Previous Article | Next Article 
Journal of Bacteriology, November 1999, p. 6922-6928, Vol. 181, No. 22
Area of Microbiology, Faculty of Biology,
University of León, 24071 León, Spain
Received 28 May 1999/Accepted 26 August 1999
The Clavulanic acid, a clinically used
Townsend and Ho showed that glycerate is a precursor of the C3 unit
(28), but the use of glycerate as the intermediate precursor of the C3 unit would require removal of the hydroxyl group at carbon 2 of the glycerate, which is not present in the Recently Thirkettle et al. (27) proposed that pyruvate (and
not glycerate) is the most likely primary metabolic source of the three
The genes for clavulanic acid biosynthesis are clustered together with
the genes for cephamycin C biosynthesis, forming the so-called
We have identified a gene, pyc, that encodes a protein
ressembling acetohydroxyacid synthases and appears to be involved in the conversion of pyruvate into the C3 unit of clavulanic acid. Inactivation of this gene leads to the inability to produce clavulanic acid in starch-asparagine medium but not in GSPG (glycerol, glutamic acid, proline) medium, suggesting that an alternative pathway bypasses
the conversion of pyruvate into the C3 unit.
Bacterial strains, plasmids, and DNA procedures.
Streptomyces clavuligerus ATCC 27064 and the disrupted
mutants obtained in this work were grown in GSPG medium
(24), SA (starch-asparagine) medium (19), and TSB
(Trypticase soy broth) liquid cultures as described previously
(24). GSP medium is GSPG medium without glycerol; SAG medium
is SA medium supplemented with 15 g of glycerol per liter. All
fermentation experiments were repeated twice, using triplicate flasks.
Data are the means ± standard deviation (SD) for duplicate
bioassays in triplicate flasks. Defined LAT minimal medium
(15) was used to test the auxotrophy of the disrupted mutants.
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Deletion of the pyc Gene Blocks
Clavulanic Acid Biosynthesis Except in Glycerol-Containing Medium:
Evidence for Two Different Genes in Formation of the C3 Unit
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-lactamase inhibitor clavulanic acid is formed by
condensation of a pyruvate-derived C3 unit with a molecule of arginine. A gene (pyc, for pyruvate converting) located upstream of
the bls gene in the clavulanic acid gene cluster of
Streptomyces clavuligerus encodes a 582-amino-acid protein
with domains recognizing pyruvate and thiamine pyrophosphate that shows
29.9% identity to acetohydroxyacid synthases. Amplification of the
pyc gene resulted in an earlier onset and higher production
of clavulanic acid. Replacement of the pyc gene with the
aph gene did not cause isoleucine-valine auxotrophy in the
mutant. The pyc replacement mutant did not produce clavulanic acid in starch-asparagine (SA) or in Trypticase soy broth
(TSB) complex medium, suggesting that the pyc gene product is involved in the conversion of pyruvate into the C3 unit of clavulanic acid. However, the -lactamase inhibitor was still formed
at the same level as in the wild-type strain in defined medium
containing D-glycerol, glutamic acid, and proline (GSPG medium) as confirmed by high-pressure liquid chromatography and paper
chromatography. The production of clavulanic acid by the replacement
mutant was dependent on addition of glycerol to the medium, and
glycerol-free GSPG medium did not support clavulanic acid biosynthesis,
suggesting that an alternative gene product catalyzes the incorporation
of glycerol into clavulanic acid in the absence of the Pyc protein. The
pyc replacement mutant overproduces cephamycin.
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-lactamase inhibitor, is synthesized by condensation of arginine
(25, 29) with a C3 unit derived from pyruvate or glycerate.
Incorporation of labelled pyruvate or glycerate into clavulanic acid
has been reported (9, 28), but the nature of the
intermediate substrate that binds to the amino group of arginine
remains uncertain. Gutman et al. (12) proposed an intact
incorporation of -hydroxypropionate into the C3 unit based on the
unchanged 3H/14C ratio in clavulanic acid
following incorporation of double-labelled [2-3H,
2-14C]hydroxypropionate, which suggests that no tritium is
lost from the C-2 methylene group during incorporation of the C3 unit.
