Previous Article | Next Article 
Journal of Bacteriology, November 1999, p. 6889-6897, Vol. 181, No. 22
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Catabolite Regulation of the pta Gene as
Part of Carbon Flow Pathways in Bacillus subtilis
Elena
Presecan-Siedel,1
Anne
Galinier,2
Robert
Longin,3
Josef
Deutscher,4
Antoine
Danchin,1
Philippe
Glaser,1 and
Isabelle
Martin-Verstraete1,*
Unité de Régulation de
l'Expression Génétique1 and
Unité de Physiologie Cellulaire, Laboratoire des
Fermentations,3 Institut Pasteur, F-75724,
Paris, Institut de Biologie et Chimie des Protéines,
CNRS, F-69367, Lyon Cedex 07,2 and
Laboratoire de Génétique des Microorganismes,
INRA-CNRS, F-78850 Thiverval-Grignon,4 France
Received 4 June 1999/Accepted 2 September 1999
 |
ABSTRACT |
In Bacillus subtilis, the products of the
pta and ackA genes, phosphotransacetylase and
acetate kinase, play a crucial role in the production of acetate, one
of the most abundant by-products of carbon metabolism in this
gram-positive bacterium. Although these two enzymes are part of the
same pathway, only mutants with inactivated ackA did not
grow in the presence of glucose. Inactivation of pta had
only a weak inhibitory effect on growth. In contrast to pta
and ackA in Escherichia coli, the corresponding
B. subtilis genes are not cotranscribed. Expression of the
pta gene was increased in the presence of glucose, as has
been reported for ackA. The effects of the predicted
cis-acting catabolite response element (CRE) located
upstream from the promoter and of the trans-acting proteins
CcpA, HPr, Crh, and HPr kinase on the catabolite regulation of
pta were investigated. As for ackA, glucose
activation was abolished in ccpA and hprK
mutants and in the ptsH1 crh double mutant. Footprinting
experiments demonstrated an interaction between CcpA and the
pta CRE sequence, which is almost identical to the proposed
CRE consensus sequence. This interaction occurs only in the presence of
Ser-46-phosphorylated HPr (HPrSer-P) or Ser-46-phosphorylated Crh
(CrhSer-P) and fructose-1,6-bisphosphate (FBP). In addition to CcpA,
carbon catabolite activation of the pta gene therefore requires at least two other cofactors, FBP and either HPr or Crh, phosphorylated at Ser-46 by the ATP-dependent Hpr kinase.
 |
INTRODUCTION |
Acetic acid is one of the major
by-products of carbon metabolism detectable during the growth of
Bacillus subtilis in rich media. Two metabolic pathways are
known to be involved in the conversion of pyruvate to acetate. The
first, with acetyl coenzyme A (acetyl-CoA) and acetyl phosphate
(acetyl~P) as intermediates, is considered to be the main source of
acetate excretion during the exponential growth of B. subtilis in the presence of an excess of carbohydrates (14,
38). The second operates during the stationary phase, and acetate
is generated via butanediol (38). Overacidification of the
medium due to pyruvate and acetate accumulation during exponential
growth is prevented by the conversion of pyruvate to uncharged acetoin
(aerobic conditions) or uncharged 2,3-butanediol (anaerobic
conditions), both of which are also excreted (38). During
late exponential growth phase, acetoin undergoes oxidative dissimilation to acetaldehyde and finally to acetate (23).
Acetate and acetoin excreted into the growth medium can be reused
during stationary growth phase when other carbon sources have been
depleted and can therefore be regarded as carbon storage compounds
(16). The acuABC genes and the aco
operon have been shown to be involved in acetoin utilization during
growth and sporulation (14, 17a), whereas acetyl-CoA
synthetase, the product of the acsA gene, is responsible for
acetate utilization (16).
This study focused on the phosphotransacetylase (pta) gene,
which together with the acetate kinase (ackA) gene encodes
the enzymes that catalyze the conversion of acetyl-CoA to acetate via
an acetyl~P intermediate. In most bacteria, these two genes are
organized into a single operon, and they have been shown to be involved
in the maintenance of the intracellular acetyl-CoA and acetyl~P pools
(1, 2, 22, 32, 37). As in Mycoplasma genitalium
(6), the B. subtilis genes pta and
ack are located at distant loci on the chromosome: at 326°
(pta) and 263° (ack). CcpA (catabolite control
protein A), a member of the LacI-GalR family of repressors, is a key
regulator of carbon flow in B. subtilis. It acts as either a
negative regulator of the expression of carbon utilization genes or a
positive regulator of the expression of genes involved in the excretion
of excess carbon, such as ackA (17, 19). CcpA
mediates glucose control by binding to the DNA operator sequence known
as the catabolite response element (CRE) (17, 42). The
phosphoenolpyruvate:sugar phosphotransferase system (PTS) is
responsible for the uptake of various sugars in bacteria
(31) and is also involved in carbon catabolite repression (CCR) in B. subtilis. The phosphocarrier protein HPr and its
homologue Crh (catabolite repression HPr) are both phosphorylated at
the regulatory Ser-46 site by the ATP-dependent HPr kinase (10, 11). This enzyme is stimulated by glycolytic intermediates such as fructose-1,6-bisphosphate (FBP). Replacement of Ser-46 with alanine,
which abolishes the ATP-dependent phosphorylation of HPr
(ptsH1 mutant), or additional disruption of the
crh gene (ptsH1 crh::aphA3
double mutant) causes the partial or complete relief from CCR of
several systems (5, 10). This finding indicates that in
addition to CcpA, both Ser-46-phosphorylated HPr (HPrSer-P) and
Ser-46-phosphorylated Crh (CrhSer-P) are involved in carbon catabolite control.
An interaction between CcpA and HPrSer-P has been demonstrated in
vitro, and in some cases this interaction has been found to be stronger
in the presence of glycolytic intermediates such as FBP (4).
The resulting protein complex interacts specifically with the CRE of
the gluconate, xylose,
-xylosidase, and levanase operons (8, 9,
13, 24a). Glucose-6-phosphate also stimulates the binding of CcpA
to the CRE sequence of the xyl and gnt operons (13, 28). While binding of CcpA to the CRE of the
-amylase gene has been observed in the presence of the corepressor
FBP, NADP has been shown to stimulate CcpA-dependent inhibition of transcription from the amyE promoter (20).
The mechanism of CCR has been extensively studied in B. subtilis, but much less is known about catabolite activation of
gene expression. For the ackA gene of B. subtilis
(15), catabolite activation was abolished in a
ccpA mutant, in a ptsH1 crh double mutant, or
after removal of the second of the two CRE sequences identified
upstream from the ackA promoter (41). CcpA is
also required to induce the expression of the alsSD operon
involved in acetoin biosynthesis (34).
In this study, we demonstrate that the pta (formerly
ywfJ) gene, sequenced in the framework of the B. subtilis genome project (12), encodes a
phosphotransacetylase. We also report the identification of the
pta promoter and of a regulatory CRE sequence upstream from
this promoter. Our results show that pta (like
ackA and alsSD) is a CcpA-activated gene involved
in excess carbon excretion pathways in B. subtilis. In
addition, we show that both HPrSer-P and CrhSer-P are involved in the
catabolite activation of pta expression.
 |
MATERIALS AND METHODS |
Bacterial strains and growth conditions.
