Previous Article | Next Article 
Journal of Bacteriology, December 1999, p. 7206-7211, Vol. 181, No. 23
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Physiological Characterization of SusG, an Outer
Membrane Protein Essential for Starch Utilization by
Bacteroides thetaiotaomicron
Joseph A.
Shipman,*
Kyu Hong
Cho,
Hilary A.
Siegel, and
Abigail A.
Salyers
Department of Microbiology, University of
Illinois at Urbana-Champaign, Urbana, Illinois 61801
Received 10 May 1999/Accepted 14 September 1999
 |
ABSTRACT |
Results from previous studies had suggested that Bacteroides
thetaiotaomicron utilizes starch by binding the polysaccharide to
the bacterial surface and subsequently degrading the polymer by using
cell-associated enzymes. Most of the starch-degrading activity was
localized to the periplasm, but a portion appeared to be membrane
associated. This raised the possibility that some breakdown might occur
in the outer membrane prior to exposure of the polysaccharide to the
periplasmic polysaccharide-degrading enzymes. In this study, we show
that SusG, an outer membrane protein which has been shown genetically
to be essential for starch utilization, has enzymatic activity. Results
of protease accessibility experiments support the hypothesis that SusG
is exposed on the cell surface. Results of [14C]starch
binding assays, however, show that SusG plays a negligible role in
binding of starch to the cell surface. Consistent with this, SusG has a
relatively high Km for starch and by itself is not sufficient to allow cells to grow on starch or to bind starch. Hence, the main role of SusG is to hydrolyze starch, but the binding of
starch to the cell surface is evidently mediated by other proteins presumably interacting with SusG.
 |
INTRODUCTION |
Human colonic Bacteroides
spp. can utilize a wide range of polysaccharides as sources of carbon
and energy. These substrates are broken down by cell-associated
enzymes. So far, no extracellular enzymatic activity has been detected,
and binding of the polysaccharide to the cell surface appears to be
important for utilization. This evidence led us to propose a model in
which the polysaccharide is first bound to an outer membrane receptor
and then translocated through the outer membrane. Most enzymatic
hydrolysis of the polysaccharide probably occurs in the periplasm, but
an initial step in breakdown catalyzed by an outer membrane enzyme
could not be ruled out. Most studies of outer membrane translocator
proteins have focused on porins, which allow small substrates to
diffuse through the outer membrane (7). However,
Bacteroides spp. can grow on substrates which are much
larger than the pore size of outer membrane porins (~600 Da) and can
grow as well on polymeric as on monomeric substrates, suggesting a
rapid and efficient uptake process.
We have used the starch utilization system of Bacteroides
thetaiotaomicron as a model for defining the various components involved in polysaccharide utilization by Bacteroides spp.
B. thetaiotaomicron can utilize all three forms of
starch
amylose, amylopectin, and pullulan
as well as component
maltooligosaccharides. Amylose consists of
-1,4-linked glucose
residues, whereas amylopectin is a branched polymer composed of amylose
chains connected by
-1,6 linkages to an amylose backbone. Pullulan
is a linear chain of maltotriose residues linked by
-1,6 bonds. We
had identified an operon consisting of eight genes (designated sus, for
starch utilization system) which encode proteins that catalyze early steps in the breakdown of starch by B. thetaiotaomicron. Two
genes, susA and susB, encode a cell-associated
starch-degrading enzyme and an
-glucosidase, respectively. A mutant
with a disruption in susA grew more slowly than the wild
type but was still able to grow on starch. This finding suggested that
other starch-degrading enzymes must participate in this pathway.
However, only a very low level of starch hydrolysis could be detected
in a cell extract from the susA disruption strain
(4). Five of the sus genes, susC,
-D, -E, -F, and -G, encode
outer membrane proteins (OMPs). SusC is essential for starch
utilization and is the only OMP necessary for utilization of the
smaller oligomers, maltotetraose to maltoheptaose (14). SusC
may form an oligomeric channel in the outer membrane of B. thetaiotaomicron. Previous evidence suggested that SusE is not
required for starch utilization (15), but whether SusD or
SusF is essential has not been established. SusG is essential for
starch utilization but not for utilization of maltooligosaccharides.
Because SusG is an OMP and is essential for utilization of full-length
starch, we suspected that SusG would have binding or enzymatic activity
or both. Sequence analysis had suggested that susG might
encode a starch-degrading enzyme because the deduced amino acid
sequence of SusG had significant similarity to sequences of a number of
-amylases and had all of the conserved residues and regions shown to
be important for catalytic activity (15). Yet, a mutant with
a disruption in susG appeared to have the same level of
starch-degrading activity as wild type. This could have been due to the
fact that the major enzyme activity detectable in cell extracts, SusA
(4), overshadowed a much lower starch-degrading activity due
to SusG. We report here that SusG has starch-degrading activity and is
exposed on the cell surface but plays only a negligible role in starch
binding. Thus, the starch utilization system seems to separate binding
activity from enzymatic activity.
 |
MATERIALS AND METHODS |
Bacterial strains and growth conditions.
