Department of Microbiology and Immunology,
University of Illinois, Chicago, Illinois 60612-7344
 |
INTRODUCTION |
Metal resistance systems are well
known in many bacterial types. The genes governing these resistances
are generally (but not always) found on plasmids and encode resistances
to toxic metal(loid) ions including Ag+,
AsO2
, AsO43,
Cd2+, Co2+, CrO42,
Cu2+, Hg2+, Ni2+, Pb2+,
Sb3+, TeO32, Tl+, and
Zn2+ (e.g., references 26 and
27). While most resistance systems function by
energy-dependent efflux of toxic ions, some involve enzymatic
transformations. The best-known example of these is mercurial
resistance (16, 23, 27) that involves one or two enzymes:
mercuric reductase, which converts soluble inorganic Hg2+
to Hg0, which is rapidly eliminated from aerobic microbial
cultures as a gas, and organomercurial lyase, which cleaves the Hg-C
bond of more toxic methylmercury, phenylmercury, and other
organomercurials to less toxic inorganic Hg2+. In addition,
all mercurial resistance systems have genes for Hg2+
transport to bring extracellular Hg2+ into the cell, where
mercuric reductase is found. The logic for this counterintuitive
finding of a transport system to bring a toxic compound into the cell
is that extracellular Hg2+ itself is highly toxic and needs
to be chaperoned from the initial binding site outside the cell to the
intracellular reductase enzyme that depends on the high-energy
intracellular cofactor NADPH. A regulatory protein, MerR (28,
30), provides tight control of expression, so that the gene
products are made only at times of need. MerR is a positively acting
regulatory protein that binds to the transcriptional mRNA start site,
and on addition of Hg2+, MerR twists and bends the DNA to a
conformation suitable for opening and initiation of mRNA synthesis
(1, 30).
Although all mercury resistance systems have these functions (and
genes) in common, the organization, and sometimes the occurrence, of
genes differs between gram-positive and gram-negative bacteria (e.g.,
references 23 and 27). With one known exception, all mercury resistance systems of gram-negative bacteria start with a
divergently (and therefore separately) transcribed merR
gene. For mercury resistance systems of low-G+C gram-positive bacteria (18, 34), the merR gene is the first gene of the
major transcript. In both gram-positive and -negative bacteria, the
genes determining the Hg2+ transport system are promoter
proximal, located upstream of the long merA gene for
mercuric reductase. Most mercury resistance systems of gram-negative
enteric bacteria lack a merB gene for organomercurial lyase
(and are therefore called narrow spectrum since they do not confer
resistance to most organomercurials). To date, all mercury resistance
systems of gram-positive bacteria are broad spectrum and have the
merB gene for organomercurial lyase.
The mercury resistance determinant of Bacillus cereus RC607
is unusual in several aspects, and it is also the most thoroughly studied mer system from a gram-positive bacterium. The
Bacillus mer resistance determinant is located on the
chromosome and not on a plasmid. The initial studies by Wang et al.
(33, 34) reported two sequences with a gap in between. The
first gene (initially called open reading frame 1 [ORF1] but now
renamed merR1) encodes the positively acting homodimeric
MerR protein, which has been studied in depth (12-14). We
have identified a second regulatory gene, called merR2, in
the newly sequenced gap region and the presence of a second
operator-promoter region (O/P2) just upstream of merR2. This
is the first occasion when two similarly oriented transcriptional start
sites have been identified in a mercurial resistance system. The
merA gene is long, with 632 codons and two 5' motifs for
metal-binding domains. The structure of the MerA protein of B. cereus RC607 was solved by X-ray crystallography (25)
and is used as the model for all mercuric reductases from gram-positive
or -negative bacteria (8). B. cereus MerA is still the only mercury resistance protein with a structural solution from crystallography. The crystal structure was missing the first 160 amino acids, forming the metal-binding motifs (25), leading to the suggestion that they lack a fixed position in the protein crystal. A second merB gene, now called merB2,
has been identified (below) in the new sequence in B. cereus
RC607. This is the first time two merB genes have been found
in a single system in gram-positive bacteria, although two
merB genes have been found previously in a
Pseudomonas strain (17).
Understanding of the genetic and molecular properties of the mercury
resistance determinant of B. cereus RC607 is important because very similar systems have been found in other laboratories with
isolates of diverse environmental origins. Nakamura and Silver (20), Bogdanova et al. (3), and Hart et al.
(11) found chromosomal determinants of mercury resistance
with DNA properties similar to those of this Boston Harbor sediment
B. cereus RC607 (19) in bacteria from marine
sediments in Japan, soil samples from Russian mining sites, and
freshwater river sediments in the United Kingdom, respectively. A
system identical to that of B. cereus RC607 has now been
identified in anaerobic gram-positive marine bacteria (bacilli and
clostridia) in Japan (7a, 16a).
| |
MATERIALS AND METHODS |
Growth studies.
Resistance to HgCl2 and
phenylmercuric acetate (PMA) of B. cereus RC607
(19), Bacillus subtilis 168, and
Escherichia coli JM109, JM109(pUC19) (2),
JM109(pYW33), and JM109(pYW40) (plasmids are described in reference
34) was measured in Luria-Bertani (LB) broth
(2) containing HgCl2 or PMA. LB broth was
inoculated with log-phase cells at a turbidity of 2 Klett units
(equivalent to 20 µg [wet weight] of cells per ml), and growth
(increase in Klett turbidity units) was measured after 20 h at
37°C.