The B. subtilis strains used in this study are listed in Table
1. Escherichia coli XL1 Blue
and TG1 were used for plasmid preparations. B. subtilis and
E. coli strains were grown in Luria-Bertani (LB) medium or
in sporulation medium. Antibiotics were added at the following
concentrations: ampicillin, 100 µg ml
1;
chloramphenicol, 5 µg ml
1; kanamycin, 5 µg
ml
1; and spectinomycin, 60 µg ml
1. The
transformation procedures used for E. coli and B. subtilis were as described by Sambrook et al. (35) and
Kunst and Rapoport (21), respectively. For carbon regulation
studies, B. subtilis strains containing the
pta-lacZ fusion were grown in CSK medium (24) in
the absence or presence of 0.4% glucose. For Pta activity assay,
B. subtilis strains were grown on LB medium supplemented with 1% glucose.
-Galactosidase specific activity in mutants containing the various lacZ fusions was measured as
previously described (39). One unit of
-galactosidase was
defined as the amount of enzyme producing 1 nmol of
o-nitrophenol per min at 28°C. Protein concentrations were
determined by using a Bio-Rad protein assay kit. The integration of DNA
fragments into the amyE locus of B. subtilis by
double crossover was assessed by monitoring the loss of amylase
activity on tryptose blood agar base (Difco) supplemented with 10 g of hydrolyzed starch (Connaught) per liter. Starch degradation was
detected by sublimating iodine onto the plates.
DNA and RNA manipulations.
Standard procedures were used to
extract plasmids from E. coli (35). Restriction
enzymes, phage T4 DNA polymerase, phage T4 DNA ligase, and T4
polynucleotide kinase were used as recommended by the manufacturers.
The PCR products were purified by using a Qiaquick kit (Qiagen). RNA
was extracted from B. subtilis 168 grown in CSK medium with
or without 0.4% glucose and harvested at an optical density at 600 nm
(OD600) of 0.2. RNA was extracted as previously described
(3). The 32P-labelled oligonucleotide
5'CAATTTTAACGTCTTTTCCAGCTAC3' (labelled with T4
polynucleotide kinase; Biolabs) was used to map the pta promoter by primer extension. DNA was sequenced by the dideoxy-chain termination method of Sanger et al. (36).
Plasmid constructs.
The main characteristics of the plasmids
used in this study are shown in Fig. 1. A
6,187-bp region of the B. subtilis chromosome containing the
pta (formerly ywfJ) gene (12) was
inserted into the E. coli plasmid pDIA5304 to give pDIA5373.
pDIA5374 was obtained by inserting a BamHI-BglII
DNA fragment containing a kanamycin resistance cassette into the unique
BglII restriction site of pDIA5373. The
EcoRI-BglII and
HindIII-BglII fragments from pDIA5373 were
inserted into the integrative plasmid pJM783 (30), giving pDIA5375 and pDIA5376, respectively (Fig. 1). These two plasmids were
integrated by Campbell recombination into the B. subtilis pta locus, producing a transcriptional pta-lacZ fusion
in a pta+ (pDIA5375) or
pta
(pDIA5376) genetic background. Three fragments,
109 to +306 (415 bp)
containing the CRE site of pta (CREpta),
49 to
+306 (355 bp) with the CRE deleted (
CREpta), and
22 to +306 (328 bp) with the CRE and the
35 promoter region deleted (
Ppta), were amplified by PCR using pDIA5373 as a
template (numbering is relative to the transcription start site).
Oligonucleotides allowing the creation of an EcoRI
restriction site near the 5' end and of a BamHI restriction
site near the 3' end were used. After digestion with BamHI
and EcoRI, the PCR products were inserted in plasmid pAC6
(39), yielding pDIA5377, pDIA5378, and pDIA5381, respectively (Fig. 1). The resulting pta-lacZ fusions were
subsequently integrated at the B. subtilis amyE locus. To
carry out the footprinting experiments, a fragment containing the CRE
region of the pta gene (from
109 to +139) and a fragment
in which the CRE was absent (from
49 to +139) were inserted between
the HindIII and EcoRI sites of the
high-copy-number plasmid pUC18 (Fig. 1).

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 1.
Plasmid construction. Various B. subtilis
chromosomal DNA fragments (horizontal lines) containing the
pta gene (bold arrow or bar) were inserted into the vectors
listed at the right. Designations for the resulting plasmids are given
at the left. The B. subtilis chromosomal DNA fragments are
numbered relative to the identified transcriptional start site of the
pta gene. The promoter region of the pta gene (P)
and the CRE (open box) are indicated. Some restriction sites are also
shown.
|
|
Isolation and purification of proteins used in protein-DNA
interaction assays.
CcpA-His6, Crh-His6,
HPr-His6, and HPr kinase-His6 were purified on
Ni-nitrilotriacetic acid-agarose columns as previously described
(10). Crh-His6 and HPr-His6 were
phosphorylated with HPr kinase-His6 in the presence of ATP
as described by Galinier et al. (11), such that about 90%
of Crh-His6 and HPr-His6 were phosphorylated.
HPr kinase was then denatured by incubation for 10 min at 80°C.
DNase I footprinting.
The DNA probe was prepared as follows.
pDIA5379 and pDIA5380 were linearized with EcoRI and treated
with the Klenow fragment of DNA polymerase I (Boehringer) in the
presence of a mixture of dGTP, dCTP, dTTP (0.5 mM), and
[
-32P]dATP. A phenol-chloroform extraction was
performed with the plasmids labelled at one end followed by a second
digestion with HindIII. The
EcoRI-HindIII labelled DNA fragments were
purified on a 6% polyacrylamide gel. Binding of either CcpA, HPr,
HPrSer-P, Crh, or CrhSer-P to these DNA fragments was assessed in
20-µl reaction mixtures containing about 0.03 pmol of one of the
32P-labelled DNA fragments (150,000 to 275,000 cpm) and 1 µg of poly(dI-dC) in 100 mM KCl-10 mM HEPES (pH 7.6)-0.1 mM EDTA-2
mM MgCl2-1 mM dithiothreitol-10% glycerol. The DNA
binding reaction was performed in the presence of 2 µM CcpA and 10 µM either HPr, HPrSer-P, Crh, or CrhSer-P by incubating the assay
mixture for 10 min at room temperature. The concentrations of
MgCl2 and CaCl2 were adjusted to 1 and 0.5 mM,
respectively, and 20 ng of DNase I (Worthington Biochemical, Freehold,
N.J.) was added. The mixture was incubated at room temperature for 1 min, and the reaction was stopped by phenol extraction followed by the
addition of 4 volumes of stop buffer (0.4 M sodium acetate, 50 µg of
calf thymus DNA/ml, 2.5 mM EDTA). A+G Maxam and Gilbert reactions
(26) were carried out with the same DNA fragments.
Acetate excretion measurements and phosphotransacetylase
assay.
For measurement of acetate production, the B. subtilis strains were grown in CSK medium supplemented with 0.4%
glucose. Production of acetate was detected by high-pressure liquid
chromatography using a Perkin-Elmer (Norwalk, Conn.) 3B liquid
chromatograph. Metabolites were separated on an Aminex HPX 87H strong
cation-exchange column (Bio-Rad Laboratories, Richmond, Calif.),
protected with a cation H microguard column (Bio-Rad Laboratories).