The bacterial
strains and plasmids used in this study are listed in Table
1. All Escherichia coli
strains used in this study were grown in Luria-Bertani (LB) broth or on
LB agar at 37°C. B. thetaiotaomicron 5482, B. thetaiotaomicron 4007, transposon-generated derivatives, and
single-disruption mutants used in this study have been described
previously (2, 4, 15). When necessary, suicide vectors were
used to create additional disruptions in these strains. B. thetaiotaomicron 4007 was used as a control in growth and binding
experiments because it is a derivative of 5482 that is tetracycline
resistant (tetQ). tetQ is the selectable marker used in the
construction of most disruption mutants.
Cells were grown initially in a prereduced Trypticase-yeast
extract-glucose (VPI) medium. For optimal induction of starch
utilization genes, cells were transferred to a defined medium
containing maltose (0.3%) as the sole carbohydrate source. To
test for
growth rates on starch, we inoculated cells into a defined
medium with
amylopectin (0.3%) as the sole carbohydrate source.
Antibiotic
concentrations were as follows: ampicillin, 200 µg/ml;
chloramphenicol, 15 µg/ml (
E. coli) or 20 µg/ml
(
B. thetaiotaomicron);
erythromycin, 10 µg/ml; gentamicin,
200 µg/ml; and tetracycline,
1 µg/ml.
DNA methods.
Isolation of plasmids was done by using a
Wizard Plus DNA purification system (Promega Corp.).
Dephosphorylation reactions and restriction digests were performed as
instructed by the manufacturer (Bethesda Research Laboratories,
Bethesda, Md., or New England BioLabs, Beverly, Mass.). Transformation
of E. coli DH5
MCR was done by the method of Lederberg and
Cohen (8). Conjugations, where constructs generated in
E. coli were transferred to Bacteroides recipients, were performed as described by Shoemaker et al.
(16). Southern blotting was done as described by Maniatis et
al. (10) except that a Renaissance detection kit
(DuPont-NEN) was used for detection of the bound DNA probe.
Chemicals.
[14C]starch (Nicotiana
tobacum L) was purchased from DuPont-NEN. Amylopectin, pullulan,
proteinase K, and phenylmethylsulfonyl fluoride (PMSF) were purchased
from Sigma Corp.
p-Nitrophenyl-
-D-maltoheptaoside was obtained
from Boehringer Mannheim Biochemica.
Membrane preparation.
Membranes were prepared by the method
of Valentine and Salyers (20). Cells were grown in a defined
medium with maltose (0.3%) as the sole carbohydrate source to late log
phase (optical density at 650 nm of 0.6 to 0.8). The cells were washed
once with 20 mM potassium phosphate buffer (pH 7.2) and resuspended in
5 ml of the same buffer. These cells were disrupted by sonication.
After separation of the cell extract from insoluble material by
centrifugation, the whole membranes (both inner and outer membranes)
were pelleted from the cell extract by ultracentrifugation (200,000 × g for 2.5 h at 4°C). The soluble fraction was
collected, and the membrane pellet was washed once with 20 mM potassium
phosphate buffer and pelleted again by ultracentrifugation under the
same conditions. The membrane pellet was resuspended in 20 mM potassium
phosphate buffer, and the membranes were dispersed by sonication. For
analysis of enzymatic activity, the membrane preparations were
resuspended in a 50 mM potassium phosphate buffer-20% glycerol
solution instead of 20 mM potassium phosphate buffer. Glycerol was
added to allow storage of the enzymes at
80°C and did not affect
specific activity.
[14C]starch binding experiments.
[14C]starch binding assays on wild-type and mutant
B. thetaiotaomicron were performed by a modification of the
procedure of Anderson and Salyers (1). Cells were grown in
maltose-minimal medium to an optical density at 650 nm of 0.5 to 0.6. The cells were washed twice with 0.1 M phosphate-buffered saline (PBS;
pH 7.4) to dissociate any loose capsular material. Cells were
resuspended in PBS to an optical density at 650 nm of 0.4. The cell
suspension was incubated with either radiolabeled starch or a mixture
of labeled and unlabeled starch for 5 min at room temperature under aerobic conditions. Under aerobic conditions, no starch uptake occurs.
That is, after the first binding step occurs, no further accumulation
of starch is seen even after an hour (1). After centrifugation of the cells, the supernatant fluid was discarded and
the cells were washed twice with 0.5 ml of PBS. All of the cell pellets
were then resuspended in 100 µl of PBS. This solution was transferred
to 2.0 ml of scintillation fluid, and the amount of bound label was
determined with a Beckman model 5000TD scintillation counter.
In binding studies, higher concentrations of starch contained a mixture
of [
14C]starch and unlabeled amylopectin in PBS to reach
the desired
concentration. As a control for nonspecific binding of
starch,
we tested binding to mutant
susC, which expresses
none of the
starch-associated OMPs and has been shown to have only a
very
low residual binding activity (
15). Values were
reported in
micrograms of starch bound per milligram of cell protein.
