INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

Human colonic Bacteroides spp. can utilize a wide range of polysaccharides as sources of carbon and energy. These substrates are broken down by cell-associated enzymes. So far, no extracellular enzymatic activity has been detected, and binding of the polysaccharide to the cell surface appears to be important for utilization. This evidence led us to propose a model in which the polysaccharide is first bound to an outer membrane receptor and then translocated through the outer membrane. Most enzymatic hydrolysis of the polysaccharide probably occurs in the periplasm, but an initial step in breakdown catalyzed by an outer membrane enzyme could not be ruled out. Most studies of outer membrane translocator proteins have focused on porins, which allow small substrates to diffuse through the outer membrane (7). However, Bacteroides spp. can grow on substrates which are much larger than the pore size of outer membrane porins (~600 Da) and can grow as well on polymeric as on monomeric substrates, suggesting a rapid and efficient uptake process.

We have used the starch utilization system of Bacteroides thetaiotaomicron as a model for defining the various components involved in polysaccharide utilization by Bacteroides spp. B. thetaiotaomicron can utilize all three forms of starchamylose, amylopectin, and pullulanas well as component maltooligosaccharides. Amylose consists of -1,4-linked glucose residues, whereas amylopectin is a branched polymer composed of amylose chains connected by -1,6 linkages to an amylose backbone. Pullulan is a linear chain of maltotriose residues linked by -1,6 bonds. We had identified an operon consisting of eight genes (designated sus, for starch utilization system) which encode proteins that catalyze early steps in the breakdown of starch by B. thetaiotaomicron. Two genes, susA and susB, encode a cell-associated starch-degrading enzyme and an -glucosidase, respectively. A mutant with a disruption in susA grew more slowly than the wild type but was still able to grow on starch. This finding suggested that other starch-degrading enzymes must participate in this pathway. However, only a very low level of starch hydrolysis could be detected in a cell extract from the susA disruption strain (4). Five of the sus genes, susC, -D, -E, -F, and -G, encode outer membrane proteins (OMPs). SusC is essential for starch utilization and is the only OMP necessary for utilization of the smaller oligomers, maltotetraose to maltoheptaose (14). SusC may form an oligomeric channel in the outer membrane of B. thetaiotaomicron. Previous evidence suggested that SusE is not required for starch utilization (15), but whether SusD or SusF is essential has not been established. SusG is essential for starch utilization but not for utilization of maltooligosaccharides.

Because SusG is an OMP and is essential for utilization of full-length starch, we suspected that SusG would have binding or enzymatic activity or both. Sequence analysis had suggested that susG might encode a starch-degrading enzyme because the deduced amino acid sequence of SusG had significant similarity to sequences of a number of -amylases and had all of the conserved residues and regions shown to be important for catalytic activity (15). Yet, a mutant with a disruption in susG appeared to have the same level of starch-degrading activity as wild type. This could have been due to the fact that the major enzyme activity detectable in cell extracts, SusA (4), overshadowed a much lower starch-degrading activity due to SusG. We report here that SusG has starch-degrading activity and is exposed on the cell surface but plays only a negligible role in starch binding. Thus, the starch utilization system seems to separate binding activity from enzymatic activity.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Bacterial strains and growth conditions. The bacterial strains and plasmids used in this study are listed in Table 1. All Escherichia coli strains used in this study were grown in Luria-Bertani (LB) broth or on LB agar at 37°C. B. thetaiotaomicron 5482, B. thetaiotaomicron 4007, transposon-generated derivatives, and single-disruption mutants used in this study have been described previously (2, 4, 15). When necessary, suicide vectors were used to create additional disruptions in these strains. B. thetaiotaomicron 4007 was used as a control in growth and binding experiments because it is a derivative of 5482 that is tetracycline resistant (tetQ). tetQ is the selectable marker used in the construction of most disruption mutants.