Samples were filtered through SJHV 0.45-µm-pore-size filter units
(Millipore Corp., Bedford, Mass.). Elution from the column was
performed at 40°C with 0.01 N H2SO4 at a flow
rate of 0.7 ml/min. Elution of the separated products was followed with
a Perkin-Elmer LC25 refractometer equipped with a Sigma 15 integrator.
Each metabolite was identified and quantified comparing its retention
time and peak surface with those of the corresponding standards.
Phosphotransacetylase activity was assayed in a coupled reaction as
previously described (
32). The reaction mixture contained
250 mM Tris-HCl (pH 7.8), 15 mM malic acid, 4.5 mM MgCl
2, 2 mM
CoA, 22.5 mM NAD, 10 mM acetyl phosphate, 12 U of malate
dehydrogenase,
and 1.1 U of citrate synthase. The reaction was started
adding
B. subtilis crude extract, and the OD
340
was measured. Phosphotransferase
specific activity is expressed in
units per milligram of protein
(1 U = 1 µmol min
1,
340 = 6.22 mM
1 cm
1).
 |
RESULTS |
Identification of the pta gene.
As part of the
B. subtilis genome sequencing project, an open reading
frame, ywfJ, encoding a protein with a sequence very similar
to that of the phosphotransacetylases of E. coli
(25) and Methanosarcina thermophila
(22) was identified. The B. subtilis ywfJ gene
encodes a protein composed of 323 amino acids, with a calculated
molecular weight of 34,800. Similar proteins (40 to 46% identical
residues) are found in Mycoplasma capricolum, M. genitalium, M. pneumoniae, Pseudomonas
denitrificans, Clostridium thermosaccharolyticum,
C. acetobutylicum, and C. glutamicum. Longer variants of phosphotransacetylase have been found in E. coli
(25), Haemophilus influenzae, and
Synechocystis sp. These longer proteins are composed of
about 700 amino acids, and the B. subtilis
phosphotransacetylase is similar only to the C-terminal part of the
longer variants of phosphotransacetylase.
Inactivation of the pta gene.
To demonstrate that
ywfJ does indeed encode a phosphotransacetylase involved in
acetate production, the gene was disrupted with a kanamycin cassette
(Fig. 1). The phosphotransacetylase activity of the wild-type strain
168 and ywfJ mutant (BSIP1171) was measured after growth on
LB medium in the presence of 0.4% glucose. The formation of acetyl-CoA
from acetyl phosphate via a coupled reaction (32) was
tested. No significant activity was detected in the ywfJ
mutant, whereas the phosphotransacetylase activity of the wild-type
strain was 56 U/mg of protein. Therefore, ywfJ clearly
encodes the phosphotransacetylase, and the gene was therefore renamed
pta.
Acetate levels in the
pta mutant BSIP1171 and the wild-type
strain were compared during the exponential and stationary growth
phases, after growth in CSK medium supplemented with glucose (Table
2). Acetate production was decreased
fourfold in the exponential
growth phase and was halved in the
stationary growth phase when
pta was inactivated. Grundy et
al. (
15) reported that growth
of the
ackA mutant
is strongly inhibited by glucose. No such effect
was observed with the
pta mutant. Bacterial yields in CSK medium
in the presence
or absence of glucose were not significantly different
in this strain
and the wild type, and the growth rate of the
ack mutant was
only slightly lower (data not shown). These results
indicated that the
pta gene product is involved in acetate production.
However,
at least one other pathway, possibly involving the conversion
of
acetoin to acetate via the butanediol cycle, should also contribute
to
synthesis of this by-product. In identical conditions, we therefore
measured acetate production in two other strains, the
alsS
mutant
and the
alsS pta double mutant.
alsS
mutants cannot synthesize
acetoin, and the corresponding pathway for
acetate production
should therefore be blocked. The
alsS
mutation alone caused a
slight increase in acetate production in the
stationary phase
(Table
2). The
alsS mutation was introduced
into the
pta strain,
where it had no effect on acetate
synthesis during both exponential
and stationary growth phases. In the
conditions tested, this second
pathway seems not to be active, and
another pathway of acetate
synthesis must exist in
B. subtilis.
Regulation of expression of the pta gene.
We
investigated pta expression under various conditions by
generating transcriptional pta-lacZ fusions. The integrative
plasmids pDIA5375 and pDIA5376 (Fig. 1) are derivatives of pJM783
carrying a DNA fragment containing the promoter region plus the
beginning of the pta gene and an internal fragment of
pta, respectively. The integration of these plasmids at the
B. subtilis pta locus by Campbell-type recombination
resulted in strains containing a transcriptional fusion between
pta and lacZ and an intact (BSIP1104) or
disrupted (BSIP1105) pta gene (Table 1).
Expression of the
pta-lacZ fusion of strain BSIP1104 in rich
medium (LB) peaked during the mid-exponential growth phase, consistent
with the observations of Rado and Hoch on phosphotransacetylase
activity (
33). Gene expression decreased in later growth
stages,
suggesting the presence of a signal that switches it
off.
In
B. subtilis, the
pta and
ackA genes
are not organized in an operon but form two separate transcriptional
units, the products
of which are involved in the same metabolic pathway
of acetate
excretion. As
ackA is subject to catabolite
activation, we tested
whether
pta gene expression was also
submitted to catabolite regulation.
We cultured the
pta-lacZ
strain, BSIP1104, in CSK medium in the
presence or absence of glucose
and measured

-galactosidase activity.
Expression of the
pta gene in the presence of 0.4% glucose was
three times
higher than that of cells grown in CSK medium without
glucose (Table
3).
A comparison of
pta-lacZ expression in strains BSIP1104 and
BSIP1105 during growth in CSK medium containing 0.4% glucose showed
that

-galactosidase activity in the absence of an intact copy
of
pta was twice that in the presence of an intact copy of
pta,
suggesting that
pta negatively regulates its
own expression (data
not
shown).
Analysis of the pta promoter region.
The DNA
sequence of the pta promoter region is presented in Fig.
2. The translation initiation codon is
probably a GTG codon preceded by a potential ribosome-binding site
(Fig. 2). The 5' end of the pta transcript was identified by
primer extension analysis using total RNA extracted from a B. subtilis wild-type strain grown on CSK medium in the presence and
absence of glucose (Fig. 3, lanes 1 and
2, respectively). Glucose clearly stimulates pta transcription (lanes 1 and 2). The 5'-end-labelled primer (Fig. 2),
gave a 95-base extension product which identified the adenine designated nucleotide +1 as the 5' end of the pta mRNA. The
putative
10 and
35 regions of the promoter are indicated in Fig. 2.
pDIA5381 (Fig. 1), a derivative of pAC6 carrying a pta
fragment (from
22 to +306 [
P in Fig. 2]) with only the
10
region fused to lacZ, was constructed to confirm the
position of the promoter. This fusion was integrated at the
amyE locus of B. subtilis and gave a much lower
level of
-galactosidase activity (2 to 6 U/mg of protein) than the
fusion containing the complete promoter region (
109 to +306) (250 U/mg of protein) (Fig. 4). Deletion of
the
35 part of the promoter abolished transcription of the
pta-lacZ fusion. A typical CRE sequence (18),
TGAAAGCGCTATAA, is located between positions
62 and
49
relative to the transcription start site of the pta gene
(boxed in Fig. 2). This sequence contains one mismatch (the adenine at
position
50) compared with the CRE consensus sequence
(18). To investigate the role of this sequence in catabolite
regulation of the pta gene, two pta-lacZ fusions were constructed by inserting into pAC6 DNA fragments with and without
the CRE region of the pta gene (Fig. 1). The start points of
fragments CREpta (
109) and
CREpta (
49) are
indicated in Fig. 2. The pta-lacZ fusions present in the
resulting plasmids pDIA5377 (CRE,
109 to +306) and pDIA5378 (
CRE,
49 to +306) were integrated as single copies at the amyE
locus of B. subtilis 168.