The oxidation levels of the carbon atoms of -hydroxypropionate are the same as those in clavulanic acid.
-lactam ring of
clavulanic acid. Feeding experiments using racemic
[1,2-13C, 2,3,3,-2H] glycerate showed that no
incorporation of the hydrogen at C-2 of glycerate into the C-6 of
clavulanic acid occurred (23).
-lactam carbons of clavulanic acid. However, the reactions required
to convert pyruvate to the C3 unit remain unknown. The utilization of
pyruvate as primary precursor does not exclude the involvement of
-hydroxypropionate as the final intermediate in the condensation reaction.
-lactam supercluster (14, 30). Several genes of the
cluster (cas2, bls, pah,
car, and claR) have been assigned specific
biosynthesis roles (1, 2, 17, 19, 22), but the genes
encoding the formation of the C3 precursor and the initial condensation
step that results in formation of the N-carboxyethylarginine intermediate (10) remain to be identified. Since the genes
involved in precursor formation are sometimes associated with
-lactam biosynthesis clusters (18), it is of great
interest to characterize the genes involved in formation and/or
condensation of the C3 unit.
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
Southern blot hybridization. For Southern hybridizations, 10 µg of digested DNA of each strain was used. The probes were labelled with a Dig-High Prime kit (Boehringer Mannheim), and 0.2 µg of denatured probe was used in the hybridizations, using the conditions suggested by the manufacturer.
Gene disruption and gene replacement. Two different strategies were followed. (i) The 2.1-kb EcoRI-BglII insert present in plasmid pBSKS2.1 was digested with BstEII to linearize the plasmid. The BstEII site is located 1,534 nucleotides (nt) from the 5' end and 215 nt from the 3' end of open reading frame 2 (ORF2). The BstEII cohesive ends were filled, and a 1.3-kb DNA fragment containing the aph gene was inserted into the gap, with the orientation of the aph gene opposite that of ORF2; the DNA was then circularized. This construction was subcloned as a XhoI-SpeI 3.4-kb DNA fragment into BamHI-digested pHZ1351 (containing an unstable replication origin [3]), which was transformed into S. clavuligerus. Using standard procedures (21), we found that 50% of the transformants were kanamycin resistant and thioestrepton sensitive after two steps of sporulation in antibiotic-free medium.
(ii) Alternatively, two oligonucleotides (O1 [5'TTGGATCCGGTTTCGCCGGGGTGTT3', corresponding to nt 597-616 of ORF2] and O2 [5'TTGGATCCACCAGGTCATCGACTCCAT3', corresponding to nt 1183 to 1205 of ORF2]) were used to amplify by PCR a BamHI-ended 4.5-kb DNA fragment containing the pBSKS(+) vector, 616 nt of the 5' end of ORF2, and 566 nt of the 3' end of ORF2. A 1.3-kb BamHI DNA fragment containing the aph gene was ligated to give a circular construction. Afterwards, a 2.8-kb SpeI-XhoI DNA fragment containing the aph gene flanked by the 5' and 3' ends of ORF2 was subcloned into pHZ1351 and used to transform S. clavuligerus. After one step of sporulation in antibiotic-free medium, 97% of the transformants were found to be kanamycin resistant and thiostrepton sensitive, indicating that chromosomal integration by recombination had occurred.Clavulanic acid, cephamycin, and alanyl-clavam production. Clavulanic acid was quantified by bioassay using Klebsiella pneumoniae ATCC 29665 as described previously (24). The presence of clavulanic acid in the broth was confirmed by derivatization with imidazole as described by Bird et al. (4) and analysis by high-pressure liquid chromatography (HPLC) using the conditions indicated by Foulstone and Reading (11); under those conditions, clavulanic acid eluted with a retention time of 5.5 min. Additionally, clavulanic acid was identified by paper chromatography using Whatman chromatography paper (Whatman International Ltd.). The samples were developed in acetonitrile-n-propanol-H2O (1:1:1), and the clavulanic acid spot was identified by bioautography using K. pneumoniae. Under these conditions, pure clavulanic acid has an Rf of 0.67. Cephamycin C and alanyl-clavam were quantified by standard bioassay using E. coli ESS 22-31 and Bacillus strain ATCC 27860, respectively, as described previously (22, 25). Growth was estimated as cell DNA content, using salmon sperm DNA as the control as described by Burton (5).
