
czcD-containing plasmid (Fig. 2B). Thus, the two yeast CDF
proteins were fully functional as participants of the Czc regulatory network.
 |
DISCUSSION |
In Ralstonia spp., CzcD and the two yeast CDF proteins
ZRC1p and COT1p catalyze a reduced accumulation of heavy-metal ions, which is probably based on metal cation efflux. Since CzcD is located
in the cytoplasmic membrane, this means there is an export of
heavy-metal cations from the cytoplasm into the periplasm.
COT1p, which does not function well as an efflux system with 100 µM
Co2+ in Ralstonia, nevertheless gives the same
degree of resistance to 100 µM Co2+ as ZRC1p and CzcD do;
therefore, the large histidine-rich domains of the protein might
detoxify cobalt cations by binding them. The CDF proteins might
function as a kind of heavy-metal buffer for the cell by performing the
following: importing heavy metals when the magnesium transport system
(18) is too slow to supply sufficient amounts of the trace
elements cobalt or zinc (e.g., due to competitive inhibition by high
magnesium concentrations), binding the heavy-metal cations, and
exporting the heavy-metal cations when the cytoplasmic concentration
becomes too high. Only when the capacity of this system is exhausted by
too low or too high heavy-metal concentrations may additional energy
sources have to be tapped to drive increased accumulation (e.g.,
by P-type or ATP-binding cassette uptake ATPases) or increased
efflux (e.g., by P-type export ATPases or the Czc proton-cation antiporter).
CzcD not only protects the cell against toxic heavy metals, albeit at a
lower level than CzcCB2A does, but also is involved in the
regulation of expression of the CzcCB2A efflux system. Deletion of the czcD gene results in a higher
czcCBA mRNA level in uninduced and induced cells, which is
sufficient to produce enough CzcCB2A efflux complex for an
initial protection against 2.5 mM Zn2+. As shown by primer
extension and RT-PCR, the czcNICBA region is transcribed
from three promoters, czcNp, czcIp, and
czcCp (4). The two-component regulatory system
CzcRS regulates only czcNp (4). CzcS, the sensor
protein, may sense only cytoplasmic cations (14). Thus,
since no other Czc protein is located in the cytoplasm except for CzcR,
the presence of heavy metals in the cytoplasm should lead to
transcription initiation from czcNp with a signal chain via
CzcS and CzcR. Because deletion of the genes czcR or czcS does not abolish Czc system induction (4),
other metal-sensing components are involved in Czc system regulation,
and these may be located in the periplasm (e.g., CzcI) or the
cytoplasmic membrane (e.g., CzcN).
 |
ACKNOWLEDGMENTS |
This work was supported by Forschungsmittel des Landes
Sachsen-Anhalt, the Deutsche Forschungsgemeinschaft (Graduiertenkolleg Streß), and Fonds der Chemischen Industrie.
We thank Grit Schleuder for skillful technical assistance, Daniel van
der Lelie for a COT1-containing plasmid, Oliver Lenz and
Bärbel Friedrich for pLO2, and students of the radioisotope course of the Graduiertenkolleg Streß for helping with the uptake experiments. Also, we thank Joseph Lengeler for a very fruitful discussion.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Institut
für Mikrobiologie, Martin-Luther-Universität
Halle-Wittenberg, Kurt-Mothes-Str. 3, D-06099 Halle, Germany. Phone:
(49)-345-5526352. Fax: (49)-345-5527010. E-mail:
d.nies{at}mikrobiologie.uni-halle.de.
 |
REFERENCES |
| 1.
|
Brim, H.,
M. Heyndrickx,
P. De Vos,
A. Wilmotte,
D. Springael,
H. G. Schlegel, and M. Mergeay.
1999.
Amplified rDNA restriction analysis and further genotypic characterisation of metal-resistant soil bacteria and related facultative hydrogenotrophs.
Syst. Appl. Microbiol.
22:258-268[Medline].
|
| 2.
|
Conklin, D. S.,
J. A. McMaster,
M. R. Culbertson, and C. Kung.
1992.
COT1, a gene involved in cobalt accumulation in Saccharomyces cerevisiae.
Mol. Cell. Biol.
12:3678-3688[Abstract/Free Full Text].
|
| 3.
|
Deretic, V.,
S. Chandrasekharappa,
J. F. Gill,
D. K. Chatterjee, and A. Chakrabarty.
1987.