-Galactosidase activity was
measured for the various strains grown in CSK medium in the presence or
absence of 0.4% glucose (Fig. 4). For the CREpta-lacZ
fusion, we observed a 3-fold activation of pta-lacZ
expression in the mid-exponential growth phase in CSK medium
supplemented with 0.4% glucose. No such activation was observed with
the
CREpta-lacZ fusion. This indicates that the DNA
fragment located between positions
109 and
49 is responsible for
catabolite activation of the pta gene and suggests that the predicted CRE sequence is involved in this activation.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 2.
pta promoter region. The nucleotide sequence
of a 291-bp-long DNA fragment containing the pta promoter
and the beginning of the pta gene is presented. The vertical
arrow indicates the position of the transcription start site, +1. The
primer used for the primer extension experiment is indicated by the
long horizontal arrow. The 10 and 35 regions, corresponding to the
RNA polymerase binding site, are indicated. The potential
ribosome-binding site (Shine-Dalgarno [SD]) and the CRE sequence are
boxed. The bent arrows at positions 109, 49, and 22 indicate the
start of the CRE, CRE, and P fragments used for the construction
of the pta-lacZ fusions in pDIA5377, pDIA5378, and pDIA5381
(Fig. 1).
|
|

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 3.
Mapping of the transcription start site of the
pta gene by primer extension. Total RNAs was extracted from
B. subtilis 168 grown in CSK medium in the presence (lane 1)
or absence (lane 2) of 0.4% glucose. In lane 3, the labelled
oligonucleotide was loaded as a control. The labelled primer used for
reverse transcription is indicated in Fig. 2. Sequencing reactions were
performed with the same oligonucleotide as a primer and pDIA5373 as the
template.
|
|

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 4.
Importance of the CRE and 35 promoter region for
pta expression. We monitored the expression of
pta-lacZ expression over time for strains BSIP1114 ( ),
BSIP1115 ( ), and BSIP1116 ( ). These strains contain the
CREpta, CREpta, and Ppta
fragments (Fig. 2) fused to the lacZ gene inserted at the
amyE locus. The strains were grown in CSK medium in the
absence (open symbols) or presence (closed symbols) of 0.4% glucose.
|
|
Effects of trans-acting CCR proteins on pta
expression.
CcpA, HPr, and Crh are known to play a role in
catabolite activation of genes involved in carbon excretion pathways
(41). In addition, HPr kinase, which phosphorylates both HPr
and Crh at Ser-46, is necessary for CCR (11). We
investigated whether these trans-acting factors were
involved in the regulation of expression of the pta gene.
Chromosomal DNA from a ccpA or hprK mutant was
used to transform a pta-lacZ strain, and chromosomal DNA
from strain BSIP1104 (pta-lacZ) was used to transform the ptsH1 (QB5223), crh::aphA3
(QB7096), and ptsH1 crh::aphA3 (QB7102) strains (Table 1). Expression of the pta-lacZ fusion was
assessed in the various mutants after growth in CSK medium in the
presence or absence of 0.4% glucose. The results are summarized in
Table 3.
Glucose activation of the
pta gene was completely abolished
in the
ccpA and
hprK mutants and in the
ptsH1 crh double mutant.
Neither
ptsH1 mutation
nor
crh disruption alone affected glucose
activation,
probably because HPrSer-P and CrhSer-P can substitute
for each other.
These results indicate that in addition to CcpA,
both HPr and Crh
phosphorylated by HPr kinase are involved in
pta catabolite
activation.
Interaction of trans-acting CCR proteins with the
pta regulatory region.
To test binding of the
transcriptional activator/repressor CcpA to the CRE sequence identified
in the pta promoter region, DNase I footprinting experiments
were performed. The key regulator CcpA, the PTS protein HPr, and its
homologue Crh (in both dephosphorylated and Ser-46-phosphorylated
forms) were purified. Two DNA fragments containing the pta
promoter region from positions
109 to +139 or
49 to +139 (Fig. 1)
were labelled with 32P at the EcoRI site. The
first DNA fragment (CREpta) contained the CRE site
identified in vivo. This site was deleted in the second fragment
(
CREpta). The results of the DNase I footprinting experiments are shown in Fig. 5.

View larger version (75K):
[in this window]
[in a new window]
|
FIG. 5.
DNase I footprinting experiments with the pta
promoter region and trans-acting CCR proteins. (A)
Footprinting with the 248-bp EcoRI-HindIII
DNA fragment containing the CREpta ( 109 to +139) (Fig. 2);
(B) footprinting with the 188-bp
EcoRI-HindIII DNA fragment
CREpta ( 49 to +139) (Fig. 2). The CREpta and
CREpta fragments were obtained from plasmids pDIA5379 and
pDIA5380, respectively, and labelled at the 3' end as described in
Materials and Methods. A+G standards for Maxam and Gilbert reactions
were made for each fragment. The DNA sequence of the promoter region of
the two fragments (from positions 84 to 33 [A] and 14 to +34
[B]) as well as the protected areas are indicated. DNase I digestions
were performed as indicated in Materials and Methods with both
fragments. In each case, the DNA was digested in the absence of
proteins (lane 1) or in the presence of 2 µM CcpA (lane 2), 2 µM
CcpA and 10 µM HPr (lane 3), 2 µM CcpA and 10 µM HPrSer-P (lane
4), 2 µM CcpA, 10 µM HPrSer-P, and 20 mM FBP (lane 5), 2 µM CcpA
and 10 µM Crh (lane 6), 2 µM CcpA and 10 µM CrhSer-P (lane 7), or
2 µM CcpA, 10 µM CrhSer-P, and 20 mM FBP (lane 8).
|
|
Under the conditions used, CcpA alone (2 µM) did not bind to these
two DNA fragments (Fig.
5A and B, lanes 2). If HPr, HPrSer-P,
Crh, or
CrhSer-P was added in a fivefold molar excess over CcpA
(lanes 3, 4, 6, and 7), no protection of the DNA fragments against
DNase I digestion
was observed. Nevertheless, in the presence
of the CcpA-HPrSer-P and
CcpA-CrhSer-P complexes, several regions
were hypersensitive to DNase
I digestion (lanes 4 and 7). As Deutscher
et al. (
4) showed
that the presence of FBP enhances the specific
interaction of CcpA from
B. megaterium with
B. subtilis HPrSer-P,
we
investigated the effect of FBP on the binding of the CcpA-HPrSer-P
and
CcpA-CrhSer-P complexes to the
pta CRE sequence. Protection
was clearly detected if 20 mM FBP was present in addition to the
CcpA-HPrSer-P and CcpA-CrhSer-P complexes (lanes 5 and 8). The
pta promoter regions protected in DNase I footprint
experiments
are highlighted in Fig.