Sequence analysis. Sequence analysis was done with the Editseq and Geneplot programs (DNAStar). The FASTA3 program was used to search the Swiss Protein database, and the Prosite program was used to look for specific motifs in the proteins. Alignment of proteins was done with the Clustal V program (DNAStar).
Nucleotide sequence accession number. The nucleotide sequence of pyc has been deposited in the EMBL database under accession no. AJ238211.
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Cloning and sequencing of ORF2.
Using DNA from 
phage
-AR3, which contains a 15-kb insert of S. clavuligerus
DNA of the region downstream of the pcbC gene (21), a 2.1-kb EcoRI-BglII fragment,
located downstream of the pbp54 gene (ORF1 in Fig.
1; also named pcbR
[20]), was subcloned into vectors pBSSK(+) and
pBSKS(+) and sequenced in both orientations. A complete ORF (ORF2; nt
145 to 1893) located 315 nt upstream of pbp54 and an
incomplete ORF (ORF3) downstream of ORF2 were found in the DNA
fragment. ORF3 corresponds to the gene bls described by
Bachmann et al. (2), encoding the -lactam synthetase.
ORF2 has 1,758 nt and a G+C content of 68.8% (Fig. 1). The presence of
the pbp54 gene upstream and in the opposite direction to
ORF2 and the positive expression of ORF2 in plasmid pVKBE2.1, a
pVK99-derived plasmid containing a 2.1-kb
EcoRI-BglII fragment carrying ORF2, indicates
that a promoter is present in the 143 nt upstream of ORF2.
|
|
Disruption of the gene encoded by ORF2 by insertion or replacement does not lead to isoleucine-valine auxotrophy. To elucidate the role of the protein encoded by ORF2 in cephamycin C and/or clavulanic acid biosynthesis, ORF2 was disrupted. Two types of disrupted mutants were obtained: (i) S. clavuligerus ORF2::aph-a, which has a 1.3-kb aph cassette inserted at position 1534 of the gene; and (ii) S. clavuligerus ORF2::aph-b, which contains the 1.3-kb insertion cassette in place of nt 760 to 1328 of ORF2.
Both disrupted mutants gave hybridizing bands of the expected size with the aph probe (Fig. 3A). S. clavuligerus ORF2::aph-a gave bands of 0.9 and 2.1 kb (lane 1), and S. clavuligerus ORF2::aph-b showed bands of 0.9 and 1.4 kb (Fig. 3B, lanes 3 and 4); the wild-type strain gave no hybridization (lane 2). With the ORF2 probe, the S. clavuligerus ORF2::aph-a mutant gave bands of 2.1 and 1.0 kb, and the S. clavuligerus ORF2::aph-b strain showed hybridization bands of 1.2 and 1.4 kb; the wild-type strain gave a single 2.7-kb hybridization band (not shown).
|
Replacement of pyc blocks clavulanic acid production
except in GSPG medium.
Clavulanic acid production by both strains
was tested in solid MEY and Trypticase soy agar media. S. clavuligerus pyc::aph-a (containing the
aph gene inserted in the 3' region of pyc)
produced the same levels of clavulanic acid as the wild-type strain.
