Previous Article | Next Article 
Journal of Bacteriology, December 1999, p. 7206-7211, Vol. 181, No. 23
Department of Microbiology, University of
Illinois at Urbana-Champaign, Urbana, Illinois 61801
Received 10 May 1999/Accepted 14 September 1999
Results from previous studies had suggested that Bacteroides
thetaiotaomicron utilizes starch by binding the polysaccharide to
the bacterial surface and subsequently degrading the polymer by using
cell-associated enzymes. Most of the starch-degrading activity was
localized to the periplasm, but a portion appeared to be membrane
associated. This raised the possibility that some breakdown might occur
in the outer membrane prior to exposure of the polysaccharide to the
periplasmic polysaccharide-degrading enzymes. In this study, we show
that SusG, an outer membrane protein which has been shown genetically
to be essential for starch utilization, has enzymatic activity. Results
of protease accessibility experiments support the hypothesis that SusG
is exposed on the cell surface. Results of [14C]starch
binding assays, however, show that SusG plays a negligible role in
binding of starch to the cell surface. Consistent with this, SusG has a
relatively high Km for starch and by itself is not sufficient to allow cells to grow on starch or to bind starch. Hence, the main role of SusG is to hydrolyze starch, but the binding of
starch to the cell surface is evidently mediated by other proteins presumably interacting with SusG.
Human colonic Bacteroides
spp. can utilize a wide range of polysaccharides as sources of carbon
and energy. These substrates are broken down by cell-associated
enzymes. So far, no extracellular enzymatic activity has been detected,
and binding of the polysaccharide to the cell surface appears to be
important for utilization. This evidence led us to propose a model in
which the polysaccharide is first bound to an outer membrane receptor
and then translocated through the outer membrane. Most enzymatic
hydrolysis of the polysaccharide probably occurs in the periplasm, but
an initial step in breakdown catalyzed by an outer membrane enzyme
could not be ruled out. Most studies of outer membrane translocator
proteins have focused on porins, which allow small substrates to
diffuse through the outer membrane (7). However,
Bacteroides spp. can grow on substrates which are much
larger than the pore size of outer membrane porins (~600 Da) and can
grow as well on polymeric as on monomeric substrates, suggesting a
rapid and efficient uptake process.
We have used the starch utilization system of Bacteroides
thetaiotaomicron as a model for defining the various components involved in polysaccharide utilization by Bacteroides spp.
B. thetaiotaomicron can utilize all three forms of
starch Because SusG is an OMP and is essential for utilization of full-length
starch, we suspected that SusG would have binding or enzymatic activity
or both. Sequence analysis had suggested that susG might
encode a starch-degrading enzyme because the deduced amino acid
sequence of SusG had significant similarity to sequences of a number of
Bacterial strains and growth conditions.
The bacterial
strains and plasmids used in this study are listed in Table
1. All Escherichia coli
strains used in this study were grown in Luria-Bertani (LB) broth or on
LB agar at 37°C. B. thetaiotaomicron 5482, B. thetaiotaomicron 4007, transposon-generated derivatives, and
single-disruption mutants used in this study have been described
previously (2, 4, 15). When necessary, suicide vectors were
used to create additional disruptions in these strains. B. thetaiotaomicron 4007 was used as a control in growth and binding
experiments because it is a derivative of 5482 that is tetracycline
resistant (tetQ). tetQ is the selectable marker used in the
construction of most disruption mutants.
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Physiological Characterization of SusG, an Outer
Membrane Protein Essential for Starch Utilization by
Bacteroides thetaiotaomicron
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
amylose, amylopectin, and pullulanas well as component
maltooligosaccharides. Amylose consists of 
-1,4-linked glucose
residues, whereas amylopectin is a branched polymer composed of amylose
chains connected by -1,6 linkages to an amylose backbone. Pullulan
is a linear chain of maltotriose residues linked by -1,6 bonds. We
had identified an operon consisting of eight genes (designated sus, for
starch utilization system) which encode proteins that catalyze early steps in the breakdown of starch by B. thetaiotaomicron. Two
genes, susA and susB, encode a cell-associated
starch-degrading enzyme and an -glucosidase, respectively. A mutant
with a disruption in susA grew more slowly than the wild
type but was still able to grow on starch. This finding suggested that
other starch-degrading enzymes must participate in this pathway.