These
values were obtained by multiplying the total counts per minute
by a dilution factor, which was the ratio of labeled starch to
total
starch in each assay. That number was converted by an empirical
constant (based on observed counts per minute per given amount
of
starch) to disintegrations per minute, which allowed the total
micrograms of starch bound to be calculated by using the reported
values of 2.2 × 10
6 dpm per µg of starch.
Experimental values were standardized by
assaying whole-cell protein
concentration, using a modification
of the method of Lowry et al.
(
9) with bovine serum albumin
as a
standard.
Assay for enzyme activity in membrane fractions of wild-type and
various susA and susG disruption strains.
In the original studies of Smith and Salyers (18), the
enzyme assay conditions were optimized for the major activity
detectable in cell extracts, which we now know is due to SusA. These
conditions might not be optimal for the residual membrane-associated
activity found in the susA disruption mutant (4).
To determine the optimum conditions for the other enzyme(s), we used
p-nitrophenyl-
-D-maltoheptaoside as the
substrate (final concentration of 0.5 mM). We found that adding
detergent (e.g., n-octyl-
-D-glucoside) to
solubilize the protein from the membrane or adding cofactors such as
Ca2+ did not enhance the observed enzyme activity.
Consequently, we used the original conditions of Smith and Salyers
(18), 50 mM potassium phosphate buffer with no additional
detergents or cofactors, to measure enzyme activity. This mixture was
used in all subsequent assays of enzyme activity.
We used the chromogenic substrate
p-nitrophenyl-

-
D-maltoheptaoside to assay

-1,4-amylase activity of whole-membrane protein
extracts. Amylase
activity was calculated as instructed by the
manufacturer (Boehringer
Mannheim Biochemica). We determined the
Km for
both SusA and SusG by using resuspended membranes from
mutants
susB and

SAB(pSGC23A), respectively. These strains
expressed
only one of the two starch-degrading enzymes, SusA and SusG,
respectively.
Resuspended membranes were used to measure SusA activity
since
much of the activity appears to be membrane associated
(
1),
and this would give us a more valid comparison of
activity with
that of membrane-associated SusG. In these strains, SusB,
an

-glucosidase
which might interfere with the measurement of each
enzyme by hydrolyzing
its products, was not expressed. Specific
activity was assayed
at various concentrations, and
Km was determined from Lineweaver-Burke
plots.
Bacteroides membranes were obtained by ultracentrifugation
as described by Valentine and Salyers (see above and reference
20).
Protease treatment of cells.
To determine if SusG was
exposed on the cell surface, we tested whether it was accessible to
proteolytic activity. We used a relatively nonspecific protease,
proteinase K, to increase the likelihood that a surface-exposed protein
would be cleaved. For this experiment, cells were transferred from an
overnight culture of cells grown in VPI to 100 ml of defined medium
containing 0.3% maltose. These cells were grown to late exponential
phase (optical density at 650 nm of 0.8) and harvested by
centrifugation at room temperature. The cell pellet was washed twice
with 100 mM potassium phosphate buffer (pH 7.2) to dissociate any loose
capsular material from the cells. Subsequently, the cells were
resuspended in 9 ml of 100 mM potassium phosphate buffer and fresh
proteinase K (20 mg/ml) was added to a final concentration of 2 mg/ml.
The cells were incubated at 37°C with occasional mixing. Samples of 2 ml were removed at 0, 0.5, 1, 2, and 4 h. To each sample, PMSF (10 mg/ml) was added to a final concentration of 10 mM to stop proteinase K
activity. The cells were harvested by centrifugation and washed once
with 2 ml of a 100 mM potassium phosphate buffer-PMSF solution. The
final cell pellet was resuspended in 100 mM potassium phosphate buffer
containing 1 mM PMSF. After disruption of the cells by sonication,
protein concentration of the cell extract was determined by a
modification of the method of Lowry et al. (9).
Approximately 100 µg of protein from each sample was solubilized in
Laemmli buffer and electrophoresed on a sodium dodecyl
sulfate-polyacrylamide gel. The gel was transferred to a Bio-Rad
Trans-Blot nitrocellulose membrane. SusG protein was detected by using
a Bio-Rad goat anti-mouse-horseradish peroxidase Opti-4CN kit, using
antisera directed against the protein. As a control, we repeated the
above procedure except that cells were incubated in buffer with no
added proteinase K. As a control to ensure that the proteinase K
treatment had not disrupted the outer membrane, we used Western
blotting to confirm that SusA was not degraded during the proteinase K
treatment period. SusA antibody was detected by using a Bio-Rad goat
anti-rabbit-horseradish peroxidase Opti-4CN substrate kit, using
antisera directed against the protein.
susG expression in trans.
susG was
amplified by PCR using primers GAATGGCCGTCGCGGATCCAATGAAATC,
which is 30 bp upstream of the putative start codon, and
AAGGTTTCTTGGAGCTCGATAGAAAC, which lies 30 bp downstream of the putative transcriptional stop site. This product was cloned into
the multiple cloning site of the expression vector
pNLY1::PsusA (17) (Fig.