6.
The footprinting experiments confirmed
that the CcpA-HPrSer-P and
CcpA-CrhSer-P complexes interact with
the CRE region shown to be
involved in glucose regulation in vivo.
A second region protected in
the in vitro footprinting experiments
was identified with the

CRE
DNA fragment. This region contains
a DNA sequence AGAAAGCGTTTTTG
(positions +1 to +14) with some
similarity to the CRE consensus
sequence (Fig.
6). However, this
second CcpA binding site did not
confer glucose-activated expression
to the

CRE
pta-lacZ
fusion in vivo (Fig.
4).

View larger version (7K):
[in this window]
[in a new window]
|
FIG. 6.
pta promoter regions protected in DNase I
footprinting experiments. The sequence of the pta promoter
region from positions 70 to +29 is presented. The CRE sequence is
boxed, and the CRE consensus sequence is indicated. The bases protected
against digestion with DNase I are indicated by asterisks.
|
|
 |
DISCUSSION |
Glycolysis and the Krebs cycle, the central pathways of carbon
metabolism, have a dual function: providing energy and reducing equivalents in form of ATP and NADH or NADPH, respectively, and facilitating the synthesis of precursors for most biosynthetic pathways. To fulfill both functions and to maximize the growth rate,
some of the carbon flow may be directed toward the formation of
by-products excreted into the medium. If external electron acceptors
such as oxygen or nitrate become limiting, B. subtilis cells
growing in a medium containing excess of carbon excrete a large variety
of compounds that are either intermediates of the central pathways,
such as pyruvate or succinate, or produced by pathways branching off
from the central metabolic pathways, such as acetate, acetoin, and
lactate (34, 38). In addition to the redox equilibrium and
the flow rate through the central pathways, pH changes may also affect
by-product synthesis as observed in Lactobacillus plantarum
(40). The pH dependence is not surprising, as the two major
by-products, pyruvate and acetate, are organic acids. B. subtilis cells have developed complex regulatory systems to
control by-product formation so as to keep carbon metabolism balanced.
The absence of phosphotransacetylase activity in ywfJ mutant
indicates clearly that this gene encodes phosphotransacetylase. By
analyzing acetate production in various mutant strains, we found that
acetate is not only formed via the Ack-Pta pathways. The low level of
acetate in the pta mutant confirms that this gene encodes
phosphotransacetylase. The similar level of acetate synthesis in the
alsS pta double mutant indicates that the butanediol cycle
is not involved in acetate production. Some unknown pathway is
therefore responsible for the significant acetate production in the
pta mutant and in the alsS pta double mutant.
Acetyl-CoA synthetase may be responsible for the residual acetate
synthesis in the pta mutant, although its main function is
related to acetate utilization (34).
Although the pta and ackA mutants affect the same
pathway for acetate excretion, there is a significant difference
between these two mutants. Glucose strongly inhibits the growth of the ackA mutant only (15), suggesting that the low
level of acetate excretion is not responsible for this growth
inhibition. Acetate kinase catalyses the second step of the acetate
excretion pathway, the conversion of acetyl~P to acetate. In the
presence of glucose, the ackA mutant probably accumulates
acetyl~P. This compound has been shown to be involved in the
regulation of signal transduction by the two-component regulatory
systems in various bacteria (27). In the ackA
mutant, abnormal acetyl~P-mediated regulation of several two-component systems may account for the inhibitory effect of glucose
on cell growth. Such growth inhibition is not observed for the
pta mutant, which probably contains only low concentrations of acetyl~P.
The location of ack and pta in two independent
transcriptional units suggested that acetate kinase and
phosphotransacetylase synthesis are differently regulated, but very
similar mechanisms of regulation of expression have been observed for
these two genes (15, 41). Coregulation is further
substantiated by the similar codon preferences in pta and
ackA (29). In gram-positive bacteria, catabolite
regulation of various operons is mediated by the
trans-acting dimeric protein CcpA, a repressor belonging to
the LacI-GalR family of bacterial regulatory proteins. CcpA binds to
the palindromic operator sequence CRE (17, 42). As observed
for the ackA gene (15, 41), expression of the
pta gene is increased threefold in the presence of glucose
(Table 3 and Fig. 4), and this activation is mediated by CcpA (Table
3). We demonstrated that the products of at least four genes
(ccpA, ptsH, crh, and hprK)
are involved in catabolite activation of the pta gene.
Replacement of the Ser-46 of HPr with an alanyl residue, as in
ptsH1, and disruption of the crh gene did not
affect glucose activation (Table 3). By contrast, a ptsH1
crh double mutant showed a release from catabolite activation
identical to that of the ccpA and hprK single
mutants. It therefore seems likely that both HPrSer-P and CrhSer-P
exert their effects on catabolite activation via CcpA as for CCR
(9, 10).
The pta promoter region (Fig. 2) contains a single
A-dependent promoter and a CRE sequence,
TGAAAGCGCTATAA, located between positions
62 and
49
relative to the transcriptional start site. Deletion of this CRE
abolished catabolite activation of pta gene expression (Fig.
4). The location of this CRE (centered on position
55.5) is similar
to that of the ackA CRE (
56.5), the only other B. subtilis CcpA binding site shown to be involved in catabolite activation (41).
DNase I footprinting experiments demonstrated that HPrSer-P and
CrhSer-P increased the specific binding of CcpA to the pta CRE (Fig. 5). However, FBP was required to observe clear protection by
the CcpA-HPrSer-P and CcpA-CrhSer-P complexes. FBP, the concentration of which is greatly increased by growth of the cells in
glucose-containing medium (7), interferes at several steps
in the CCR signal transduction pathway, ultimately facilitating the
binding of CcpA to the CRE. FBP stimulates the phosphorylation of HPr
and Crh at the regulatory Ser-46 by the ATP-dependent HPr kinase
(11) and the interaction between HPrSer-P and CcpA
(4). In some cases, FBP probably also increases the in vitro
binding of the CcpA-HPrSer-P and CcpA-CrhSer-P complexes to their
targets as observed for the xyn CRE (9). FBP may
also be responsible for doubling of pta-lacZ expression in
mutants carrying a disrupted pta gene. Inactivation of the Pta-Ack acetate excretion pathway in such mutants may lead to an
increase in the concentration of FBP and other glycolytic intermediates and hence to altered catabolite regulation.
A second region, located between positions +1 and +14, is also
protected by the CcpA-HPrSer-P and CcpA-CrhSer-P complexes against in
vitro digestion by DNase I. This second CcpA binding site, which is
less similar to the consensus CRE sequence, is not sufficient to confer
in vivo glucose activation (Fig. 4). The presence of an auxiliary CRE
site has also been shown for the xyl and gnt
operons (13, 28). Although the position of this additional
CRE sequence is atypical for a positive regulatory site, the binding of
CcpA to multiple CRE sites, possibly brought into close contact by DNA
looping, may help to cause local changes in DNA conformation or may
facilitate CcpA-RNA polymerase interactions. The binding of the
CcpA-HPrSer-P and CcpA-CrhSer-P complexes caused also significant
alterations in the pattern of DNase I digestion outside the CRE
sequence (Fig. 5), suggesting that changes in the DNA structure may be induced.