This suggests that the 72 amino acids which are lacking in this mutant are not essential for clavulanic acid biosynthesis. However, the replacement mutant S. clavuligerus
pyc::aph-b did not produce clavulanic acid in
either of these media. To further study the effect of the
pyc deletion on the production of clavulanic acid, cephamycin, and alanyl-clavam, S. clavuligerus
pyc::aph-b was grown in liquid cultures in
either defined GSPG or SA medium or complex TSB medium. As expected,
the replacement mutant did not produce clavulanic acid in either TSB
medium (not shown) or SA medium (Fig.
4A). However, clavulanic acid was
produced by this mutant in GSPG medium (see below); the onset of
clavulanic acid biosynthesis was delayed 24 h in relation to the
wild-type strain (Fig. 4B), but the level of the -lactamase
inhibitor at 72 h was up to 95% of that seen in the control
S. clavuligerus strain. It seems that glycerol induces an
alternative enzyme system for its conversion into the C3 unit of
clavulanic acid.
|
) and replacement mutant S. clavuligerus pyc::aph-b (
) in SA (A) and
GSPG (B) media. (C) HPLC elution profile of the broth corresponding to
48 h of S. clavuligerus pyc::aph-b
growth in GSPG medium shown in panel B. The arrow indicates the peak
that coeluted with a sample of pure clavulanic acid (CA). (Inset)
Bioautography of a paper chromatography of culture broths. Lanes: 1, pure clavulanic acid (Rf 0.67); 2 and 3, S. clavuligerus pyc::aph-b grown in SA
medium; 4, S. clavuligerus 27064 grown in GSPG medium; 5, S. clavuligerus pyc::aph-b grown in
GSPG medium. SD are given as discontinuous bars for the wild-type
strain and as solid bars for the S. clavuligerus
pyc::aph-b mutant.
-lactamase inhibitory substance (since the inhibition zone decreased
considerably in the absence of penicillin G in the bioassay) with an
Rf of 0.67, identical to that found in broths of
the wild-type strain and to that of the pure clavulanic acid (Fig. 4C,
inset). A peak eluting with a retention time of 5.5 min that
cochromatographed with pure clavulanic acid was found by HPLC in the
GSPG-grown cultures of the S. clavuligerus
pyc::aph-b mutant (Fig. 4C).
Alanyl-clavam, detected by bioassay and confirmed by methionine
reversion, was produced by the wild-type strain in GSPG medium. The
production of alanyl-clavam by the S. clavuligerus
pyc::aph-b mutant was in the range of 45 to
66% of that of the control at different times of the culture.
Clavulanic acid production by the pyc-deleted mutant is dependent on the presence of glycerol. The production of clavulanic acid in GSPG medium suggested the existence of a different gene involved in the formation of the C3 unit in the disrupted mutant. Therefore, clavulanic acid formation was tested in GSP medium (containing glutamate, sucrose, and proline) compared with GSPG medium, (which contains glycerol [15 g/liter]) as well as in SA medium compared with SAG medium (SA medium supplemented with glycerol [15 g/liter]). acid-specific production are lower than in SPG medium, which reflects an increase of growth due to the presence of glycerol in GSPG. However, as shown in Fig. 5C and D, clavulanic acid production by the pyc replacement mutant is dependent on the presence of glycerol in GSPG medium. The absence of glycerol in the medium dramatically decreased also the production of alanyl-clavam by both strains (to less than 2% of the control condition), suggesting that the alternative pathway that converts glycerol into the C3 unit may be directly related to clavam biosynthesis. Therefore, it seems that an alternative gene to pyc encodes an enzyme able to form the C3 unit from D-glycerol instead of pyruvate in GSPG medium.
|
Amplification of the pyc gene results in an earlier onset and higher production of clavulanic acid. In parallel, the effect of pyc gene dosage on antibiotic production was tested by using multicopy plasmid pVKEB2.1 (9.9 kb). The higher pyc gene dosage in S. clavuligerus[pVKEB2.1] results in an earlier formation of clavulanic acid and higher levels of this compound than in the control strain, S. clavuligerus[pULVK99] (Fig. 6).