Reductase assays.
Whole-cell mercuric reductase assays
(e.g., references 21 and 34) for
the conversion of Hg2+ to Hg0 was measured with
B. cereus RC607 and E. coli JM109(pYW33) as test
strains, E. coli JM109(pUC19) as a negative control, and E. coli J53(pGN120) (21) as a positive control.
Overnight bacterial cultures were inoculated into fresh LB broth (at 20 µg [wet weight] of cells per ml) and grown at 30°C to a turbidity
reading of about 50 to 70 Klett units. An aliquot of the uninduced (UI)
cells was harvested by centrifugation and kept on ice. The remaining
culture was induced (I) for 1 h by the addition of 1 µM
Hg2+. The cell pellets were washed with chilled suspension
buffer (50 mM sodium phosphate [pH 7.4], 0.5 mM Na2EDTA)
and suspended at the equivalent of 2,000 Klett units. The cell
suspension was added to 203Hg2+-containing
assay buffer (total volume, 250 µl containing 50 mM sodium phosphate
[pH 7.4], 0.5 mM Na2EDTA, 0.2 mM magnesium acetate, 1 mM
-mercaptoethanol, 5 µM HgCl2 [containing
203Hg2+], 0.5 mg of bovine serum albumin
fraction V [Sigma Chemical Co., St. Louis, Mo.) per ml, and 250 µg
of chloramphenicol per ml) to give a final turbidity value of 200 Klett
units. The assay mixture was incubated at 30°C with rapid (200 rpm)
shaking, and 25 µl of the assay mixture was periodically removed to 3 ml of water-miscible scintillation fluid. The remaining radioactivity in the samples was counted by a Packard Tri-Carb 1900CA liquid scintillation counter.
DNA sequencing.
To obtain the DNA sequence between the two
Bacillus mer determinant sequences of Wang et al.
(34), plasmid pYW40 was transformed into E. coli
DH5
. Plasmid DNA was isolated and purified by Qiagen (Santa Clarita,
Calif.) spin column purification and used for sequencing at the
University of Illinois-Urbana DNA Sequencing Facility. The dye
terminator dideoxy sequencing reaction protocol of Applied Biosystems
was used, and analysis was done with an Applied Biosystems 373A
automated DNA sequencer. Primers (boxed in Fig.
1B) were synthesized that started (i) 696 nucleotides (nt) after the stop codon of merA
(5'CGCTAGTATCAAGGAAACGG3'; forward) and (ii) 110 nt upstream
from the start of merB1 (5'CATAGCTTGTCTGATTTTTGA3') and in the opposite orientation (reverse). From the first
sequence data, a second set of primers was designed and used:
5'AGCTAAGCTGCCTAAAGAATC3', starting 635 nt down from the
start of the first forward primer, and 5'AACTGCCTGCCCATCACGAAT3',
starting 552 nt upstream from the start of the first reverse
primer. The sequences were compiled and provided 1,200 nt of
double-stranded data including 1,114 previously undetermined positions.
Single-stranded sequences from the second set of primers extended in
both directions more than 100 nt beyond the initial primers into the
previously determined sequences of Wang et al. (34).
View larger version (91K):
[in this window]
[in a new window]
|
FIG. 1.
(A) Diagram of the chromosomal mercury resistance
determinant of B. cereus RC607 showing the two determined
O/P regions, the names of the genes, and the sizes of the gene products
in amino acids (aa). The locations of the two oligonucleotide primers
used for RT-PCR analysis and the three mRNA transcripts are shown. (B)
DNA sequence of the region between merA and merB1
(as shown in panel A), with 100 nt per line, showing the newly
completed region between the end of the sequence with GenBank accession
no. M22708 and the start of the sequence with accession no. M22709. The
final amino acid translation and termination codon of merA,
the amino acid translation sequences of the new MerR2 and MerB2 protein
products, and the first six amino acids of MerB1 are shown. The +1
first mRNA position for O/P2 is marked, and the positions of the four
oligomer primers used for sequencing are boxed.
|
|
Transcript analysis.
RNA was isolated from uninduced cells
or cells exposed to HgCl2 or PMA for 2 h at 37°C
during growth in LB broth by using the RNeasy total RNA preparation kit
(Qiagen Inc., Santa Clarita, Calif.). E. coli JM109(pYW33)
(UI or I by growth with 5, 10, or 25 µM HgCl2 or 5 or 10 µM PMA) and B. cereus RC607 (UI or I with 10 µM
HgCl2) were included. The RNA was treated with DNase (RNase free; Life Technologies, Gaithersburg, Md.). For reverse transcriptase PCR (RT-PCR) (10), 1 µg of RNA was used for cDNA synthesis
with Superscript II RT in accordance with the manufacturer's (Life Technologies) protocol. PCR was performed with PlatiTaq polymerase (Life Technologies), and amplification products were visualized in
agarose gels after ethidium bromide staining and recorded by a
Nucleotech gel documentation system with GelExpert 97 version 2.0.
For identification of transcription start sites by primer extension, 1 µg of RNA was used as the template for cDNA synthesis with Moloney
murine leukemia virus RT (Promega Corporation, Madison, Wis.) in
accordance with the manufacturer's protocol. Sequencing ladder
reactions were obtained with the Sequenase version 2.0 DNA sequencing
kit (Amersham Life Science, Cleveland, Ohio) and the same
oligonucleotide primers as used for primer extension. Primer extension
and sequencing ladder products were separated on 7% polyacrylamide
gels containing 7 M urea and visualized by exposure to X-Omat AR film
(Eastman Kodak Company, Rochester, N.Y.).