1). In this construct, the gene of
interest is cloned downstream of a 392-bp PCR fragment containing the
susA promoter (PsusA). This plasmid was called
pSGC23A. pSGC23A was mated to
susG,
SAB,
SAC,
SAG, and
susC. These transconjugants were tested by
immunoblotting to confirm SusG expression as well as expression of
other starch proteins. In addition, these strains were tested for
growth on starch.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 1.
Partial restriction map of pNLY1::PsusA, the
expression vector used to express susG in trans
in B. thetaiotaomicron. The selectable marker in E. coli is ampicillin resistance (bla) plus
chloramphenicol resistance (CAT). The selectable marker in B. thetaiotaomicron is chloramphenicol resistance. The E. coli replication region (pBI136) and B. thetaiotaomicron replication and mobilization region (pBI143) are
shown. The CAT gene is cloned downstream of the IS4351
promoter. The promoter to control expression of cloned genes was
obtained by PCR of a 392-bp fragment from the B. thetaiotaomicron chromosome containing PsusA.
|
|
For all relevant strains, we used the assay described above to test for
polysaccharidase activity of membrane extracts. We
also compared starch
binding ability by a strain expressing
susG in
trans but not the other starch-associated OMPs
[
susC(pSGC23A)]
with a strain which expresses none of
the starch-associated OMPs
(
susC). Furthermore, we tested
whether SusG was still exposed
on the cell surface when expressed
independently of the other
starch-associated
OMPs.
 |
RESULTS |
susG expression in trans.
From previous
studies in which susG was inactivated by an insertional
disruption or a transposon insertion, we knew that SusG was essential
for growth on starch (15). To determine the role of SusG
itself, we needed to express this gene in trans to determine the properties of a strain producing SusG independently of the other
OMPs. In this case, it was important to be particularly careful about
the promoter used to drive susG expression and the effect of
that promoter on expression of chromosomal genes, because we had found
previously that PsusA and susB PsusB
could titrate the regulatory protein, SusR, thus reducing transcription
of the entire susB-susG operon when either promoter region
was provided in trans on a multicopy plasmid (5).
We used PsusA because it is 30-fold weaker and had much less
effect in trans than PsusB. The original shuttle
vector used to clone susG for in trans
complementation, pNLY1, is present at 8 to 10 copies/cell
(17). Consequently, taking into account the lower expression
level of PsusA than of PsusB and the copy number
of the plasmid, expression of susG from this plasmid should
be close to wild-type levels. The susG expression plasmid,
designated pSGC23A, was transferred into an
susG
background to test for complementation.
Strain
susG(pSGC23A) had a generation time of 1.7 h
on amylopectin, whereas a strain that had wild-type
susG,
B. thetaiotaomicron 4007(pNLY1::PsusA), had a
generation time of 1.4 h. Thus, the
cloned gene complemented the
mutation, allowing it to grow on
starch at about the same rate as the
wild type. In addition, it
appeared that the cloned
susG was
fully functional and that P
susA did not reduce significantly
expression of the chromosomal
sus genes. In Western blots of
membranes from cells grown on minimal
medium plus maltose, we noted a
slight overexpression of SusG
in the membrane fraction compared to the
wild type, but the amount
appeared to be at most twofold higher than
the wild-type level.
We also confirmed by Western blotting that the
other OMPs (SusC
to SusF) were being expressed at wild-type levels
(Fig.
2). The
fact that a slight
overexpression of SusG was not deleterious
to the cell suggested that
SusG may not need to achieve a tight
stoichiometric balance with the
other OMPs for effective starch
degradation. We used this
susG expression plasmid in subsequent
experiments to
test SusG's role in starch utilization.

View larger version (79K):
[in this window]
[in a new window]
|
FIG. 2.
Immunoblot showing SusG expression from a multicopy
plasmid. Approximately 50 µg of protein was loaded onto each lane.
All membrane fractions were obtained from cells grown on minimal medium
with maltose as the sole carbohydrate source. Lanes: 1, membrane
fraction from B. thetaiotaomicron 5482; 2, membrane fraction
from B. thetaiotaomicron susG(pSGC23A); 3, membrane fraction from B. thetaiotaomicron
susG; 4, membrane fraction from B. thetaiotaomicron susC(pSGC23A); 5, membrane fraction
from B. thetaiotaomicron susC. The arrows mark
the known starch OMPs.
|
|
susG encodes a starch-hydrolyzing enzyme.
Previous
experiments had shown that cell extracts from B. thetaiotaomicron mutant Ms-4, which had a transposon inserted in susG, appeared to have wild-type levels of
starch-hydrolyzing enzyme activity (1), but the high
activity of SusA in these extracts could have been masking another
enzyme activity. To eliminate the major starch-degrading activity
detected in our assay system (SusA), we constructed a mutant with a
disruption in susA (
susA) and compared its
enzymatic activity with that of a double mutant that had disruptions in
both susA and susG (
SAG). We used Western blotting to confirm that both mutants lacked SusA but still expressed SusB to SusF normally and that
susA produced SusG whereas
SAG lacked SusG.