However, only a very low level of starch hydrolysis could be detected
in a cell extract from the susA disruption strain
(4). Five of the sus genes, susC,
-D, -E, -F, and -G, encode
outer membrane proteins (OMPs). SusC is essential for starch
utilization and is the only OMP necessary for utilization of the
smaller oligomers, maltotetraose to maltoheptaose (14). SusC
may form an oligomeric channel in the outer membrane of B. thetaiotaomicron. Previous evidence suggested that SusE is not
required for starch utilization (15), but whether SusD or
SusF is essential has not been established. SusG is essential for
starch utilization but not for utilization of maltooligosaccharides.
-amylases and had all of the conserved residues and regions shown to
be important for catalytic activity (15). Yet, a mutant with
a disruption in susG appeared to have the same level of
starch-degrading activity as wild type. This could have been due to the
fact that the major enzyme activity detectable in cell extracts, SusA
(4), overshadowed a much lower starch-degrading activity due
to SusG. We report here that SusG has starch-degrading activity and is
exposed on the cell surface but plays only a negligible role in starch
binding. Thus, the starch utilization system seems to separate binding
activity from enzymatic activity.
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
TABLE 1.
Strains and plasmids used in
this studya
DNA methods.
Isolation of plasmids was done by using a
Wizard Plus DNA purification system (Promega Corp.).
Dephosphorylation reactions and restriction digests were performed as
instructed by the manufacturer (Bethesda Research Laboratories,
Bethesda, Md., or New England BioLabs, Beverly, Mass.). Transformation
of E. coli DH5MCR was done by the method of Lederberg and
Cohen (8). Conjugations, where constructs generated in
E. coli were transferred to Bacteroides recipients, were performed as described by Shoemaker et al.
(16). Southern blotting was done as described by Maniatis et
al. (10) except that a Renaissance detection kit
(DuPont-NEN) was used for detection of the bound DNA probe.
Chemicals.
[14C]starch (Nicotiana
tobacum L) was purchased from DuPont-NEN. Amylopectin, pullulan,
proteinase K, and phenylmethylsulfonyl fluoride (PMSF) were purchased
from Sigma Corp.
p-Nitrophenyl--D-maltoheptaoside was obtained
from Boehringer Mannheim Biochemica.
Membrane preparation.
Membranes were prepared by the method
of Valentine and Salyers (20). Cells were grown in a defined
medium with maltose (0.3%) as the sole carbohydrate source to late log
phase (optical density at 650 nm of 0.6 to 0.8). The cells were washed
once with 20 mM potassium phosphate buffer (pH 7.2) and resuspended in
5 ml of the same buffer. These cells were disrupted by sonication.
After separation of the cell extract from insoluble material by
centrifugation, the whole membranes (both inner and outer membranes)
were pelleted from the cell extract by ultracentrifugation (200,000 × g for 2.5 h at 4°C). The soluble fraction was
collected, and the membrane pellet was washed once with 20 mM potassium
phosphate buffer and pelleted again by ultracentrifugation under the
same conditions. The membrane pellet was resuspended in 20 mM potassium
phosphate buffer, and the membranes were dispersed by sonication. For
analysis of enzymatic activity, the membrane preparations were
resuspended in a 50 mM potassium phosphate buffer-20% glycerol
solution instead of 20 mM potassium phosphate buffer. Glycerol was
added to allow storage of the enzymes at 
80°C and did not affect
specific activity.
[14C]starch binding experiments. [14C]starch binding assays on wild-type and mutant B. thetaiotaomicron were performed by a modification of the procedure of Anderson and Salyers (1). Cells were grown in maltose-minimal medium to an optical density at 650 nm of 0.5 to 0.6. The cells were washed twice with 0.1 M phosphate-buffered saline (PBS; pH 7.4) to dissociate any loose capsular material. Cells were resuspended in PBS to an optical density at 650 nm of 0.4. The cell suspension was incubated with either radiolabeled starch or a mixture of labeled and unlabeled starch for 5 min at room temperature under aerobic conditions. Under aerobic conditions, no starch uptake occurs. That is, after the first binding step occurs, no further accumulation of starch is seen even after an hour (1). After centrifugation of the cells, the supernatant fluid was discarded and the cells were washed twice with 0.5 ml of PBS. All of the cell pellets were then resuspended in 100 µl of PBS. This solution was transferred to 2.0 ml of scintillation fluid, and the amount of bound label was determined with a Beckman model 5000TD scintillation counter.
In binding studies, higher concentrations of starch contained a mixture of [14C]starch and unlabeled amylopectin in PBS to reach the desired concentration. As a control for nonspecific binding of starch, we tested binding to mutant
susC, which expresses
none of the starch-associated OMPs and has been shown to have only a
very low residual binding activity (15). Values were
reported in micrograms of starch bound per milligram of cell protein.