Nucleotide sequence accession number.
The new sequence and
assembled mer determinant of B. cereus RC607 has
been assigned GenBank accession no. AF138877.
| |
RESULTS |
DNA sequence analysis.
Although this is a report on the
transcriptional organization and expression of the mercurial resistance
determinant of B. cereus RC607, the presence of a gap in the
previous sequence (34) needed to be eliminated. Figure 1A
shows the overall completed structure of the chromosomal Bacillus
mer determinant with additional data obtained by sequence walking
(starting with position 4100 of the sequence with accession no. M22708
and ending with position 216 of the sequence with GenBank accession no.
M22709 [Fig. 1B], which is equivalent to positions 4100 to 6205 of
the assembled new sequence in the GenBank database). The central 1,114 nt (shown in Fig. 1B) are new data, and the total sequence now consists of 7,029 nt and is available from GenBank under accession no. AF138877.
The order of genes in the complete mercury resistance determinant is
operator-promoter 1 (O/P1) merR1 merT ORF3 ORF4 merA O/P2 merR2 merB2 merB1 (Fig. 1A). The
sequence shown in Fig. 1B starts just before the end of the
merA gene (position 4100 of the sequence with GenBank
accession no. M22708) and continues to just after the beginning of
merB1 (position 210 of the sequence with GenBank accession
no. M22709). The final position (nt 4875) of reference
34 (sequence with accession no. M22708 including
merA) and the first position (nt 1) of reference
34 (sequence with accession no. M22709 including
merB1) are noted in Fig. 1B.
Two significant ORFs were found in the new sequence, as shown in Figure
1. An ORF of 130 codons has a predicted product homologous (29%
identical amino acids) to MerR of B. cereus RC607
(34). The corresponding gene is called merR2, and
the previous gene is now called merR1. Overlapping the
termination codon of merR2 by a single base (ATGA) (Fig. 1B)
is the start codon of the second ORF, which is now called
merB2, since from sequence homologies it appears to be the
gene for an additional organomercurial lyase with (again) 29% of its
amino acids identical to those of the previous gene product (now called
MerB1). These sequence homologies will be considered further in the
Discussion. Wang et al. (34) noted an AT-rich inverted
repeat as a strong candidate for termination of transcription after
merA. In the region between this proposed transcriptional
stop site and the beginning of merR2, an additional transcriptional start site (Fig. 1) was identified by primer extension (see below).
Resistance to inorganic mercury and PMA.
The mercury
resistance determinant confers resistance to both Hg2+ and
PMA (Fig. 2), in comparison to a control
sensitive strain, B. subtilis 168. When it was cloned into
plasmid pUC19 in E. coli (pYW33; reference
34), a higher level of resistance was obtained than
with B. cereus RC607 (Fig. 2). This difference may reflect differing expression of gene products or different resistance levels of
the host cells. Unexpectedly, transformation of the pUC19 control
vector into E. coli resulted in a slightly higher level of
resistance to both Hg2+ and PMA. The deletion form of
pYW33, missing the merO/P1 promoter and the first four genes
(pYW40), contains the intact merA, merR2, merB2, and merB1 genes and conferred an
intermediate level of resistance to both Hg2+ and PMA (Fig.
2).
View larger version (23K):
[in this window]
[in a new window]
|
FIG. 2.
(A) Growth of B. cereus RC607 and E. coli containing cloned fragments in LB broth with added
Hg2+ (A) and phenylmercury acetate (B) at 37°C for
20 h. Symbols:  , B. subtilis 168 (sensitive
control);  , B. cereus RC607 (resistant);  and  ,
E. coli JM109 and JM109(pUC19) (both sensitive);  and
 , E. coli JM109 with cloned Bacillus mer
fragments in plasmids pYW33 (resistant) and pYW40 (missing O/P1 and
transport genes).
|
|
Volatilization of radioactive mercury.
To measure inducibility
and overall expression of mercuric reductase, the volatilization of
radioactivity from added 5 µM 203Hg2+ was
monitored (Fig. 3). B. cereus
RC607 showed the most rapid loss of 203Hg2+,
and the uninduced Bacillus cells showed approximately 3% of the rate of volatilization of induced cells. With E. coli
JM109(pYW33) carrying the cloned Bacillus mer determinant, a
much lower rate of volatilization was seen (70 times less than with
B. cereus RC607; Fig. 3). This difference is not consistent
with the higher resistance level (Fig. 2). How assay conditions such as
media, temperature, and timing differences between growth and
volatilization experiments explain this is not known. It was not a
question of the bacterial species, E. coli versus
Bacillus, as E. coli J53(pGN120) cells
(21) with a mercury resistance determinant from a
gram-negative bacterium volatilized 203Hg2+
rapidly (Fig. 3).
View larger version (17K):
[in this window]
[in a new window]
|
FIG. 3.
Volatilization of 203Hg2+ from
cells of B. cereus RC607 ( [UI] or [I]), and
E. coli J53(pGN120) ( [UI] or [I]), and E. coli JM109(pYW33) ( [UI] or [I]) and JM109(pUC19) ( [UI] or  [I]). Cells were grown in LB broth, I or UI, harvested,
and suspended in assay buffer with 5 µM
203HgCl2 at 30°C with aeration and shaking.
Samples were removed periodically, and residual radioactivity was
counted in scintillation fluid.
|
|
Transcription of the mercury resistance determinant.