A set of cassettes and improved vectors for genetic and biochemical characterization of Pseudomonas genes.
Gene
57:61-72[Medline].
|
| 4.
|
Große, C.,
G. Grass,
A. Anton,
S. Franke,
A. Navarrete Santos,
B. Lawley,
N. L. Brown, and D. H. Nies.
1999.
Transcriptional organization of the czc heavy-metal homoeostasis determinant from Alcaligenes eutrophus.
J. Bacteriol.
181:2385-2393[Abstract/Free Full Text].
|
| 5.
|
Inoue, Y.,
S. Kobayashi, and A. Kimura.
1993.
Cloning and phenotypic characterization of a gene enhancing resistance against oxidative stress in Saccharomyces cerevisiae.
J. Ferment. Bioeng.
75:327-331.
|
| 6.
|
Kamizomo, A.,
M. Nishizawa,
A. Teranishi,
K. Murata, and A. Kimura.
1989.
Identification of a gene conferring resistance to zinc and cadmium ions in the yeast Saccharomyces cerevisiae.
Mol. Gen. Genet.
219:161-167[Medline].
|
| 7.
|
Lenz, O.,
E. Schwartz,
J. Dernedde,
M. Eitinger, and B. Friedrich.
1994.
The Alcaligenes eutrophus H16 hoxX gene participates in hydrogenase regulation.
J. Bacteriol.
176:4385-4393[Abstract/Free Full Text].
|
| 8.
|
Manoil, C.
1990.
Analysis of protein localization by use of gene fusions with complementary properties.
J. Bacteriol.
172:1035-1042[Abstract/Free Full Text].
|
| 9.
|
Mergeay, M.,
D. Nies,
H. G. Schlegel,
J. Gerits,
P. Charles, and F. Van Gijsegem.
1985.
Alcaligenes eutrophus CH34 is a facultative chemolithotroph with plasmid-bound resistance to heavy metals.
J. Bacteriol.
162:328-334[Abstract/Free Full Text].
|
| 10.
|
Nies, A.,
D. H. Nies, and S. Silver.
1989.
Cloning and expression of plasmid genes encoding resistances to chromate and cobalt in Alcaligenes eutrophus.
J. Bacteriol.
171:5065-5070[Abstract/Free Full Text].
|
| 11.
|
Nies, D.,
M. Mergeay,
B. Friedrich, and H. G. Schlegel.
1987.
Cloning of plasmid genes encoding resistance to cadmium, zinc, and cobalt in Alcaligenes eutrophus CH34.
J. Bacteriol.
169:4865-4868[Abstract/Free Full Text].
|
| 12.
|
Nies, D. H.
1995.
The cobalt, zinc, and cadmium efflux system CzcABC from Alcaligenes eutrophus functions as a cation-proton antiporter in Escherichia coli.
J. Bacteriol.
177:2707-2712[Abstract/Free Full Text].
|
| 13.
|
Nies, D. H.
1992.
CzcR and CzcD, gene products affecting regulation of resistance to cobalt, zinc, and cadmium (czc system) in Alcaligenes eutrophus.
J. Bacteriol.
174:8102-8110[Abstract/Free Full Text].
|
| 14.
|
Nies, D. H., and N. Brown.
1998.
Two-component systems in the regulation of heavy metal resistance, p. 77-103.
In
S. Silver, and W. Walden (ed.), Metal ions in gene regulation. Chapman & Hall, London, England
|
| 15.
|
Nies, D. H.,
S. Koch,
S. Wachi,
N. Peitzsch, and M. H. Saier, Jr.
1998.
CHR, a novel family of prokaryotic proton motive force-driven transporters probably containing chromate/sulfate antiporters.
J. Bacteriol.
180:5799-5802[Abstract/Free Full Text].
|
| 16.
|
Nies, D. H.,
A. Nies,
L. Chu, and S. Silver.
1989.
Expression and nucleotide sequence of a plasmid-determined divalent cation efflux system from Alcaligenes eutrophus.
Proc. Natl. Acad. Sci. USA
86:7351-7355[Abstract/Free Full Text].
|
| 17.
|
Nies, D. H., and S. Silver.
1995.
Ion efflux systems involved in bacterial metal resistances.
J. Ind. Microbiol.
14:186-199[Medline].
|
| 18.
|
Nies, D. H., and S. Silver.
1989.