To determine if SusG had enzymatic activity, we used membranes as the
enzyme source, both because we knew that SusG was an
OMP and because
using membrane fractions would concentrate the
activity being assayed
to give us a higher sensitivity of detection.
SusA, the major
neopullulanase in our system, partitions mostly
(~65%) with the
membrane (
2). Disruption of
susA in mutant
susA decreased the membrane-associated amylase activity
sixfold
(Table
2), yet there was still
detectable membrane-associated
activity in this strain. When
susG was disrupted to create the
double mutant

SAG, this
activity decreased over 13-fold to below
detectable levels (Table
2).
Thus, SusG accounts for the residual
activity in the
susA
mutant. To support this claim, we determined
if SusG provided in
trans would restore the enzyme activity. We
transferred the
multicopy plasmid pSGC23A into the

SAG strain
and tested for
starch-degrading activity. In the resulting strain,
starch-degrading
activity increased from below detectable levels
to over two times that
of the
susA strain (Table
2). This increase
in activity
over
susA was probably due to the slight overexpression
of SusG from the multicopy plasmid that we had observed on Western
blots (Fig.
2).
We also wanted to determine if this observed enzyme activity required
any of the other starch-associated OMPs. Accordingly,
we constructed a
double mutant with disruptions in both
susA and
susC (

SAC) and introduced pSGC23A. This strain expressed
neither
SusA nor any of the starch-associated OMPs except SusG. The
original

SAC strain without the plasmid had no detectable
starch-degrading
activity. When the plasmid expressing
susG
(pSGC23A) was introduced,
starch-degrading activity of this strain was
comparable to that
observed for

SAG(pSGC23A) (Table
2), confirming
that SusG has
enzymatic activity even when the other starch-associated
OMPs
are not present. It is interesting that this strain,

SAC(pSGC23A),
which expresses SusG but not SusC to SusF, could not
grow at all
on starch but could grow on maltose and maltotriose. Thus,
if
SusG by itself were degrading starch in vivo to maltose and
maltotriose,
this strain should have been able to grow on starch. Data
from
our assay (where amylose was the substrate) support the hypothesis
that SusG hydrolyzes amylose. The fact that a
susG
disruption
mutant could not grow on pullulan suggests that SusG also
degrades
pullulan and is thus a
neopullulanase.
SusG is exposed on the cell surface.
Since SusG had enzymatic
activity, we wanted to determine if SusG was exposed on the cell
surface. If the protein is surface exposed, enzymatic cleavage might
occur on the cell surface. We tested for exposure on the cell surface
by determining the protease accessibility of SusG in intact cells.
After 2 h of proteinase K treatment, SusG was no longer detectable
in these cells (Fig. 3). The complete
degradation of SusG shows that proteinase K was able to attack SusG on
the cell surface. We performed control experiments to confirm that SusG
was stable in the absence of proteinase K and that proteinase K
degradation of surface-exposed proteins was not destroying the outer
membrane. In a control experiment where proteinase K was not added,
SusG was stable throughout the course of the experiment. To confirm
that the cells treated with proteinase K remained intact during the
digestion period, we determined whether SusA, a periplasmic enzyme, was
present at the time points where SusG was not present. According to the
results of immunoblotting, SusA was present at a constant level at all
time points in this experiment (Fig. 3). This confirms that we were
seeing surface degradation of OMPs but not disruption of the outer
membrane. In a separate experiment, to rule out the possibility that
SusA was unusually resistant to proteases, we disrupted cells to
release SusA and then added proteinase K. Under these conditions, SusA disappeared within 30 min after addition of proteinase K, confirming that SusA is readily degraded by proteinase K if it is accessible to
the enzyme.

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 3.
Immunoblots showing proteolytic sensitivity of SusG in
intact cells. Cells were treated with proteinase K (2 mg/ml), and
degradation of SusG was observed over time. SusA, a periplasmic marker,
is shown to be stable during the course of each experiment.
Approximately 100 µg of protein from whole-cell extracts was loaded
onto each lane. Lanes 1 to 5 represent whole-cell extracts of B. thetaiotaomicron wild-type (A) and susC(pSGC23A) (B)
strains at 0, 30, 60, 120, and 240 min, respectively.
|
|
Additionally, we tested whether SusG was exposed on the cell surface
when expressed independently of the other starch-associated
OMPs. Since
these OMPs are involved in starch utilization, one
or more of these
proteins could be necessary for SusG to be properly
localized and
stable in the outer membrane. For this experiment,
we assayed
proteinase K accessibility of SusG in strain
susC(pSGC23A),
which produced SusG but not SusC to SusF.