The
transcription from the mercury resistance determinant of B. cereus RC607 was characterized by Northern blot RNA-DNA
hybridization, primer extension determination of transcript start
sites, and RT-PCR determination of which genes were traversed by a
single transcript. Northern blot analysis with RNA from induced
Bacillus cells did not show specific transcripts (data not
shown). Whether this was due to instability of long transcripts (Fig.
1A) is not clear, but it is not unusual to be unable to isolate intact
long transcripts in sufficient amounts for Northern blot analysis
(e.g., reference 10).
Primer extension determination of transcriptional start sites.
To locate the O/P1 transcriptional start site and to determine whether
the second predicted transcriptional start site, O/P2, is used in vivo,
primer extension analysis was used (Fig.
4). Sufficient RNA transcript for these
experiments was not found in induced cells of B. cereus
RC607 (data not shown), so the Bacillus mercury resistance
determinant cloned in E. coli was used. RNA isolated from
E. coli JM109(pYW33) cells induced with Hg2+ or
PMA served as the template for cDNA synthesis using primers situated
near the 5' region of the first gene in each predicted transcript,
merR1 (Fig. 4A) or merR2 (Fig. 4B). Specific
products mapping to the start sites of both transcripts were obtained
(Fig. 4), and the sites are marked in Fig. 1B and 4. O/P1-initiated transcription was induced by addition of Hg2+ (Fig. 4A) or
PMA (data not shown). O/P2-initiated transcription was also induced by
addition of either Hg2+ or PMA (Fig. 4B). A much longer
untranslated mRNA region appears before the presumed ribosomal binding
site (RBS) for the first gene after O/P2 than after O/P1 (Fig. 4C).
Although 20 nt occur between the predicted 
10 and 35 RNA polymerase
binding sites of O/P1 (unusually long and associated with the bending
and twisting of the DNA region with the 19-nt distance in the
better-studied mer O/P in gram-negative bacteria; references
1 and 30), the distance between
the predicted RNA polymerase binding sites for O/P2 is 18 nt, closer to
the canonical length of 17 ± 1 nt. Both regions between the 10
and 35 sites contain inverted repeats (a perfect 4-4-4 repeat for
O/P1 and an imperfect 7-1-7 repeat for O/P2; marked in Fig. 4C).
Control reactions showed no corresponding RT transcription product with
RNA from an E. coli strain lacking the plasmid-encoded
mercury resistance determinant (data not shown). The transcriptional
start sites (+1), deduced 10 and 35 RNA polymerase-interacting
promoter sequences, proposed RBS, and polypeptide-initiating ATG for
both transcripts are indicated in Fig. 4C.
View larger version (85K):
[in this window]
[in a new window]
|
FIG. 4.
Primer extension for start sites of mRNA for
mer O/P1 (A) and mer O/P2 (B) with total cellular
RNA from E. coli JM109(pYW33) either UI or I with added
HgCl2 or PMA (values above the lanes are micromolar
concentrations) for 2 h. The transcription start sites determined
(marked by asterisks) were mapped against sequencing ladders (lanes C,
T, A, and G) using the same oligonucleotide primers. (C) The
mer O/P1 and mer O/P2 +1 mRNA initiation
nucleotides determined and the predicted 10 and 35 RNA polymerase
binding sites are shown. The predicted RBS and start codons for first
genes, merR1 and merR2, are marked on the
sequence. The perfect 4-4-4 and imperfect 7-1-7 inverted repeats
between the 10 and 35 sites are also marked.
|
|
RT-PCR transcript analysis.
RT-PCR was used to analyze the
bacterial transcripts for the strain RC607 mercury resistance system in
both B. cereus and E. coli after cloning into
plasmid pYW33. The Bacillus mer determinant was expressed
from its own promoter(s) in E. coli, unlike the situation
with the previously studied mer operon from plasmid pI258 of
another low-G+C gram-positive bacterium, Staphylococcus aureus, which is not expressed in E. coli (6, 18,
29), presumably because of a failure of the MerR protein to
interact productively with the heterologous RNA polymerase. Subcloning into E. coli allows comparisons of the mRNA products
produced with both gram-positive (homologous) and gram-negative
(heterologous) bacterial RNA polymerases, comparable to the
volatilization assays shown in Fig. 3.
The Bacillus mer system might synthesize one or two
transcripts (Fig. 1A). To identify the number of transcripts and to
compare the expression of individual genes, total RNA was isolated from cells grown under induced (I) (growth for 60 min in medium supplemented with Hg2+) and uninduced (UI) conditions. Total RNA was
isolated from I and UI cultures of B. cereus and E. coli and used as the template for RT reactions, using primers
situated at the 3' end of merA or merB1 (Fig.
1A). Additional RT oligonucleotide primers corresponding to the 3' ends
of the standardization control genes (for 16S rRNA) from B. cereus and E. coli were included in the same RT
reactions as with mercury gene-specific merA and
merB1 primers. The products of the RT reactions were
templates for amplification of individual genes by PCR.
With RNA isolated from B. cereus cells and cDNA synthesized
from the merA RT primer, both merR1 and
merA were amplified by PCR (Fig.