The pyc-replacement mutant overproduces
cephamycin.
Another interesting finding is the observation that
the pyc replacement mutant is an overproducer of cephamycin
in three different media, GSPG, SA (Fig. 5), and the soy meal-based TSB
(not shown). In parallel, the amplification of pyc in
S. clavuligerus[pVKBE2.1] resulted in lower production of
cephamycin (Fig. 6C and D). The increase
in cephamycin biosynthesis by the pyc deletion mutant might
be explained by sparing pyruvate for use in the lysine (
-aminoadipic acid) pathway. Lysine is formed through the dihydrodipicolinic intermediate by condensation of pyruvate with the four-carbon aspartic
acid semialdehyde. Alternatively, the Pyc protein may have a repressor
effect on cephamycin biosynthesis that is lacking in the pyc
replacement mutant. This hypothesis is being further investigated to
establish if the transcripts (or enzymes) for the cephamycin gene
cluster are enhanced in the pyc-disrupted mutant.
|
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
The cloned pyc gene shows 29.9% identity in specific motifs to acetohydroxyacid synthases, enzymes that condense two pyruvate units to form acetolactic acid. An S. clavuligerus strain disrupted in the pyc gene is prototrophic and does not require isoleucine or valine to grow, thus ruling out the possibility that the pyc gene encodes a functional acetohydroxyacid synthase. The conserved amino acids in pyruvate-binding motifs suggest, however, that pyruvate is a substrate of this enzyme.
The pyc gene product is required for clavulanic acid
biosynthesis in the standard SA medium; this medium has been optimized for clavulanic acid production with very high yields of the
-lactamase inhibitor. We propose that the pyc gene is
involved in the conversion of pyruvate to a hydroxyacid, presumably
-hydroxypropionate (Fig. 1). Genes for precursor formation are
sometimes clustered with antibiotic biosynthesis genes (18).
The pyc gene of the clavulanic acid cluster appears to play
a role in formation of the C3 unit, just as the
lysine-6-aminotransferase encoded by the lat gene of the
cephamycin cluster is involved in formation of the -aminoadipic acid
precursor of cephamycin (8, 16).
An interesting finding is the observation that S. clavuligerus lacking the pyc gene is able to produce
clavulanic acid in GSPG, a defined medium containing glycerol in
addition to proline and glutamate (24). When glycerol was
removed from this medium, clavulanic acid production by the replacement
deletion mutant dropped to barely detectable levels. These results
suggest that there is a gene(s) that encodes an enzyme able to convert
glycerol into the C3 precursor independently from the pyc
gene product. This alternative enzyme system is possibly repressed in
starch- or soy meal-supplemented SA (Fig. 5A and B) or TSB medium. This result explains some of the previous confusion about the incorporation of C3 precursors into clavulanic acid. Incorporation of glycerol (9, 28), propionate (9), -hydroxypropionate
(12), pyruvate (23, 28), and D- and
L-glycerate (28) has been reported. The reported
incorporation of labelled precursors must have been dependent on the
biosynthetic route for the C3 unit used in each growth medium.
Our results indicate that there are at least two different pathways involved in formation of C3 unit; the first one, encoded by the pyc gene, appears to use pyruvate as the substrate and is catalyzed by the acetohydroxyacid synthase-like pyc gene product. These observations support the recent proposal of Pitlik and Townsend (23) that pyruvate is the real precursor of the C3 unit. Interestingly, in defined medium containing glycerol, this three-carbon alcohol provides a good level of clavulanic acid production, suggesting that it is converted to the C3 unit. The parallel gene might be involved in the formation of the C3 unit for clavam biosynthesis since in the absence of glycerol, the formation of alanyl-clavam is drastically reduced in the wild-type strain and the pyc replacement mutant.
| |
ACKNOWLEDGMENTS |
|---|
This research was supported by grants from the CICYT, Madrid (BIO-96-0827), and from Antibióticos, S.A. (León), Spain. R. Pérez-Redondo received a fellowship from the University of León.