These results confirm that very similar mechanisms, including protein
phosphorylation and protein-protein and protein-DNA interactions, are
involved in catabolite activation and carbon catabolite repression in
B. subtilis. Further studies are required to elucidate the
molecular details of these mechanisms, leading in one case to
activation and in the other to inhibition of gene expression.
 |
ACKNOWLEDGMENTS |
We thank H. Cruz Ramos for the gift of strains BSIP1173 and
BSIP1174, Christelle Kula for technical advice, and G. Rapoport for
helpful discussions.
E.P.-S. is a fellow of the European Union Biotec Programme (contract
ERBB102 CT930272). This research was supported by grants from the
Ministère de l'Education Nationale de la Recherche et de la
Technologie, Centre National de la Recherche Scientifique (URA1129),
Institut National de la Recherche Agronomique, Institut Pasteur,
Université Paris 7, and European Union Biotech Programme (contracts ERBB102 CT930272 and ERBB104 CT960655).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Unité de
Régulation de l'Expression Génétique, Institut
Pasteur, 28, rue du Dr. Roux, F-75724, Paris cedex 15, France. Phone:
33-(0)1-4568-8441. Fax: 33-(0)1-4568-8948. E-mail:
iverstra{at}pasteur.fr.
 |
REFERENCES |
| 1.
|
Brown, T. D. K.,
M. C. Jones-Mortimer, and H. L. Kornberg.
1977.
The enzymatic interconversion of acetate and acetyl-coenzyme A in Escherichia coli.
J. Gen. Microbiol.
102:327-336[Abstract/Free Full Text].
|
| 2.
|
Brown, T. D. K.,
C. R. S. Pereira, and F. C. Stormer.
1972.
Studies of the acetate kinase-phosphotransacetylase and the butane diol-forming systems in Aerobacter aerogenes.
J. Bacteriol.
112:1106-1111[Abstract/Free Full Text].
|
| 3.
|
Cruz Ramos, H.,
L. Boursier,
I. Moszer,
F. Kunst,
A. Danchin, and P. Glaser.
1995.
Anaerobic transcription activation in Bacillus subtilis: identification of distinct FNR-dependent and -independent regulatory mechanisms.
EMBO J.
14:5984-5994[Medline].
|
| 4.
|
Deutscher, J.,
E. Kuster,
U. Bergstedt,
V. Charrier, and W. Hillen.
1995.
Protein kinase-dependent HPr/CcpA interaction links glycolytic activity to carbon catabolite repression in gram-positive bacteria.
Mol. Microbiol.
15:1049-1053[Medline].
|
| 5.
|
Deutscher, J.,
J. Reizer,
C. Fischer,
A. Galinier,
M. H. Saier, Jr., and M. Steinmetz.
1994.
Loss of protein kinase-catalyzed phosphorylation of HPr, a phosphocarrier protein of the phosphotransferase system, by mutation of the ptsH gene confers catabolite repression resistance to several catabolic genes of Bacillus subtilis.
J. Bacteriol.
176:3336-3344[Abstract/Free Full Text].
|
| 6.
|
Fraser, C. M., et al.
1995.
The minimal gene complement of Mycoplasma genitalium.
Science
270:397-403[Abstract/Free Full Text].
|
| 7.
|
Fujita, Y., and E. Freese.
1979.
Purification and properties of fructose-1,6-bisphosphatase of Bacillus subtilis.
J. Biol. Chem.
254:5340-5349[Abstract/Free Full Text].
|
| 8.
|
Fujita, Y.,
Y. Miwa,
A. Galinier, and J. Deutscher.
1995.
Specific recognition of the Bacillus subtilis gnt cis-acting catabolite-responsive element by a protein complex formed between CcpA and seryl-phosphorylated HPr.
Mol. Microbiol.
17:953-960[Medline].
|
| 9.
|
Galinier, A.,
J. Deutscher, and I. Martin-Verstraete.
1999.
Phosphorylation of either Crh or HPr mediates binding of CcpA to the Bacillus subtilis xyn cre and catabolite repression of the xyn operon.
J. Mol. Biol.
286:307-314[Medline].
|
| 10.
|
Galinier, A.,
J. Haiech,
M. C. Kilhoffer,
M. Jaquinod,
J. Stülke,
J. Deutscher, and I. Martin-Verstraete.
1997.
The Bacillus subtilis crh gene encodes a HPr-like protein involved in carbon catabolite repression.
Proc. Natl. Acad. Sci. USA
94:8439-8444[Abstract/Free Full Text].
|
| 11.
|
Galinier, A.,
M. Kravanja,
R. Engelmann,
W. Hengstenberg,
M. C. Kilhoffer,
J. Deutscher, and J. Haiech.
1998.
New protein kinase and protein phosphatase families mediate signal transduction in bacterial catabolite repression.
Proc. Natl. Acad. Sci. USA
95:1823-1828[Abstract/Free Full Text].
|
| 12.
|
Glaser, P.,
F. Kunst,
M. Arnaud,
M.-P. Coudart,
W. Gonzales,
M.-F. Hullo,
M. Ionescu,
B. Lubochinsky,
L. Marcelino,
I. Moszer,
E. Presecan,
M. Santana,
E. Schneider,
J. Schweizer,
A. Vertes,
G. Rapoport, and A. Danchin.
1993.
Bacillus subtilis genome project: cloning and sequencing of the 97 kb region from 325° to 333°.
Mol. Microbiol.
10:371-384[Medline].
|
| 13.
|
Gösseringer, R.,
E. Kuster,
A. Galinier,
J. Deutscher, and W. Hillen.
1997.
Cooperative and non-cooperative DNA binding modes of catabolite control protein CcpA from Bacillus megaterium result from sensing two different signals.
J. Mol. Biol.
266:665-676[Medline].
|
| 14.
|
Grundy, F. J.,
A. J. Turinsky, and T. M. Henkin.
1994.
Catabolite regulation of Bacillus subtilis acetate and acetoin utilization genes by CcpA.
J. Bacteriol.
176:4527-4533[Abstract/Free Full Text].
|
| 15.
|
Grundy, F. J.,
D. A. Waters,
S. H. George Allen, and T. M. Henkin.
1993.
Regulation of the Bacillus subtilis acetate kinase gene by CcpA.
J. Bacteriol.
175:7348-7355[Abstract/Free Full Text].
|
| 16.
|
Grundy, F. J.,
D. A. Waters,
Y., T. Y. Takova, and T. M. Henkin.
1993.
Identification of genes involved in utilization of acetate and acetoin in Bacillus subtilis.
Mol. Microbiol.
10:259-271[Medline].
|
| 17.
|
Henkin, T. M.
1996.
The role of the CcpA transcriptional regulator in carbon metabolism in Bacillus subtilis.
FEMS Microbiol. Lett.
135:9-15[Medline].
|
| 17a.
|
Huang, M.,
F. B. Oppermann-Sanio, and A. Steinbüchel.
1999.
Biochemical and molecular characterization of the Bacillus subtilis acetoin catabolic pathway.