5A). This shows that merR1
through merA were synthesized as a single transcript. The
PCR products were quantitated (Table 1)
from the original charge-coupled device camera data shown in Fig. 5.
mRNAs for both merR1 and merA were less abundant
in the UI cells than in the I cells. However, the induction ratio of
apparent transcript abundance was seven times more for merA than for merR1 (Table 1). With total cellular RNA from
E. coli JM109(pYW33), merR1 and
merA were also PCR amplified by using cDNA from RT with the
merA primer. However, the amounts of PCR products amplified
for the UI and I E. coli cells were essentially the same
(Fig. 5A; Table 1), showing no indication of induction by
Hg2+. In control reactions, PCR products were not found
when RNA was treated with RNase or when the RT reaction was run without
RT (data not shown). PCR amplification products arising from
contaminating DNA was ruled out by the absence of products when
DNase-treated RNA was used and/or when the RNA sample was directly used
as the template for a PCR (results not shown).
View larger version (41K):
[in this window]
[in a new window]
|
FIG. 5.
RT-PCR transcript analysis of the mercury resistance
determinant and control 16S rRNA with total cellular RNA from B. cereus RC607 and E. coli JM109(pYW33), UI or I by
growth with HgCl2 for 2 h. (A) Mercury resistance
genes. RT primers and subsequent PCR primers are indicated for each
reaction, as are the sizes of the PCR products detected. (B) Control
16S rRNA gene RT-PCR from the same reactions as with merA or
merB1 primers. A quantitative analysis of the ethidium
bromide-stained PCR products is shown in Table 1.
|
|
Using cDNA from RT with the merB1 primer, PCR products were
amplified for three genes, merA, merR2, and
merB1 (Fig. 5A). This established that mercury resistance
genes merA through merB1 are synthesized as a
single transcript and that the transcript does not invariably terminate
after merA. Since genes merR1 through merA are cotranscribed and genes merA through
merB1 are cotranscribed, all eight genes are considered to
be cotranscribed as a single transcript of 6.3 kb. With RNA from
B. cereus and the RT product obtained with the
merB1 primer, the amounts of PCR products obtained with
merA, merR2, and merB1 were greater
when I cells were used than when UI cells were used (Fig. 5A; Table 1),
although the apparent induction ratios were less than those obtained
with the merA gene RT primer. There was no significant
indication of inducibility with RT-PCR amplification of
merA, merR2, and merB1 in the E. coli background (Table 1). Equivalent amounts of RT-PCR products for the 16S rRNA genes from B. cereus and E. coli
were obtained with the I and UI cells (Fig. 5B; Table 1), showing that
equivalent amounts of RNA were taken for the reactions.
| |
DISCUSSION |
Analysis of DNA sequence.
By combining the two sequences of
reference 34 with the new sequence reported here, a
continuous total of 7,029 nt (shown in Fig. 1A; available from GenBank
under accession no. AF138877) was obtained. The G+C content is not
uniform along the sequence. The first 4,875 nt have 39% G+C; the
intermediate 2,100 bp in Fig. 1B contain 36% G+C. However, the
merB1 gene contains 46% G+C. The hypothesis is that the
Bacillus mercury resistance determinant evolved, probably
originating with the merR1 through merA genes, with the additional genes merR2, merB2, and
merB1 being added subsequently by horizontal transfer from
outside this region. The two merR genes and the two
merB genes are quite dissimilar in sequence, with only 42 to
43% nt matches upon alignment (analysis not shown), and therefore
probably did not arise by gene duplication. It is not clear whether a
segment containing the second promoter and the genes merR2
and merB2 was inserted after merA and before merB1 (Fig. 1). The merR2-merB2 region has a
rather constant low G+C content, similar to that of the upstream
mer region. The distal gene, merB1, alone shows a
significantly higher G+C content, indicating a different origin.
This assemblage of the Bacillus mercury resistance
determinant does not appear to have been a recent event. At least 95%
of the mercury resistance determinants analyzed from Minamata Bay, Japan, marine Bacillus isolates have the same sizes, and
apparently the same arrangement, of genes (20) as shown in
this report for Massachusetts B. cereus isolate RC607
(19, 33). This similarity includes the 2.1 kb between the
end of merA and the beginning of merB1 (Fig. 1B),
which shows precisely the same size within the limitations of agarose
gel analysis of PCR products (20).
The MerR and MerB protein families.
The MerR2 amino acid
sequence is only 29% identical to that of MerR1. In fact, MerR2 is
similarly related (not more so) to MerR sequences from gram-negative
bacteria and to less-studied MerR paralogs that appear to function in
the regulation of other cation-related genes (analysis not shown). The
best characterized of these is ZntR (4), which is an
E. coli chromosomally encoded MerR paralog that regulates
cellular efflux of Zn2+. Thus, MerR2 appears to be a rather
remote member of the larger family of proteins homologous to MerR. In
contrast, MerR1 is 58% identical to MerR of S. aureus
plasmid pI258. MerR2 is still less similar (about 20% of the amino
acid are identical) to MerD sequences for the secondary transcriptional
regulator from gram-negative bacteria, which are themselves weakly
related to MerR, and MerR2 may be hypothesized to play a similar
secondary down-regulatory role (28). The three completely
invariant cysteines, Cys79, Cys114, and Cys123 in MerR1, of
Hg2+-responding MerRs from both gram-positive and -negative
bacteria (14, 28) are absent in MerR2 and are replaced with
Ile81, Ser116, and Gly126; there are no alternative nearby cysteine
residues. Therefore, MerR2 cannot respond to and bind Hg2+
in a manner similar to that of MerR1 (12, 13, 22).