We thank Sonia Campoy and Luis M. Lorenzana for help in measuring clavulanic acid by HPLC and paper chromatography.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Area of Microbiology, Faculty of Biology, University of León, 24071 León, Spain. Phone: (34-987) 291504. Fax: (34-987) 291506. E-mail: degplp{at}unileon.es.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
| 1. | Aidoo, K. A., A. Wong, D. C. Alexander, R. A. R. Rittamer, and S. E. Jensen. 1994. Cloning, sequencing and disruption of a gene from S. clavuligerus involved in clavulanic acid biosynthesis. Gene 147:41-46[Medline]. |
| 2. |
Bachmann, B. O.,
R. Li, and C. A. Townsend.
1998.
-Lactam synthetase: a new biosynthetic enzyme.
Proc. Natl. Acad. Sci. USA
95:9082-9086 |
| 3. | Bao, K., X. Zhou, T. Kieser, and Z. Deng. 1997. pHZ1351, a broad host-range plasmid vector useful for gene cloning and for gene replacement in Streptomyces hygroscopicus KMP3, abstr. 4P15. In Abstracts of ISBA'97.Beijing, People's Republic of China. |
| 4. | Bird, A. E., J. M. Bellis, and B. C. Gasson. 1982. Spectrophotometric assay of clavulanic acid by reaction with imidazole. Analyst 107:1241-1245. |
| 5. | Burton, K. 1956. A study of the conditions and mechanism of the diphenylamine reaction for the colorimetric estimation of deoxyribonucleic acid. Biochem. J. 62:315-323[Medline]. |
| 6. | Chary, V. K., J. L. Fuente, P. Liras, and J. F. Martín. 1997. amy as a reporter gene for promoter activity in Nocardia lactamdurans: comparison of promoters of the cephamycin cluster. Appl. Environ. Microbiol. 63:2977-2982[Abstract]. |
| 7. | Chipman, D., Z. Barak, and J. V. Schloss. 1998. Biosynthesis of 2-aceto-2-hydroxyacids:acetolactate synthases and acetohydroxyacid synthases. Biochim. Biophys. Acta 1385:401-419[Medline]. |
| 8. |
Coque, J. J. R.,
P. Liras,
L. Laíz, and J. F. Martín.
1991.
A gene encoding lysine-6-aminotransferase, which forms the -lactam precursor -aminoadipic acid, is located in the cluster of cephamycin biosynthetic genes in Nocardia lactamdurans.
J. Bacteriol.
173:6258-6264 |
| 9. | Elson, S. W., and R. S. Oliver. 1978. Studies on the biosynthesis of clavulanic acid. I. Incorporation of 13C-labelled precursors. J. Antibiot. 31:586-592[Medline]. |
| 10. | Elson, S. W., K. H. Baggaley, M. Fulston, N. H. Nicholson, J. W. Tyler, J. Edwards, H. Holms, I. Hamilton, and D. M. Mousdale. 1993. Two novel arginine derivatives from a mutant of Streptomyces clavuligerus. J. Chem. Soc. Chem. Commun. 1993:1211-1212. |
| 11. | Foulstone, M., and C. Reading. 1982. Assay of amoxicillin and clavulanic acid, the components of aumgmentin, in biological fluids with high-performance liquid chromatography. Antimicrob. Agents Chemother. 178:6310-6318. |
| 12. |
Gutman, A. L.,
V. Ribon, and A. Boltanski.
1985.
Incorporation of -hydroxypropionate into the -lactam residue of clavulanic acid.