In intact cells of this
strain, SusG was eliminated by proteinase K
treatment after 4
h, somewhat more slowly than SusG in a wild-type
background (Fig.
3). The apparent slower disappearance is probably due
to the fact
that there is more SusG in the mutant. Meanwhile, in a
control
experiment, SusG was present at a constant level when
proteinase
K was not added. Thus, SusG localizes to and is stable in
the
outer membrane independent of the other starch-associated
OMPs.
SusG exhibits very low affinity for starch and does not play a
significant role in starch binding.
We used membrane fractions
from two different mutants to determine the Km
of SusG for starch hydrolysis and compare it to that of SusA. In the
strain
susB, the only membrane-associated starch-degrading enzyme present is SusA, because the polarity of the
insertion prevents the expression of SusG. In strain
SAB(pSGC23A), only SusG is produced. The Km of SusG was 3.1 mM. By comparison, the Km of SusA was 0.125 mM,
almost 20 times lower than that of SusG. These results suggest that
SusG has a low affinity for starch. To test the contribution of SusG to
starch binding, we expressed SusG independently of the other OMPs. This
was achieved by placing pSGC23A in an
susC background.
The
susC(pSGC23A) strain produced SusA, SusB, and SusG
but not SusC, SusD, SusE, or SusF. This strain did not exhibit
significant binding above the background binding of
susC
(Fig. 4). Other proteins seem to be more
directly involved in binding than SusG.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 4.
Starch binding of B. thetaiotaomicron mutants
at various starch concentrations. Cells bound increasing amounts of
starch ([14C]starch plus unlabeled amylopectin)
proportional to starch concentration until the binding sites were
saturated, at which point binding was independent of starch
concentration. Error bars are shown for B. thetaiotaomicron
4007, susG, and susC only.
|
|
To degrade starch sufficiently for cell growth, SusG's activity could
be enhanced by starch binding proteins which bring the
substrate closer
to it. This possibility suggested that SusG may
closely interact with
starch binding proteins. Whether this is
a direct or indirect
interaction has not been determined. If there
is a direct interaction,
the possibility exists that SusG's absence
(e.g., in
susG) may affect binding by these potentially closely
associated starch binding proteins. We examined this possibility
by
using a starch binding assay. Initially, in doing the assay
that
measures binding of [
14C]starch to intact cells, we
merely pelleted the cells and did
not wash them because we assumed that
binding would be reversible.
Subsequently, we found that most of the
[
14C]starch remained associated with the cells even after
washing
and was thus irreversibly bound. Since the wash step eliminated
some of the variation, we used this procedure to compare mutants
with
the wild type. Under the aerobic assay conditions used, there
was no
uptake and metabolism of the starch. Thus, our assay should
measure
only tight binding to the cell surface and not
transport.
When a range of starch concentrations was tested for irreversible
binding of starch, it became clear that a
susG disruption
mutant (
susG) bound amounts similar to those bound by the
wild
type at saturating conditions of starch. Binding was saturated
at
approximately 40 µg of bound starch/mg of cell protein for
both
wild-type and
susG strains. When SusG expression was
restored
by expression in
trans
[
susG(pSGC23A)], starch binding was again
equal to
that of the wild type (Fig.
4). It appears that lack
of SusG may have
increased the
KD of binding somewhat, but if
so,
this difference was barely significant. SusG appears not to
play a
significant role in starch binding, and its absence has
little
effect on starch
binding.
 |
DISCUSSION |
Our results demonstrate that SusG plays an important role in
starch breakdown. One function is enzymatic hydrolysis of starch. There
are a number of lines of evidence supporting the hypothesis that SusG
is a starch-degrading enzyme and not just a protein that activates an
enzyme. Smith and Salyers (18) partially purified membrane-bound starch-degrading proteins by subjecting Triton X-100
extracts of B. thetaiotaomicron membranes to isoelectric focusing. SusG is the only one of the Sus OMPs that can be solubilized by Triton X-100 (15). Therefore, we would expect SusG to
have been present in these extracts. Smith and Salyers found a fraction of amylase activity with pI of 4.4 to 4.9. SusG has a predicted pI of
4.8 to 4.9, once the putative signal sequence is removed. In this
range, the enzymatic activity was low relative to the other band, now
known to be SusA, but it was still detectable. SusG has significant
sequence similarity to
-amylases in the databases, is responsible
for the residual membrane-bound activity in a susA
disruption strain, and has enzyme activity when expressed independently
of the other starch-associated OMPs. Thus, based on current genetic and
previous biochemical evidence, it is reasonable to suggest that SusG
has starch-hydrolyzing activity. Another possible role for SusG is
binding of starch to the cell surface. Our results suggest, however,
that SusG makes little contribution to starch binding. If SusG has
little or no role in binding starch, the binding of starch must be
mediated by other starch OMPs which cooperate with SusG and even
enhance SusG's enzymatic activity.