An alternative role for MerR2 may be as a more general transcriptional
regulator. In other systems, there are paralogous proteins, such as
SoxR of E. coli, which responds to oxygen stress with an
iron-sulfur cluster as a sensor (7, 15), and BmrR from B. subtilis, which functions as a positive transcriptional
activator of multidrug resistance (35, 36). BmrR has a
MerR-like amino-terminal DNA-binding domain and a dissimilar
substrate-binding carboxyl-terminal region.
Helmann et al. (12) altered each of the four cysteine
residues in B. cereus RC607 MerR1 to alanines and
demonstrated that three of the four, Cys79, Cys114, and Cys123, are
required for high-affinity binding of Hg2+ to the dimeric
protein and also for transcriptional activation in vitro. The fourth
cysteine, Cys12, is not required. By in vivo and in vitro heterodimer
formation between mutant proteins affected in different residues,
Helmann et al. (12, 13) showed that the Cys79 residue is
required on one subunit of the MerR dimer and Cys114 and Cys123 are
required on the other subunit. The three essential cysteines of
Bacillus MerR are also found at equivalent positions in the
MerRs of gram-negative bacteria, for which a similar trithiol dimer
bridging for Hg2+ binding and activation has been shown
(22, 31). The MerR transcriptional regulator of the
gram-positive bacterium Streptomyces lividans
(5), alone among MerR proteins, is not an activator but is a
repressor and shows sequence homology to the ArsR/CadR/SmtB family of
metal-responding transcriptional repressors in bacteria (27).
Purification of the MerR1 and MerR2 proteins and quantitative in vitro
analysis of binding to mer O/P1 and O/P2 are needed to
distinguish between the properties of MerR1 and MerR2 and to understand
the function of MerR2.
All known MerB organomercurial lyase sequences are homologous, although
the diversity of sequences is great. For example, B. cereus
RC607 MerB1 and MerB2 show only 29% identical amino acids. MerB2 is
about equally similar to MerB of S. aureus plasmid pI258 as
to Bacillus MerB1. Organomercurial resistance was previously associated with the downstream region of the Bacillus mer
determinant (34), before the separate merB1 and
merB2 genes were known. A more detailed analysis is now
needed to establish the substrate specificities of the two protein
products, by separately eliminating merB1 and
merB2 and testing against a spectrum of organomercurial compounds. Kiyono et al. (17) undertook a similar analysis
with the two organomercurial lyase genes (and proteins) from a soil Pseudomonas strain, which was, in fact, the first mercury
resistance strain to be studied in depth, more than 30 years ago. The
level of understanding of the organomercurial lyase enzyme
(32) does not allow the drawing of conclusions with regard
to substrate specificity from the protein sequences.
Transcriptional control.
The MerR1 protein binds specifically
to the mer O/P1 region in vitro, as shown by gel mobility
shift assays and by protection against digestion by a GTAC-cutting
restriction endonuclease (14). Runoff transcription assays
(14) demonstrated that addition of the MerR protein
repressed low-level activity in vitro and that addition of MerR plus
Hg2+ resulted in positively regulated higher expression
from mer O/P1. However, the precise position of the +1
nucleotide for mRNA synthesis had not been determined prior to the
experiment whose results are shown in Fig. 4A and the existence of a
second promoter site (Fig. 4C) had not been anticipated. When E. coli RNA polymerase rather than B. subtilis RNA
polymerase (14) was used, no in vitro transcription from
mer O/P1 occurred. The experiments whose results are shown
in Fig. 3 (showing inducible volatilization of radioactive mercury) and
Fig. 5 [RT-PCR analysis of mRNA from E. coli JM109(pYW33)
cells] demonstrated that the B. cereus RC607 mer
determinant can utilize E. coli RNA polymerase in vivo,
although not equivalently to that of B. cereus RC607.
Previous heterologous-expression studies of the related mer
operon of S. aureus plasmid pI258 showed resistance when
mer was cloned into B. subtilis but no phenotype when it was cloned into E. coli (18). Northern
blot analysis (29) found that in S. aureus,
full-length mer operon transcripts were synthesized although
the genes are shorter and fewer than with B. cereus RC607.
In RT experiments, Skinner et al. (29) identified the +1
mRNA start position equivalent to that shown here for B. cereus RC607 mer O/P1. Furthermore, S. aureus MerR bound and protected the S. aureus mer O/P
DNA in DNase footprinting experiments (6) between the 35
and 10 RNA polymerase recognition sites as proposed here and in
reference 14 for the Bacillus system. By
sequence alignment of O/P regions from different mer systems, Park et al. (24) found that the repeat sequence
GTAC----GTAC between the 10 and 35 elements was conserved and may
be required for operator function in both gram-positive and -negative
bacteria. In B. cereus RC607, mer O/P1 has the
GTAC----GTAC repeat in equivalent positions (underlined in Fig. 4C),
probably the site for binding of MerR1. mer O/P2 lacks the
conserved GTAC----GTAC configuration but has a 7-1-7 repeat between the
10 and 35 elements (underlined in Fig. 4C). The 7-1-7 repeat
sequence of mer O/P2 shares only 3 of the 8 nt to the 4-4-4 repeat of mer O/P1. There is, however, a 7-nt region,
CTAAGGT, that is conserved between the repeat elements of
mer O/P1 and mer O/P2. It is hypothesized that
MerR1, if involved in the regulation of mer O/P2, may
recognize the 7-nt conserved region near the center of the operator.