J. Chem. Soc. Chem. Commun.
1985:1627-1629.
|
| 13. | Hawkins, C. F., A. Borges, and R. N. Perham. 1989. A common structural motif in thiamine pyrophosphate-binding enzymes. FEBS Lett. 255:77-82[Medline]. |
| 14. | Hodgson, J. E., A. P. Fosberry, N. S. Rawlinson, H. N. M. Ross, R. J. Neal, J. C. Arnell, A. J. Earl, and E. J. Lawlor. 1995. Clavulanic acid biosynthesis in Streptomyces clavuligerus: gene cloning and characterization. Gene 166:49-55[Medline]. |
| 15. |
Madduri, K.,
S. Stuttard, and L. C. Vining.
1989.
Lysine catabolism in Streptomyces spp. is primarily through cadaverine: -lactam producers also make -aminoadipate.
J. Bacteriol.
17:1299-1302.
|
| 16. |
Madduri, K.,
S. Stuttard, and L. C. Vining.
1991.
Cloning and location in Streptomyces spp. of a gene governing lysine-6-aminotransferase, an enzyme initiating -lactam biosynthesis in Streptomyces spp.
J. Bacteriol.
173:985-988 |
| 17. | Marsh, E. N., M. Chang Dah-Tsyr, and C. A. Townsend. 1992. Two isoenzymes of clavaminate synthase central to clavulanic acid formation: cloning and sequencing of both genes from Streptomyces clavuligerus. Biochemistry 31:12648-12657[Medline]. |
| 18. |
Martín, J. F.
1998.
New aspects of gene and enzymes for -lactam antibiotic biosynthesis.
Appl. Microbiol. Biotechnol.
50:1-15[Medline].
|
| 19. |
Paradkar, A. S., and S. E. Jensen.
1995.
Functional analysis of the gene encoding the clavaminate synthase 2 isoenzyme involved in clavulanic acid biosynthesis in Streptomyces clavuligerus.
J. Bacteriol.
177:1307-1314 |
| 20. |
Paradkar, A. S.,
A. Kwanema,
K. A. Aidoo,
A. Wong, and S. E. Jensen.
1996.
Molecular analysis of a -lactam resistance gene encoded within the cephamycin gene cluster of Streptomyces clavuligerus.
J. Bacteriol.
178:6266-6274 |
| 21. |
Pérez-Llarena, F. J.,
P. Liras,
A. Rodríguez-García, and J. F. Martín.
1997.
A regulatory gene (ccaR) required for cephamycin and clavulanic acid production in Streptomyces clavuligerus: amplification results in overproduction of both -lactam compounds.
J. Bacteriol.
179:2053-2059 |
| 22. | Pérez-Redondo, R., A. Rodríguez-García, J. F. Martín, and P. Liras. 1998. The claR gene of Streptomyces clavuligerus, encoding a LysR-type regulatory protein controlling clavulanic acid biosynthesis, is linked to the clavulanate-9-aldehyde reductase (car) gene. Gene 211:311-321[Medline]. |
| 23. | Pitlik, J., and C. A. Townsend. 1997. The fate of [2,3,3,-2H3, 1,2-13C2]-D,L-glycerate in clavulanic acid biosynthesis. Chem. Commun. 1997:225-226. |
| 24. | Romero, J., P. Liras, and J. F. Martín. 1984. Dissociation of cephamycin and clavulanic acid biosynthesis in Streptomyces clavuligerus. Appl. Microbiol. Biotechnol. 20:318-325. |
| 25. |
Romero, J.,
P. Liras, and J. F. Martín.
1986.
Utilization of ornithine and arginine as specific precursors of clavulanic acid.
Appl. Environ. Microbiol.
52:892-897 |
| 26. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y |
| 27. |
Thirkettle, J. E.,
J. E. Baldwin,
J. Edwards,
J. P. Griffin, and C. J. Schofield.
1997.
The origin of the -lactam carbons of clavulanic acid.
Chem. Commun.