The cellulosomes of clostridia and the pullulanase system of
Klebsiella pneumoniae have cell-associated enzymes that
degrade polysaccharides on the cell surface (3, 13). The
difference between the two, aside from the outer membrane, is that the
cellulosome also contains cellodextrin binding proteins which are in
close proximity to the cellulases (11). As a relevant
example, in Clostridium cellulolyticum, the cellulose
binding domains of CipC are hypothesized to enhance hydrolysis of
cellulose by keeping the substrate in a favorable position for
enzymatic attack (12). This hypothesis has been difficult to
test rigorously because of the lack of a genetic Clostridium
system. In our system, however, we can test this hypothesis in living
cells that have been genetically modified to produce only some of the
proteins involved. B. thetaiotaomicron appears also to have
starch binding proteins separate from the enzymes that work in concert
with them to cleave the substrate and sequester the protein. Evidence
presented here suggests that SusG has a very low affinity for starch,
necessitating starch binding proteins to promote hydrolytic attack,
which would be similar to the cellulosome's proposed mechanism of
polysaccharide hydrolysis.
Taken together, results of our previous and present studies show that
OMPs, including a putative porin SusC, are involved in the binding of
starch to the outer membrane of B. thetaiotaomicron. Starch
binding by OMPs has been shown to be an essential step for this process
(2). SusG appears to act primarily as an enzyme cleaving the
starch bound by those proteins to smaller oligomers which can then
traverse the membrane.
 |
ACKNOWLEDGMENTS |
This study was supported by grant AI17876 from the National
Institutes of Health.
We thank Nadja B. Shoemaker for constructing pNLY1::PsusA and
pGERM as well as providing excellent technical advice. We also thank
Jorge Frias-Lopez for superb technical advice on the proteinase K
accessibility experiments.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology, University of Illinois at Urbana-Champaign, 601 South
Goodwin Ave., Urbana, IL 61801. Phone: (217) 244-2938. Fax: (217)
244-6697. E-mail: jshipman{at}uiuc.edu.
 |
REFERENCES |
| 1.
|
Anderson, K. L., and A. A. Salyers.
1989.
Biochemical evidence that starch breakdown by Bacteroides thetaiotaomicron involves outer membrane starch-binding sites and periplasmic starch-degrading enzymes.
J. Bacteriol.
171:3192-3198[Abstract/Free Full Text].
|
| 2.
|
Anderson, K. L., and A. A. Salyers.
1989.
Genetic evidence that outer membrane binding of starch is required for starch utilization by Bacteroides thetaiotaomicron.
J. Bacteriol.
171:3199-3204[Abstract/Free Full Text].
|
| 3.
|
Beguin, P., and M. Lemaire.
1996.
The cellulosome: an exocellular, multiprotein complex specialized in cellulose degradation.
Crit. Rev. Biochem. Mol. Biol.
31:201-236[Medline].
|
| 4.
|
D'elia, J. N., and A. A. Salyers.
1996.
Contribution of a neopullulanase, a pullulanase and an -glucosidase to growth of Bacteroides thetaiotaomicron on starch.
J. Bacteriol.
178:7173-7179[Abstract/Free Full Text].
|
| 5.
|
D'elia, J. N., and A. A. Salyers.
1996.
Effect of regulatory levels on utilization of starch by Bacteroides thetaiotaomicron.
J. Bacteriol.
178:7180-7186[Abstract/Free Full Text].
|
| 6.
|
Hanahan, D.
1983.
Studies on the transformation of Escherichia coli with plasmids.
J. Mol. Biol.
166:557-580[Medline].
|
| 7.
|
Kanazawa, K.,
Y. Kobayashi,
M. Nakano,
M. Sakurai,
N. Gotoh, and T. Nishino.
1995.
Identification of three porins in the outer membrane of Bacteroides fragilis.
FEMS Microbiol. Lett.
127:181-186.
|
| 8.
|
Lederberg, E. M., and S. M. Cohen.
1974.
Transformation of Salmonella typhimurium by plasmid deoxyribonucleic acid.
J. Bacteriol.
119:1072-1074[Abstract/Free Full Text].
|
| 9.
|
Lowry, O. H.,
N. J. Rosebrough,
A. L. Farr, and R. J. Randall.
1951.
Protein measurement with the Folin phenol reagent.
J. Biol. Chem.
193:265-275[Free Full Text].
|
| 10.
|
Maniatis, T.,
E. F. Fritsch, and J. Sambrook.
1982.
Molecular cloning: a laboratory manual.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y
|
| 11.
|
Pages, S.,
A. Belaich,
C. Tardif,
C. Reverbel-Leroy,
C. Gaudin, and P. Belaich.
1996.
Interaction between the endoglucanase CelA and the scaffolding protein CipC of the Clostridium cellulolyticum cellulosome.
J. Bacteriol.
178:2279-2286[Abstract/Free Full Text].
|
| 12.
|
Pages, S.,
L. Gal,
A. Belaich,
C. Gaudin,
C. Tardif, and J.-P. Belaich.
1997.
Role of scaffolding protein CipC of Clostridium cellulolyticum in cellulose degradation.