DNA methods. Isolation of plasmids was done by using a Wizard Plus DNA purification system (Promega Corp.). Dephosphorylation reactions and restriction digests were performed as instructed by the manufacturer (Bethesda Research Laboratories, Bethesda, Md., or New England BioLabs, Beverly, Mass.). Transformation of E. coli DH5MCR was done by the method of Lederberg and Cohen (8). Conjugations, where constructs generated in E. coli were transferred to Bacteroides recipients, were performed as described by Shoemaker et al. (16). Southern blotting was done as described by Maniatis et al. (10) except that a Renaissance detection kit (DuPont-NEN) was used for detection of the bound DNA probe.

Chemicals. [¹⁴C]starch (Nicotiana tobacum L) was purchased from DuPont-NEN. Amylopectin, pullulan, proteinase K, and phenylmethylsulfonyl fluoride (PMSF) were purchased from Sigma Corp. p-Nitrophenyl--D-maltoheptaoside was obtained from Boehringer Mannheim Biochemica.

Membrane preparation. Membranes were prepared by the method of Valentine and Salyers (20). Cells were grown in a defined medium with maltose (0.3%) as the sole carbohydrate source to late log phase (optical density at 650 nm of 0.6 to 0.8). The cells were washed once with 20 mM potassium phosphate buffer (pH 7.2) and resuspended in 5 ml of the same buffer. These cells were disrupted by sonication. After separation of the cell extract from insoluble material by centrifugation, the whole membranes (both inner and outer membranes) were pelleted from the cell extract by ultracentrifugation (200,000 × g for 2.5 h at 4°C). The soluble fraction was collected, and the membrane pellet was washed once with 20 mM potassium phosphate buffer and pelleted again by ultracentrifugation under the same conditions. The membrane pellet was resuspended in 20 mM potassium phosphate buffer, and the membranes were dispersed by sonication. For analysis of enzymatic activity, the membrane preparations were resuspended in a 50 mM potassium phosphate buffer-20% glycerol solution instead of 20 mM potassium phosphate buffer. Glycerol was added to allow storage of the enzymes at 80°C and did not affect specific activity.

[¹⁴C]starch binding experiments. [¹⁴C]starch binding assays on wild-type and mutant B. thetaiotaomicron were performed by a modification of the procedure of Anderson and Salyers (1). Cells were grown in maltose-minimal medium to an optical density at 650 nm of 0.5 to 0.6. The cells were washed twice with 0.1 M phosphate-buffered saline (PBS; pH 7.4) to dissociate any loose capsular material. Cells were resuspended in PBS to an optical density at 650 nm of 0.4. The cell suspension was incubated with either radiolabeled starch or a mixture of labeled and unlabeled starch for 5 min at room temperature under aerobic conditions. Under aerobic conditions, no starch uptake occurs. That is, after the first binding step occurs, no further accumulation of starch is seen even after an hour (1). After centrifugation of the cells, the supernatant fluid was discarded and the cells were washed twice with 0.5 ml of PBS. All of the cell pellets were then resuspended in 100 µl of PBS. This solution was transferred to 2.0 ml of scintillation fluid, and the amount of bound label was determined with a Beckman model 5000TD scintillation counter.

Assay for enzyme activity in membrane fractions of wild-type and various susA and susG disruption strains. In the original studies of Smith and Salyers (18), the enzyme assay conditions were optimized for the major activity detectable in cell extracts, which we now know is due to SusA. These conditions might not be optimal for the residual membrane-associated activity found in the susA disruption mutant (4). To determine the optimum conditions for the other enzyme(s), we used p-nitrophenyl--D-maltoheptaoside as the substrate (final concentration of 0.5 mM). We found that adding detergent (e.g., n-octyl--D-glucoside) to solubilize the protein from the membrane or adding cofactors such as Ca²⁺ did not enhance the observed enzyme activity. Consequently, we used the original conditions of Smith and Salyers (18), 50 mM potassium phosphate buffer with no additional detergents or cofactors, to measure enzyme activity. This mixture was used in all subsequent assays of enzyme activity.