J. Bacteriol.
18:3837-3841.
|
| 18.
|
Hueck, C. J.,
W. Hillen, and M. H. Saier, Jr.
1994.
Analysis of a cis-active sequence mediating catabolite repression in Gram-positive bacteria.
Res. Microbiol.
145:503-518[Medline].
|
| 19.
|
Hueck, C. J., and W. Hillen.
1995.
Catabolite repression in Bacillus subtilis: a global mechanism for the Gram-positive bacteria?
Mol. Microbiol.
15:395-401[Medline].
|
| 20.
|
Kim, J.-H.,
M. I. Voskuil, and G. H. Chambliss.
1998.
NADP, corepressor for the Bacillus catabolic control protein CcpA.
Proc. Natl. Acad. Sci. USA
95:9590-9595[Abstract/Free Full Text].
|
| 21.
|
Kunst, F., and G. Rapoport.
1995.
Salt stress is an environmental signal affecting degradative enzyme synthesis in Bacillus subtilis.
J. Bacteriol.
177:2403-2407[Abstract/Free Full Text].
|
| 22.
|
Latimer, M. T., and J. G. Ferry.
1993.
Cloning, sequence analysis, and hyperexpression of the genes encoding phosphotransacetylase and acetate kinase from Methanosarcina thermophila.
J. Bacteriol.
175:6822-6829[Abstract/Free Full Text].
|
| 23.
|
Lopez, J. M.,
B. Thoms, and H. Rehbein.
1975.
Acetoin degradation in Bacillus subtilis by direct oxidative cleavage.
Eur. J. Biochem.
57:425-430[Medline].
|
| 24.
|
Martin-Verstraete, I.,
M. Débarbouillé,
A. Klier, and G. Rapoport.
1990.
Levanase operon of Bacillus subtilis includes a fructose specific phosphotransferase system regulating the expression of the operon.
J. Mol. Biol.
214:657-671[Medline].
|
| 24a.
|
Martin-Verstraete, I.,
J. Deutscher, and A. Galinier.
1999.
Phosphorylation of HPr and Crh by HPrK, early steps in the catabolite repression signalling pathway for the Bacillus subtilis levanase operon.
J. Bacteriol.
181:2966-2969[Abstract/Free Full Text].
|
| 25.
|
Matsuyama, A.,
H. Yamamoto-Otake,
J. Hewitt,
R. T. A. MacGillivray, and E. Nakano.
1994.
Nucleotide sequence of the phosphotransacetylase gene of Escherichia coli strain K12.
Biochim. Biophys. Acta
1219:559-562[Medline].
|
| 26.
|
Maxam, A. M., and W. Gilbert.
1980.
Sequencing end-labeled DNA with base-specific chemical cleavages.
Methods Enzymol.
65:499-560[Medline].
|
| 27.
|
McCleary, W. R.,
J. B. Stock, and A. J. Ninfa.
1993.
Is acetyl phosphate a global signal in Escherichia coli?
J. Bacteriol.
175:2793-2798[Free Full Text].
|
| 28.
|
Miwa, Y.,
K. Nagura,
S. Eguchi,
H. Fukuda,
J. Deutscher, and Y. Fujita.
1997.
Catabolite repression of the Bacillus subtilis gnt operon exerted by two catabolite-responsive elements.
Mol. Microbiol.
23:1203-1213[Medline].
|
| 29.
|
Nitschké, P.,
P. Guerdoux-Jamet,
H. Chiapello,
G. Faroux,
C. Hénaut,
A. Hénaut, and A. Danchin.
1998.
Indigo: a World-Wide-Web review of genomes and gene functions.
FEMS Microbiol. Rev.
22:207-227[Medline].
|
| 30.
|
Perego, M.
1993.
Integrational vectors for genetic manipulation in Bacillus subtilis, p. 615-624.
In
A. L. Sonenshein, J. A. Hoch, and R. Losick (ed.), Bacillus subtilis and other gram-positive bacteria: biochemistry, physiology, and molecular genetics. American Society for Microbiology, Washington, D.C.
|
| 31.
|
Postma, P. W.,
J. W. Lengeler, and G. R. Jacobson.
1993.
Phosphoenolpyruvate: carbohydrate phosphotransferase systems in bacteria.
Microbiol. Rev.
57:543-594[Abstract/Free Full Text].
|
| 32.
|
Prüß, B. M., and A. J. Wolfe.
1994.
Regulation of acetyl phosphate synthesis and degradation, and the control of flagellar expression in Escherichia coli.
Mol. Microbiol.
12:973-984[Medline].
|
| 33.
|
Rado, T. A., and J. A. Hoch.
1973.
Phosphotransacetylase from Bacillus subtilis: purification and physiological studies.
Biochim. Biophys. Acta
321:114-125[Medline].
|
| 34.
|
Renna, M. C.,
N. Najimudin,
L. R. Winik, and S. A. Zahler.
1993.
Regulation of the Bacillus subtilis alsS, alsD, and alsR genes involved in post-exponential-phase production of acetoin.
J. Bacteriol.
175:3863-3875[Abstract/Free Full Text].
|
| 35.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor, N.Y
|
| 36.
|
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467[Abstract/Free Full Text].
|
| 37.
|
Singh-Wissmann, K., and J. K. Ferry.
1995.
Transcriptional regulation of the phosphotransacetylase-encoding and acetate kinase-encoding genes (pta and ack) from Methanosarcina thermophila.
J. Bacteriol.
177:1699-1702[Abstract/Free Full Text].
|
| 38.
|
Speck, E. L., and E. Freese.
1973.
Control of metabolite secretion in Bacillus subtilis.
J. Gen. Microbiol.
78:261-275[Abstract/Free Full Text].
|
| 39.
|
Stülke, J.,
I. Martin-Verstraete,
M. Zagorec,
M. Rose,
A. Klier, and G. Rapoport.
1997.
Induction of the Bacillus subtilis ptsGHI operon by glucose is controlled by a novel antiterminator, GlcT.
Mol. Microbiol.
25:65-78[Medline].
|
| 40.
|
Tsau, J. L.,
A. A. Guffanti, and T. J. Montville.
1992.
Conversion of pyruvate to acetoin helps to maintain pH homeostasis in Lactobacillus plantarum.
Appl. Environ. Microbiol.
58:891-894[Abstract/Free Full Text].
|
| 41.
|
Turinsky, A. J.,
F. J. Grundy,
J.-H. Kim,
G. H. Chambliss, and T. M. Henkin.
1998.
Transcriptional activation of the Bacillus subtilis ackA gene requires sequences upstream of the promoter.
J. Bacteriol.
180:5961-5967[Abstract/Free Full Text].
|
| 42.
|
Weickert, M. J., and G. H. Chambliss.
1990.
Site-directed mutagenesis of a catabolite repression operator sequence in Bacillus subtilis.
Proc. Natl. Acad. Sci. USA
87:6238-6242[Abstract/Free Full Text].
|
Journal of Bacteriology, November 1999, p. 6889-6897, Vol. 181, No. 22
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Poncet, S., Soret, M., Mervelet, P., Deutscher, J., Noirot, P.
(2009). Transcriptional Activator YesS Is Stimulated by Histidine-phosphorylated HPr of the Bacillus subtilis Phosphotransferase System. J. Biol. Chem.