Metal ion uptake by a plasmid-free metal-sensitive Alcaligenes eutrophus strain.
J. Bacteriol.
171:4073-4075[Abstract/Free Full Text].
|
| 19.
|
Nies, D. H., and S. Silver.
1989.
Plasmid-determined inducible efflux is responsible for resistance to cadmium, zinc, and cobalt in Alcaligenes eutrophus.
J. Bacteriol.
171:896-900[Abstract/Free Full Text].
|
| 20.
|
Oelmüller, U.,
N. Krüger,
A. Steinbüchel, and C. G. Friedrich.
1990.
Isolation of prokaryotic RNA and detection of specific mRNA with biotinylated probes.
J. Microbiol. Methods
11:73-84.
|
| 21.
|
Palmiter, R. D.,
T. B. Cole, and S. D. Findley.
1996.
ZnT-2, a mammalian protein that confers resistance to zinc by facilitating vesicular sequestration.
EMBO J.
15:1784-1791[Medline].
|
| 22.
|
Palmiter, R. D., and S. D. Findley.
1995.
Cloning and functional characterization of a mammalian zinc transporter that confers resistance to zinc.
EMBO J.
14:639-649[Medline].
|
| 23.
|
Paulsen, I. T., and M. H. Saier, Jr.
1997.
A novel family of ubiquitous heavy metal ion transport proteins.
J. Membr. Biol.
156:99-103[Medline].
|
| 24.
|
Rensing, C.,
T. Pribyl, and D. H. Nies.
1997.
New functions for the three subunits of the CzcCBA cation-proton antiporter.
J. Bacteriol.
179:6871-6879[Abstract/Free Full Text].
|
| 25.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y
|
| 26.
|
Simon, R.,
U. Priefer, and A. Pühler.
1983.
A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in Gram-negative bacteria.
Bio/Technology
1:784-791.
|
| 27.
|
van der Lelie, D.,
T. Schwuchow,
U. Schwidetzky,
S. Wuertz,
W. Baeyens,
M. Mergeay, and D. H. Nies.
1997.
Two component regulatory system involved in transcriptional control of heavy metal homoeostasis in Alcaligenes eutrophus.
Mol. Microbiol.
23:493-503[Medline].
|
| 28.
|
Xiong, A., and R. K. Jayaswal.
1998.
Molecular characterization of a chromosomal determinant conferring resistance to zinc and cobalt ions in Staphylococcus aureus.
J. Bacteriol.
180:4024-4029[Abstract/Free Full Text].
|
Journal of Bacteriology, November 1999, p. 6876-6881, Vol. 181, No. 22
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Haritha, A., Sagar, K. P., Tiwari, A., Kiranmayi, P., Rodrigue, A., Mohan, P. M., Singh, S. S.
(2009). MrdH, a Novel Metal Resistance Determinant of Pseudomonas putida KT2440, Is Flanked by Metal-Inducible Mobile Genetic Elements. J. Bacteriol.
191: 5976-5987
[Abstract]
[Full Text]
-
Huang, D.-L., Tang, D.-J., Liao, Q., Li, H.-C., Chen, Q., He, Y.-Q., Feng, J.-X., Jiang, B.-L., Lu, G.-T., Chen, B., Tang, J.-L.
(2008). The Zur of Xanthomonas campestris functions as a repressor and an activator of putative zinc homeostasis genes via recognizing two distinct sequences within its target promoters. Nucleic Acids Res
36: 4295-4309
[Abstract]
[Full Text]
-
Leedjarv, A., Ivask, A., Virta, M.
(2008). Interplay of Different Transporters in the Mediation of Divalent Heavy Metal Resistance in Pseudomonas putida KT2440. J. Bacteriol.
190: 2680-2689
[Abstract]
[Full Text]
-
Grover, A., Sharma, R.
(2006). Identification and Characterization of a Major Zn(II) Resistance Determinant of Mycobacterium smegmatis.. J. Bacteriol.
188: 7026-7032
[Abstract]
[Full Text]
-
Teitzel, G. M., Geddie, A., De Long, S. K., Kirisits, M. J., Whiteley, M., Parsek, M. R.
(2006). Survival and Growth in the Presence of Elevated Copper: Transcriptional Profiling of Copper-Stressed Pseudomonas aeruginosa.. J. Bacteriol.
188: 7242-7256
[Abstract]
[Full Text]
-
Wei, Y., Fu, D.