1997:1025-1026.
|
| 28. | Townsend, C. A., and M. Ho. 1985. Biosynthesis of clavulanic acid: origin of the C3 unit. J. Am. Chem. Soc. 107:1066-1068. |
| 29. | Valentine, B. B., C. R. Bailey, A. Doherty, J. Morris, S. W. Elson, K. H. Baggaley, and N. H. Nicholson. 1993. Evidence that arginine is a later metabolic intermediate than ornithine in the biosynthesis of clavulanic acid by Streptomyces clavuligerus. J. Chem. Soc. Chem. Commun. 1993:1210-1212. |
| 30. | Ward, J. M., and J. E. Hodgson. 1993. The biosynthetic genes for clavulanic acid and cephamycin production occur as a "super-cluster" in three Streptomyces. FEMS Microbiol. Lett. 110:239-242[Medline]. |
Journal of Bacteriology, November 1999, p. 6922-6928, Vol. 181, No. 22
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Banos, S., Perez-Redondo, R., Koekman, B., Liras, P.
(2009). Glycerol Utilization Gene Cluster in Streptomyces clavuligerus. Appl. Environ. Microbiol.
75: 2991-2995
[Abstract] [Full Text] -
Zelyas, N. J., Cai, H., Kwong, T., Jensen, S. E.
(2008). Alanylclavam Biosynthetic Genes Are Clustered Together with One Group of Clavulanic Acid Biosynthetic Genes in Streptomyces clavuligerus. J. Bacteriol.
190: 7957-7965
[Abstract] [Full Text] -
de la Fuente, A., Martin, J. F., Rodriguez-Garcia, A., Liras, P.
(2004). Two Proteins with Ornithine Acetyltransferase Activity Show Different Functions in Streptomyces clavuligerus: Oat2 Modulates Clavulanic Acid Biosynthesis in Response to Arginine. J. Bacteriol.
186: 6501-6507
[Abstract] [Full Text] -
Tahlan, K., Anders, C., Jensen, S. E.
(2004). The Paralogous Pairs of Genes Involved in Clavulanic Acid and Clavam Metabolite Biosynthesis Are Differently Regulated in Streptomyces clavuligerus. J. Bacteriol.
186: 6286-6297
[Abstract] [Full Text] -
Lorenzana, L. M., Perez-Redondo, R., Santamarta, I., Martin, J. F., Liras, P.
(2004). Two Oligopeptide-Permease-Encoding Genes in the Clavulanic Acid Cluster of Streptomyces clavuligerus Are Essential for Production of the {beta}-Lactamase Inhibitor. J. Bacteriol.
186: 3431-3438
[Abstract] [Full Text] -
Tahlan, K., Park, H. U., Wong, A., Beatty, P. H., Jensen, S. E.
(2004). Two Sets of Paralogous Genes Encode the Enzymes Involved in the Early Stages of Clavulanic Acid and Clavam Metabolite Biosynthesis in Streptomyces clavuligerus. Antimicrob. Agents Chemother.
48: 930-939
[Abstract] [Full Text] -
Jensen, S. E., Wong, A., Griffin, A., Barton, B.
(2004). Streptomyces clavuligerus Has a Second Copy of the Proclavaminate Amidinohydrolase Gene. Antimicrob. Agents Chemother.
48: 514-520
[Abstract] [Full Text] -
de la Fuente, A., Lorenzana, L. M., Martin, J. F., Liras, P.
(2002). Mutants of Streptomyces clavuligerus with Disruptions in Different Genes for Clavulanic Acid Biosynthesis Produce Large Amounts of Holomycin: Possible Cross-Regulation of Two Unrelated Secondary Metabolic Pathways. J. Bacteriol.
184: 6559-6565
[Abstract] [Full Text] -
Mellado, E., Lorenzana, L. M., Rodriguez-Saiz, M., Diez, B., Liras, P., Barredo, J. L.
(2002). The clavulanic acid biosynthetic cluster of Streptomyces clavuligerus: genetic organization of the region upstream of the car gene. Microbiology
148: 1427-1438
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»