Appl. Environ. Microbiol.
179:2810-2816.
|
| 13.
|
Pugsley, A. P.
1993.
The complete general secretory pathway in gram-negative bacteria.
Microbiol. Rev.
57:50-108[Abstract/Free Full Text].
|
| 14.
|
Reeves, A. R.,
J. N. D'elia,
J. Frias, and A. A. Salyers.
1996.
A Bacteroides thetaiotaomicron outer membrane protein that is essential for utilization of maltooligosaccharides and starch.
J. Bacteriol.
178:823-830[Abstract/Free Full Text].
|
| 15.
|
Reeves, A. R.,
G.-R. Wang, and A. A. Salyers.
1997.
Characterization of four outer membrane proteins that play a role in utilization of starch by Bacteroides thetaiotaomicron.
J. Bacteriol.
179:643-649[Abstract/Free Full Text].
|
| 16.
|
Shoemaker, N. B.,
C. Getty,
E. P. Guthrie, and A. A. Salyers.
1986.
Regions in Bacteroides plasmids pBFTM10 and pB8-51 that allow Escherichia coli-Bacteroides shuttle vectors to be mobilized by IncP plasmids and by a conjugative Bacteroides tetracycline resistance element.
J. Bacteriol.
166:959-965[Abstract/Free Full Text].
|
| 17.
| Shoemaker, N. B., G.-R. Wang, and A. A. Salyers. Multiple gene products and an excision required
sequence (XRS) necessary for the excision of the mobilizable
Bacteroides element NBU1. Submitted for publication.
|
| 18.
|
Smith, K. A., and A. A. Salyers.
1991.
Characterization of a neopullulanase and an -glucosidase from Bacteroides thetaiotaomicron 95-1.
J. Bacteriol.
173:2962-2968[Abstract/Free Full Text].
|
| 19.
|
Tancula, E.,
M. J. Feldhaus,
L. A. Bedzyk, and A. A. Salyers.
1992.
Location and characterization of genes involved in binding of starch to the surface of Bacteroides thetaiotaomicron.
J. Bacteriol.
174:5609-5616[Abstract/Free Full Text].
|
| 20.
|
Valentine, P., and A. A. Salyers.
1992.
Analysis of proteins associated with growth of Bacteroides ovatus on the branched galactomannan guar gum.
Appl. Environ. Microbiol.
58:1534-1540[Abstract/Free Full Text].
|
Journal of Bacteriology, December 1999, p. 7206-7211, Vol. 181, No. 23
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Wexler, H. M.
(2007). Bacteroides: the Good, the Bad, and the Nitty-Gritty. Clin. Microbiol. Rev.
20: 593-621
[Abstract]
[Full Text]
-
Xie, G., Bruce, D. C., Challacombe, J. F., Chertkov, O., Detter, J. C., Gilna, P., Han, C. S., Lucas, S., Misra, M., Myers, G. L., Richardson, P., Tapia, R., Thayer, N., Thompson, L. S., Brettin, T. S., Henrissat, B., Wilson, D. B., McBride, M. J.
(2007). Genome Sequence of the Cellulolytic Gliding Bacterium Cytophaga hutchinsonii. Appl. Environ. Microbiol.
73: 3536-3546
[Abstract]
[Full Text]
-
Ramsay, A. G., Scott, K. P., Martin, J. C., Rincon, M. T., Flint, H. J.
(2006). Cell-associated {alpha}-amylases of butyrate-producing Firmicute bacteria from the human colon.. Microbiology
152: 3281-3290
[Abstract]
[Full Text]
-
Nikaido, H.
(2003). Molecular Basis of Bacterial Outer Membrane Permeability Revisited. Microbiol. Mol. Biol. Rev.
67: 593-656
[Abstract]
[Full Text]
-
Cho, K. H., Cho, D., Wang, G.-R., Salyers, A. A.
(2001). New Regulatory Gene That Contributes to Control of Bacteroides thetaiotaomicron Starch Utilization Genes. J. Bacteriol.
183: 7198-7205
[Abstract]
[Full Text]
-
Cho, K. H., Salyers, A. A.
(2001). Biochemical Analysis of Interactions between Outer Membrane Proteins That Contribute to Starch Utilization by Bacteroides thetaiotaomicron. J. Bacteriol.
183: 7224-7230
[Abstract]
[Full Text]
-
Wang, J., Wang, G.-R., Shoemaker, N. B., Salyers, A. A.
(2001). Production of Two Proteins Encoded by the Bacteroides Mobilizable Transposon NBU1 Correlates with Time-Dependent Accumulation of the Excised NBU1 Circular Form. J. Bacteriol.
183: 6335-6343
[Abstract]
[Full Text]
-
Shipman, J. A., Berleman, J. E., Salyers, A. A.
(2000). Characterization of Four Outer Membrane Proteins Involved in Binding Starch to the Cell Surface of Bacteroides thetaiotaomicron. J. Bacteriol.
182: 5365-5372
[Abstract]
[Full Text]