(2005). Selective Metal Binding to a Membrane-embedded Aspartate in the Escherichia coli Metal Transporter YiiP (FieF). J. Biol. Chem.
280: 33716-33724
[Abstract]
[Full Text]
-
Banjerdkij, P., Vattanaviboon, P., Mongkolsuk, S.
(2005). Exposure to Cadmium Elevates Expression of Genes in the OxyR and OhrR Regulons and Induces Cross-Resistance to Peroxide Killing Treatment in Xanthomonas campestris. Appl. Environ. Microbiol.
71: 1843-1849
[Abstract]
[Full Text]
-
Grass, G., Franke, S., Taudte, N., Nies, D. H., Kucharski, L. M., Maguire, M. E., Rensing, C.
(2005). The Metal Permease ZupT from Escherichia coli Is a Transporter with a Broad Substrate Spectrum. J. Bacteriol.
187: 1604-1611
[Abstract]
[Full Text]
-
Munkelt, D., Grass, G., Nies, D. H.
(2004). The Chromosomally Encoded Cation Diffusion Facilitator Proteins DmeF and FieF from Wautersia metallidurans CH34 Are Transporters of Broad Metal Specificity. J. Bacteriol.
186: 8036-8043
[Abstract]
[Full Text]
-
Anton, A., Weltrowski, A., Haney, C. J., Franke, S., Grass, G., Rensing, C., Nies, D. H.
(2004). Characteristics of Zinc Transport by Two Bacterial Cation Diffusion Facilitators from Ralstonia metallidurans CH34 and Escherichia coli. J. Bacteriol.
186: 7499-7507
[Abstract]
[Full Text]
-
Legatzki, A., Grass, G., Anton, A., Rensing, C., Nies, D. H.
(2003). Interplay of the Czc System and Two P-Type ATPases in Conferring Metal Resistance to Ralstonia metallidurans. J. Bacteriol.
185: 4354-4361
[Abstract]
[Full Text]
-
Franke, S., Grass, G., Rensing, C., Nies, D. H.
(2003). Molecular Analysis of the Copper-Transporting Efflux System CusCFBA of Escherichia coli. J. Bacteriol.
185: 3804-3812
[Abstract]
[Full Text]
-
Weightman, A. J., Topping, A. W., Hill, K. E., Lee, L. L., Sakai, K., Slater, J. H., Thomas, A. W.
(2002). Transposition of DEH, a Broad-Host-Range Transposon Flanked by ISPpu12, in Pseudomonas putida Is Associated with Genomic Rearrangements and Dehalogenase Gene Silencing. J. Bacteriol.
184: 6581-6591
[Abstract]
[Full Text]
-
MacDiarmid, C. W., Milanick, M. A., Eide, D. J.
(2002). Biochemical Properties of Vacuolar Zinc Transport Systems of Saccharomyces cerevisiae. J. Biol. Chem.
277: 39187-39194
[Abstract]
[Full Text]
-
Clemens, S., Bloss, T., Vess, C., Neumann, D., Nies, D. H., zur Nieden, U.
(2002). A Transporter in the Endoplasmic Reticulum of Schizosaccharomyces pombe Cells Mediates Zinc Storage and Differentially Affects Transition Metal Tolerance. J. Biol. Chem.
277: 18215-18221
[Abstract]
[Full Text]
-
Grass, G., Fan, B., Rosen, B. P., Franke, S., Nies, D. H., Rensing, C.
(2001). ZitB (YbgR), a Member of the Cation Diffusion Facilitator Family, Is an Additional Zinc Transporter in Escherichia coli. J. Bacteriol.
183: 4664-4667
[Abstract]
[Full Text]
-
Roux, M., Sarret, G., Pignot-Paintrand, I., Fontecave, M., Coves, J.
(2001). Mobilization of Selenite by Ralstonia metallidurans CH34. Appl. Environ. Microbiol.
67: 769-773
[Abstract]
[Full Text]
-
Wang, W., Guffanti, A. A., Wei, Y., Ito, M., Krulwich, T. A.
(2000). Two Types of Bacillus subtilis tetA(L) Deletion Strains Reveal the Physiological Importance of TetA(L) in K+ Acquisition as well as in Na+, Alkali, and Tetracycline Resistance. J. Bacteriol.
182: 2088-2095
[Abstract]
[Full Text]