The most thorough analysis of differential synthesis of transcripts
over the length of a mer operon was that of Gambill and Summers (9) with the E. coli Tn21
operon, which has only four genes in the major positively activated
mer mRNA. Tn21 does not have merB
genes. With Northern blot DNA-RNA analysis of abundance, Gambill and
Summers (9) concluded that a transcriptional gradient occurred. Distal genes were transcribed more slowly and at lower levels. The quantitative analysis by RT-PCR started in the experiments whose results are shown in Fig. 5 needs to be extended before a
quantitative picture of the two promoter sites and relative rates of
mRNA synthesis and degradation can be made.
We thank Paige Goodlove of the University of Illinois DNA Sequencing
Center for care and effort that was truly of a collaborator rather than
a support facility. Kunihiko Nakamura (Minamata, Japan) and Elena
Bogdanova (Moscow, Russia) contributed to discussions of this work.
| 1.
|
Ansari, A. Z.,
J. E. Bradner, and T. V. O'Halloran.
1995.
DNA-bend modulation in a repressor-to-activator switching mechanism.
Nature
374:371-375[Medline].
|
| 2.
|
Ausubel, F. M.,
R. Brent,
R. E. Kingston,
D. D. Moore,
J. G. Seidman,
J. A. Smith, and K. Struhl (ed.).
1987.
Current protocols in molecular biology, plus dated supplements.
John Wiley & Sons, Inc., New York, N.Y
|
| 3.
|
Bogdanova, E. S.,
I. A. Bass,
L. S. Minakhin,
M. A. Petrova,
S. Z. Mindlin,
A. A. Volodin,
E. S. Kalyaeva,
J. M. Tiedje,
J. L. Hobman,
N. L. Brown, and V. G. Nikiforov.
1998.
Horizontal spread of mer operons among gram-positive bacteria in natural environments.
Microbiology
144:609-620[Abstract].
|
| 4.
|
Brocklehurst, K. R.,
J. L. Hobman,
B. Lawley,
L. Blank,
S. J. Marshall,
N. L. Brown, and A. P. Morby.
1999.
ZntR is a Zn(II)-responsive MerR-like transcriptional regulator of zntA in Escherichia coli.
Mol. Microbiol.
31:893-902[Medline].
|
| 5.
|
Brünker, P.,
D. Rother,
R. Sedlmeier,
J. Klein,
R. Mattes, and J. Altenbuchner.
1996.
Regulation of the operon responsible for broad-spectrum mercury resistance in Streptomyces lividans 1326.
Mol. Gen. Genet.
251:307-315[Medline].
|
| 6.
|
Chu, L.,
D. Mukhopadhyay,
H. Yu,
K.-S. Kim, and T. K. Misra.
1992.
Regulation of the Staphylococcus aureus plasmid pI258 mercury resistance operon.
J. Bacteriol.
174:7044-7047[Abstract/Free Full Text].
|
| 7.
|
Ding, H., and B. Demple.
1998.
Thiol-mediated disassembly and reassembly of [2Fe-2S] clusters in the redox-regulated transcription factor SoxR.
Biochemistry
37:17280-17286[Medline].
|
| 7a.
| Endo, G. Personal communication.
|
| 8.
|
Engst, S., and S. M. Miller.
1998.
Rapid reduction of Hg(II) by mercuric ion reductase does not require the conserved C-terminal cysteine pair using HgBr2 as the substrate.
Biochemistry
37:11496-11507[Medline].
|
| 9.
|
Gambill, B. D., and A. O. Summers.
1992.
Synthesis and degradation of the mRNA of the Tn21 mer operon.
J. Mol. Biol.
225:251-259[Medline].
|
| 10.
|
Gupta, A.
1999.
RT-PCR: identification of long multi-gene operons in bacteria.
BioTechniques
27:2-5.
|
| 11.
|
Hart, M. C.,
G. N. Elliott,
A. M. Osborn,
D. A. Ritchie, and P. Strike.
1998.
Diversity amongst Bacillus merA genes amplified from mercury resistant isolates and directly from mercury polluted soil.
FEMS Microbiol. Ecol.
27:73-84.
|
| 12.
|
Helmann, J. D.,
B. T. Ballard, and C. T. Walsh.
1990.
The MerR metalloregulatory protein binds mercuric ion as a tricoordinate, metal-bridged dimer.
Science
247:946-948[Abstract/Free Full Text].
|
| 13.
|
Helmann, J. D.,
L. M. Shewchuk, and C. T. Walsh.
1990.
Regulation of gene expression by mercury.
Adv. Inorg. Biochem.
8:33-61[Medline].
|
| 14.
|
Helmann, J. D.,
Y. Wang,
I. Mahler, and C. T. Walsh.
1989.
Homologous metalloregulatory proteins from both gram-positive and gram-negative bacteria control transcription of mercury resistance operons.
J. Bacteriol.
171:222-229[Abstract/Free Full Text].
|
| 15.
|
Hidalgo, E.,
V. Leautaud, and B. Demple.
1998.
The redox-regulated SoxR protein acts from a single DNA site as a repressor and an allosteric activator.
EMBO J.
17:2629-2636[Medline].
|
| 16.
|
Hobman, J. L., and N. L. Brown.
1997.
Bacterial mercury-resistance genes, p. 527-568.
In
H. Sigel, and A. Sigel (ed.), Metal ions in biological systems, vol. 34. Marcel Dekker, Inc., New York, N.Y
|
| 16a.
|
Huang, C. C.,
M. Narita,
T. Yamagata,
Y. Itoh, and G. Endo.
1999.