Protease treatment of cells. To determine if SusG was exposed on the cell surface, we tested whether it was accessible to proteolytic activity. We used a relatively nonspecific protease, proteinase K, to increase the likelihood that a surface-exposed protein would be cleaved. For this experiment, cells were transferred from an overnight culture of cells grown in VPI to 100 ml of defined medium containing 0.3% maltose. These cells were grown to late exponential phase (optical density at 650 nm of 0.8) and harvested by centrifugation at room temperature. The cell pellet was washed twice with 100 mM potassium phosphate buffer (pH 7.2) to dissociate any loose capsular material from the cells. Subsequently, the cells were resuspended in 9 ml of 100 mM potassium phosphate buffer and fresh proteinase K (20 mg/ml) was added to a final concentration of 2 mg/ml. The cells were incubated at 37°C with occasional mixing. Samples of 2 ml were removed at 0, 0.5, 1, 2, and 4 h. To each sample, PMSF (10 mg/ml) was added to a final concentration of 10 mM to stop proteinase K activity. The cells were harvested by centrifugation and washed once with 2 ml of a 100 mM potassium phosphate buffer-PMSF solution. The final cell pellet was resuspended in 100 mM potassium phosphate buffer containing 1 mM PMSF. After disruption of the cells by sonication, protein concentration of the cell extract was determined by a modification of the method of Lowry et al. (9). Approximately 100 µg of protein from each sample was solubilized in Laemmli buffer and electrophoresed on a sodium dodecyl sulfate-polyacrylamide gel. The gel was transferred to a Bio-Rad Trans-Blot nitrocellulose membrane. SusG protein was detected by using a Bio-Rad goat anti-mouse-horseradish peroxidase Opti-4CN kit, using antisera directed against the protein. As a control, we repeated the above procedure except that cells were incubated in buffer with no added proteinase K. As a control to ensure that the proteinase K treatment had not disrupted the outer membrane, we used Western blotting to confirm that SusA was not degraded during the proteinase K treatment period. SusA antibody was detected by using a Bio-Rad goat anti-rabbit-horseradish peroxidase Opti-4CN substrate kit, using antisera directed against the protein.

susG expression in trans. susG was amplified by PCR using primers GAATGGCCGTCGCGGATCCAATGAAATC, which is 30 bp upstream of the putative start codon, and AAGGTTTCTTGGAGCTCGATAGAAAC, which lies 30 bp downstream of the putative transcriptional stop site. This product was cloned into the multiple cloning site of the expression vector pNLY1::PsusA (17) (Fig. 1). In this construct, the gene of interest is cloned downstream of a 392-bp PCR fragment containing the susA promoter (PsusA). This plasmid was called pSGC23A. pSGC23A was mated to susG, SAB, SAC, SAG, and susC. These transconjugants were tested by immunoblotting to confirm SusG expression as well as expression of other starch proteins. In addition, these strains were tested for growth on starch.

View larger version (20K): [in this window] [in a new window]   FIG. 1.   Partial restriction map of pNLY1::PsusA, the expression vector used to express susG in trans in B. thetaiotaomicron. The selectable marker in E. coli is ampicillin resistance (bla) plus chloramphenicol resistance (CAT). The selectable marker in B. thetaiotaomicron is chloramphenicol resistance. The E. coli replication region (pBI136) and B. thetaiotaomicron replication and mobilization region (pBI143) are shown. The CAT gene is cloned downstream of the IS4351 promoter. The promoter to control expression of cloned genes was obtained by PCR of a 392-bp fragment from the B. thetaiotaomicron chromosome containing PsusA.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

susG expression in trans. From previous studies in which susG was inactivated by an insertional disruption or a transposon insertion, we knew that SusG was essential for growth on starch (15). To determine the role of SusG itself, we needed to express this gene in trans to determine the properties of a strain producing SusG independently of the other OMPs. In this case, it was important to be particularly careful about the promoter used to drive susG expression and the effect of that promoter on expression of chromosomal genes, because we had found previously that PsusA and susB PsusB could titrate the regulatory protein, SusR, thus reducing transcription of the entire susB-susG operon when either promoter region was provided in trans on a multicopy plasmid (5). We used PsusA because it is 30-fold weaker and had much less effect in trans than PsusB. The original shuttle vector used to clone susG for in trans complementation, pNLY1, is present at 8 to 10 copies/cell (17). Consequently, taking into account the lower expression level of PsusA than of PsusB and the copy number of the plasmid, expression of susG from this plasmid should be close to wild-type levels. The susG expression plasmid, designated pSGC23A, was transferred into an susG background to test for complementation.