284: 28188-28197
[Abstract]
[Full Text]
-
Puri-Taneja, A., Schau, M., Chen, Y., Hulett, F. M.
(2007). Regulators of the Bacillus subtilis cydABCD Operon: Identification of a Negative Regulator, CcpA, and a Positive Regulator, ResD. J. Bacteriol.
189: 3348-3358
[Abstract]
[Full Text]
-
Schilling, O., Frick, O., Herzberg, C., Ehrenreich, A., Heinzle, E., Wittmann, C., Stulke, J.
(2007). Transcriptional and Metabolic Responses of Bacillus subtilis to the Availability of Organic Acids: Transcription Regulation Is Important but Not Sufficient To Account for Metabolic Adaptation. Appl. Environ. Microbiol.
73: 499-507
[Abstract]
[Full Text]
-
Deutscher, J., Francke, C., Postma, P. W.
(2006). How Phosphotransferase System-Related Protein Phosphorylation Regulates Carbohydrate Metabolism in Bacteria. Microbiol. Mol. Biol. Rev.
70: 939-1031
[Abstract]
[Full Text]
-
Puri-Taneja, A., Paul, S., Chen, Y., Hulett, F. M.
(2006). CcpA Causes Repression of the phoPR Promoter through a Novel Transcription Start Site, PA6. J. Bacteriol.
188: 1266-1278
[Abstract]
[Full Text]
-
Lorca, G. L., Chung, Y. J., Barabote, R. D., Weyler, W., Schilling, C. H., Saier, M. H. Jr
(2005). Catabolite Repression and Activation in Bacillus subtilis: Dependency on CcpA, HPr, and HprK. J. Bacteriol.
187: 7826-7839
[Abstract]
[Full Text]
-
Larsson, J. T., Rogstam, A., von Wachenfeldt, C.
(2005). Coordinated patterns of cytochrome bd and lactate dehydrogenase expression in Bacillus subtilis. Microbiology
151: 3323-3335
[Abstract]
[Full Text]
-
Satomura, T., Shimura, D., Asai, K., Sadaie, Y., Hirooka, K., Fujita, Y.
(2005). Enhancement of Glutamine Utilization in Bacillus subtilis through the GlnK-GlnL Two-Component Regulatory System. J. Bacteriol.
187: 4813-4821
[Abstract]
[Full Text]
-
Wolfe, A. J.
(2005). The Acetate Switch. Microbiol. Mol. Biol. Rev.
69: 12-50
[Abstract]
[Full Text]
-
Belitsky, B. R., Kim, H.-J., Sonenshein, A. L.
(2004). CcpA-Dependent Regulation of Bacillus subtilis Glutamate Dehydrogenase Gene Expression. J. Bacteriol.
186: 3392-3398
[Abstract]
[Full Text]
-
Gerstmeir, R., Cramer, A., Dangel, P., Schaffer, S., Eikmanns, B. J.
(2004). RamB, a Novel Transcriptional Regulator of Genes Involved in Acetate Metabolism of Corynebacterium glutamicum. J. Bacteriol.
186: 2798-2809
[Abstract]
[Full Text]
-
Bulter, T., Lee, S.-G., Wong, W. W., Fung, E., Connor, M. R., Liao, J. C.
(2004). From the Cover: Design of artificial cell-cell communication using gene and metabolic networks. Proc. Natl. Acad. Sci. USA
101: 2299-2304
[Abstract]
[Full Text]
-
Warner, J. B., Magni, C., Lolkema, J. S.
(2003). CcpA-Independent Regulation of Expression of the Mg2+-Citrate Transporter Gene citM by Arginine Metabolism in Bacillus subtilis. J. Bacteriol.
185: 854-859
[Abstract]
[Full Text]
-
Ramstrom, H., Sanglier, S., Leize-Wagner, E., Philippe, C., Van Dorsselaer, A., Haiech, J.
(2003). Properties and Regulation of the Bifunctional Enzyme HPr Kinase/Phosphatase in Bacillus subtilis. J. Biol. Chem.
278: 1174-1185
[Abstract]
[Full Text]
-
Guillouard, I., Auger, S., Hullo, M.-F., Chetouani, F., Danchin, A., Martin-Verstraete, I.
(2002). Identification of Bacillus subtilis CysL, a Regulator of the cysJI Operon, Which Encodes Sulfite Reductase. J. Bacteriol.
184: 4681-4689
[Abstract]
[Full Text]
-
Marino, M., Ramos, H. C., Hoffmann, T., Glaser, P., Jahn, D.
(2001). Modulation of Anaerobic Energy Metabolism of Bacillus subtilis by arfM (ywiD). J. Bacteriol.
183: 6815-6821
[Abstract]
[Full Text]
-
Ould Ali, N., Bignon, J., Rapoport, G., Debarbouille, M.
(2001). Regulation of the Acetoin Catabolic Pathway Is Controlled by Sigma L in Bacillus subtilis. J. Bacteriol.
183: 2497-2504
[Abstract]
[Full Text]
-
Moir-Blais, T. R., Grundy, F. J., Henkin, T. M.
(2001). Transcriptional Activation of the Bacillus subtilis ackA Promoter Requires Sequences Upstream of the CcpA Binding Site. J. Bacteriol.
183: 2389-2393
[Abstract]
[Full Text]
-
Jankovic, I., Egeter, O., Brückner, R.
(2001). Analysis of Catabolite Control Protein A-Dependent Repression in Staphylococcus xylosus by a Genomic Reporter Gene System. J. Bacteriol.
183: 580-586
[Abstract]
[Full Text]
-
Warner, J. B., Krom, B. P., Magni, C., Konings, W. N., Lolkema, J. S.
(2000). Catabolite Repression and Induction of the Mg2+-Citrate Transporter CitM of Bacillus subtilis. J. Bacteriol.
182: 6099-6105
[Abstract]
[Full Text]
-
Turinsky, A. J., Moir-Blais, T. R., Grundy, F. J., Henkin, T. M.
(2000). Bacillus subtilis ccpA Gene Mutants Specifically Defective in Activation of Acetoin Biosynthesis. J. Bacteriol.
182: 5611-5614
[Abstract]
[Full Text]
-
Cruz Ramos, H., Hoffmann, T., Marino, M., Nedjari, H., Presecan-Siedel, E., Dreesen, O., Glaser, P., Jahn, D.
(2000). Fermentative Metabolism of Bacillus subtilis: Physiology and Regulation of Gene Expression. J. Bacteriol.
182: 3072-3080
[Abstract]
[Full Text]
-
Fillinger, S., Boschi-Muller, S., Azza, S., Dervyn, E., Branlant, G., Aymerich, S.
(2000). Two Glyceraldehyde-3-phosphate Dehydrogenases with Opposite Physiological Roles in a Nonphotosynthetic Bacterium. J. Biol. Chem.
275: 14031-14037
[Abstract]
[Full Text]
-
Dossonnet, V., Monedero, V., Zagorec, M., Galinier, A., Pérez-Martínez, G., Deutscher, J.
(2000). Phosphorylation of HPr by the Bifunctional HPr Kinase/P-Ser-HPr Phosphatase from Lactobacillus casei Controls Catabolite Repression and Inducer Exclusion but Not Inducer Expulsion. J. Bacteriol.
182: 2582-2590
[Abstract]
[Full Text]