Structure analysis of a class II transposon encoding the mercury resistance of the Gram-positive bacterium Bacillus megaterium MB1, a strain isolated from Minamata Bay, Japan.
Gene
234:361-369[Medline].
|
| 17.
|
Kiyono, M.,
T. Omura,
H. Fujimori, and H. Pan-Hou.
1995.
Organomercurial resistance determinants in Pseudomonas K-62 are present on two plasmids.
Arch. Microbiol.
163:242-247[Medline].
|
| 18.
|
Laddaga, R. A.,
L. Chu,
T. K. Misra, and S. Silver.
1987.
Nucleotide sequence and expression of the mercurial-resistance operon from Staphylococcus aureus plasmid pI258.
Proc. Natl. Acad. Sci. USA
84:5106-5110[Abstract/Free Full Text].
|
| 19.
|
Mahler, I.,
H. S. Levinson,
Y. Wang, and H. O. Halvorson.
1986.
Cadmium- and mercury-resistant Bacillus strains from a salt marsh and from Boston Harbor.
Appl. Environ. Microbiol.
52:1293-1298[Abstract/Free Full Text].
|
| 20.
|
Nakamura, K., and S. Silver.
1994.
Molecular analysis of mercury-resistant Bacillus isolates from sediment of Minamata Bay, Japan.
Appl. Environ. Microbiol.
60:4596-4599[Abstract/Free Full Text].
|
| 21.
|
Nucifora, G.,
L. Chu,
S. Silver, and T. K. Misra.
1989.
Mercury operon regulation by the merR gene of the organomercurial resistance system of plasmid pDU1358.
J. Bacteriol.
171:4241-4247[Abstract/Free Full Text].
|
| 22.
|
O'Halloran, T. V.
1993.
Transition metals in control of gene expression.
Science
261:715-725[Abstract/Free Full Text].
|
| 23.
|
Osborn, A. M.,
K. D. Bruce,
P. Strike, and D. A. Ritchie.
1997.
Distribution, diversity and evolution of the bacterial mercury resistance (mer) operon.
FEMS Microbiol. Rev.
19:239-262[Medline].
|
| 24.
|
Park, S. J.,
J. Wireman, and A. O. Summers.
1992.
Genetic analysis of the Tn21 mer operator-promoter.
J. Bacteriol.
174:2160-2171[Abstract/Free Full Text].
|
| 25.
|
Schiering, N.,
W. Kabsch,
M. J. Moore,
M. D. Distefano,
C. T. Walsh, and E. F. Pai.
1991.
Structure of the detoxification catalyst mercuric ion reductase from Bacillus sp. strain RC607.
Nature
352:168-171[Medline].
|
| 26.
|
Silver, S.
1998.
Genes for all metals a bacterial view of the periodic table.
J. Ind. Microbiol. Biotechnol.
20:1-12[Medline].
|
| 27.
|
Silver, S., and L. T. Phung.
1996.
Bacterial heavy metal resistance: new surprises.
Annu. Rev. Microbiol.
50:753-789[Medline].
|
| 28.
|
Silver, S., and M. Walderhaug.
1992.
Gene regulation of plasmid- and chromosome-determined inorganic ion transport in bacteria.
Microbiol. Rev.
56:195-228[Abstract/Free Full Text].
|
| 29.
|
Skinner, J. S.,
E. Ribot, and R. A. Laddaga.
1991.
Transcriptional analysis of the Staphylococcus aureus plasmid pI258 mercury resistance determinant.
J. Bacteriol.
173:5234-5238[Abstract/Free Full Text].
|
| 30.
|
Summers, A. O.
1992.
Untwist and shout: a heavy metal-responsive transcriptional regulator.
J. Bacteriol.
174:3097-3101[Free Full Text].
|
| 31.
|
Utschig, L. M.,
J. W. Bryson, and T. V. O'Halloran.
1995.
Mercury-199 NMR of the metal receptor site in MerR and its protein-DNA complex.
Science
268:380-385[Abstract/Free Full Text].
|
| 32.
|
Walts, A. E., and C. T. Walsh.
1988.
Bacterial organomercurial lyase: novel enzymatic protonolysis of organostannanes.
J. Am. Chem. Soc.
110:1950-1953.
|
| 33.
|
Wang, Y.,
I. Mahler,
H. S. Levinson, and H. O. Halvorson.
1987.
Cloning and expression in Escherichia coli of chromosomal mercury resistance genes from a Bacillus sp.
J. Bacteriol.
169:4848-4851[Abstract/Free Full Text].
|
| 34.
|
Wang, Y.,
M. Moore,
H. S. Levinson,
S. Silver,
C. Walsh, and I. Mahler.
1989.
Nucleotide sequence of a chromosomal mercury resistance determinant from a Bacillus sp. with broad-spectrum mercury-resistance.
J. Bacteriol.
171:83-92[Abstract/Free Full Text].
|
| 35.
|
Zheleznova, E. E.,
P. N. Markham,
A. A. Neyfakh, and R. G. Brennan.
1997.
Preliminary structural studies on the multi-ligand-binding domain of the transcription activator, BmrR, from Bacillus subtilis.
Protein Sci.
6:2465-2468[Abstract].
|
| 36.
|
Zheleznova, E. E.,
P. N. Markham,
A. A. Neyfakh, and R. G. Brennan.
1999.
Structural basis of multidrug recognition by BmrR, a transcription activator of a multidrug transporter.
Cell
96:353-362[Medline].
|
![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Top
Abstract
Introduction