View larger version (79K): [in this window] [in a new window]   FIG. 2.   Immunoblot showing SusG expression from a multicopy plasmid. Approximately 50 µg of protein was loaded onto each lane. All membrane fractions were obtained from cells grown on minimal medium with maltose as the sole carbohydrate source. Lanes: 1, membrane fraction from B. thetaiotaomicron 5482; 2, membrane fraction from B. thetaiotaomicron susG(pSGC23A); 3, membrane fraction from B. thetaiotaomicron susG; 4, membrane fraction from B. thetaiotaomicron susC(pSGC23A); 5, membrane fraction from B. thetaiotaomicron susC. The arrows mark the known starch OMPs.

susG encodes a starch-hydrolyzing enzyme. Previous experiments had shown that cell extracts from B. thetaiotaomicron mutant Ms-4, which had a transposon inserted in susG, appeared to have wild-type levels of starch-hydrolyzing enzyme activity (1), but the high activity of SusA in these extracts could have been masking another enzyme activity. To eliminate the major starch-degrading activity detected in our assay system (SusA), we constructed a mutant with a disruption in susA (susA) and compared its enzymatic activity with that of a double mutant that had disruptions in both susA and susG (SAG). We used Western blotting to confirm that both mutants lacked SusA but still expressed SusB to SusF normally and that susA produced SusG whereas SAG lacked SusG.

SusG is exposed on the cell surface. Since SusG had enzymatic activity, we wanted to determine if SusG was exposed on the cell surface. If the protein is surface exposed, enzymatic cleavage might occur on the cell surface. We tested for exposure on the cell surface by determining the protease accessibility of SusG in intact cells. After 2 h of proteinase K treatment, SusG was no longer detectable in these cells (Fig. 3). The complete degradation of SusG shows that proteinase K was able to attack SusG on the cell surface. We performed control experiments to confirm that SusG was stable in the absence of proteinase K and that proteinase K degradation of surface-exposed proteins was not destroying the outer membrane. In a control experiment where proteinase K was not added, SusG was stable throughout the course of the experiment. To confirm that the cells treated with proteinase K remained intact during the digestion period, we determined whether SusA, a periplasmic enzyme, was present at the time points where SusG was not present. According to the results of immunoblotting, SusA was present at a constant level at all time points in this experiment (Fig. 3). This confirms that we were seeing surface degradation of OMPs but not disruption of the outer membrane. In a separate experiment, to rule out the possibility that SusA was unusually resistant to proteases, we disrupted cells to release SusA and then added proteinase K. Under these conditions, SusA disappeared within 30 min after addition of proteinase K, confirming that SusA is readily degraded by proteinase K if it is accessible to the enzyme.

View larger version (36K): [in this window] [in a new window]   FIG. 3.   Immunoblots showing proteolytic sensitivity of SusG in intact cells. Cells were treated with proteinase K (2 mg/ml), and degradation of SusG was observed over time. SusA, a periplasmic marker, is shown to be stable during the course of each experiment. Approximately 100 µg of protein from whole-cell extracts was loaded onto each lane. Lanes 1 to 5 represent whole-cell extracts of B. thetaiotaomicron wild-type (A) and susC(pSGC23A) (B) strains at 0, 30, 60, 120, and 240 min, respectively.

SusG exhibits very low affinity for starch and does not play a significant role in starch binding. We used membrane fractions from two different mutants to determine the K_m of SusG for starch hydrolysis and compare it to that of SusA. In the strain susB, the only membrane-associated starch-degrading enzyme present is SusA, because the polarity of the insertion prevents the expression of SusG. In strain SAB(pSGC23A), only SusG is produced. The K_m of SusG was 3.1 mM. By comparison, the K_m of SusA was 0.125 mM, almost 20 times lower than that of SusG. These results suggest that SusG has a low affinity for starch. To test the contribution of SusG to starch binding, we expressed SusG independently of the other OMPs. This was achieved by placing pSGC23A in an susC background. The susC(pSGC23A) strain produced SusA, SusB, and SusG but not SusC, SusD, SusE, or SusF. This strain did not exhibit significant binding above the background binding of susC (Fig. 4). Other proteins seem to be more directly involved in binding than SusG.

View larger version (18K): [in this window] [in a new window]   FIG. 4.   Starch binding of B. thetaiotaomicron mutants at various starch concentrations. Cells bound increasing amounts of starch ([14C]starch plus unlabeled amylopectin) proportional to starch concentration until the binding sites were saturated, at which point binding was independent of starch concentration. Error bars are shown for B. thetaiotaomicron 4007, susG, and susC only.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

Our results demonstrate that SusG plays an important role in starch breakdown. One function is enzymatic hydrolysis of starch. There are a number of lines of evidence supporting the hypothesis that SusG is a starch-degrading enzyme and not just a protein that activates an enzyme. Smith and Salyers (18) partially purified membrane-bound starch-degrading proteins by subjecting Triton X-100 extracts of B. thetaiotaomicron membranes to isoelectric focusing. SusG is the only one of the Sus OMPs that can be solubilized by Triton X-100 (15). Therefore, we would expect SusG to have been present in these extracts. Smith and Salyers found a fraction of amylase activity with pI of 4.4 to 4.9. SusG has a predicted pI of 4.8 to 4.9, once the putative signal sequence is removed. In this range, the enzymatic activity was low relative to the other band, now known to be SusA, but it was still detectable. SusG has significant sequence similarity to -amylases in the databases, is responsible for the residual membrane-bound activity in a susA disruption strain, and has enzyme activity when expressed independently of the other starch-associated OMPs. Thus, based on current genetic and previous biochemical evidence, it is reasonable to suggest that SusG has starch-hydrolyzing activity. Another possible role for SusG is binding of starch to the cell surface. Our results suggest, however, that SusG makes little contribution to starch binding. If SusG has little or no role in binding starch, the binding of starch must be mediated by other starch OMPs which cooperate with SusG and even enhance SusG's enzymatic activity.

The cellulosomes of clostridia and the pullulanase system of Klebsiella pneumoniae have cell-associated enzymes that degrade polysaccharides on the cell surface (3, 13). The difference between the two, aside from the outer membrane, is that the cellulosome also contains cellodextrin binding proteins which are in close proximity to the cellulases (11). As a relevant example, in Clostridium cellulolyticum, the cellulose binding domains of CipC are hypothesized to enhance hydrolysis of cellulose by keeping the substrate in a favorable position for enzymatic attack (12). This hypothesis has been difficult to test rigorously because of the lack of a genetic Clostridium system. In our system, however, we can test this hypothesis in living cells that have been genetically modified to produce only some of the proteins involved. B. thetaiotaomicron appears also to have starch binding proteins separate from the enzymes that work in concert with them to cleave the substrate and sequester the protein. Evidence presented here suggests that SusG has a very low affinity for starch, necessitating starch binding proteins to promote hydrolytic attack, which would be similar to the cellulosome's proposed mechanism of polysaccharide hydrolysis.

Taken together, results of our previous and present studies show that OMPs, including a putative porin SusC, are involved in the binding of starch to the outer membrane of B. thetaiotaomicron. Starch binding by OMPs has been shown to be an essential step for this process (2). SusG appears to act primarily as an enzyme cleaving the starch bound by those proteins to smaller oligomers which can then traverse the membrane.