These values were obtained by multiplying the total counts per minute by a dilution factor, which was the ratio of labeled starch to total
starch in each assay. That number was converted by an empirical constant (based on observed counts per minute per given amount of
starch) to disintegrations per minute, which allowed the total micrograms of starch bound to be calculated by using the reported values of 2.2 × 106 dpm per µg of starch.
Experimental values were standardized by assaying whole-cell protein
concentration, using a modification of the method of Lowry et al.
(9) with bovine serum albumin as a standard.
Assay for enzyme activity in membrane fractions of wild-type and
various susA and susG disruption strains.
In the original studies of Smith and Salyers (18), the
enzyme assay conditions were optimized for the major activity
detectable in cell extracts, which we now know is due to SusA. These
conditions might not be optimal for the residual membrane-associated
activity found in the susA disruption mutant (4).
To determine the optimum conditions for the other enzyme(s), we used
p-nitrophenyl--D-maltoheptaoside as the
substrate (final concentration of 0.5 mM). We found that adding
detergent (e.g., n-octyl-
-D-glucoside) to
solubilize the protein from the membrane or adding cofactors such as
Ca2+ did not enhance the observed enzyme activity.
Consequently, we used the original conditions of Smith and Salyers
(18), 50 mM potassium phosphate buffer with no additional
detergents or cofactors, to measure enzyme activity. This mixture was
used in all subsequent assays of enzyme activity.
-D-maltoheptaoside to assay
-1,4-amylase activity of whole-membrane protein extracts. Amylase
activity was calculated as instructed by the manufacturer (Boehringer
Mannheim Biochemica). We determined the Km for
both SusA and SusG by using resuspended membranes from mutants
susB and SAB(pSGC23A), respectively. These strains
expressed only one of the two starch-degrading enzymes, SusA and SusG,
respectively. Resuspended membranes were used to measure SusA activity
since much of the activity appears to be membrane associated
(1), and this would give us a more valid comparison of
activity with that of membrane-associated SusG. In these strains, SusB,
an -glucosidase which might interfere with the measurement of each
enzyme by hydrolyzing its products, was not expressed. Specific
activity was assayed at various concentrations, and
Km was determined from Lineweaver-Burke plots.
Bacteroides membranes were obtained by ultracentrifugation as described by Valentine and Salyers (see above and reference 20).
Protease treatment of cells. To determine if SusG was exposed on the cell surface, we tested whether it was accessible to proteolytic activity. We used a relatively nonspecific protease, proteinase K, to increase the likelihood that a surface-exposed protein would be cleaved. For this experiment, cells were transferred from an overnight culture of cells grown in VPI to 100 ml of defined medium containing 0.3% maltose. These cells were grown to late exponential phase (optical density at 650 nm of 0.8) and harvested by centrifugation at room temperature. The cell pellet was washed twice with 100 mM potassium phosphate buffer (pH 7.2) to dissociate any loose capsular material from the cells. Subsequently, the cells were resuspended in 9 ml of 100 mM potassium phosphate buffer and fresh proteinase K (20 mg/ml) was added to a final concentration of 2 mg/ml. The cells were incubated at 37°C with occasional mixing. Samples of 2 ml were removed at 0, 0.5, 1, 2, and 4 h. To each sample, PMSF (10 mg/ml) was added to a final concentration of 10 mM to stop proteinase K activity. The cells were harvested by centrifugation and washed once with 2 ml of a 100 mM potassium phosphate buffer-PMSF solution. The final cell pellet was resuspended in 100 mM potassium phosphate buffer containing 1 mM PMSF. After disruption of the cells by sonication, protein concentration of the cell extract was determined by a modification of the method of Lowry et al. (9). Approximately 100 µg of protein from each sample was solubilized in Laemmli buffer and electrophoresed on a sodium dodecyl sulfate-polyacrylamide gel. The gel was transferred to a Bio-Rad Trans-Blot nitrocellulose membrane. SusG protein was detected by using a Bio-Rad goat anti-mouse-horseradish peroxidase Opti-4CN kit, using antisera directed against the protein. As a control, we repeated the above procedure except that cells were incubated in buffer with no added proteinase K. As a control to ensure that the proteinase K treatment had not disrupted the outer membrane, we used Western blotting to confirm that SusA was not degraded during the proteinase K treatment period. SusA antibody was detected by using a Bio-Rad goat anti-rabbit-horseradish peroxidase Opti-4CN substrate kit, using antisera directed against the protein.
susG expression in trans.
susG was
amplified by PCR using primers GAATGGCCGTCGCGGATCCAATGAAATC,
which is 30 bp upstream of the putative start codon, and
AAGGTTTCTTGGAGCTCGATAGAAAC, which lies 30 bp downstream of the putative transcriptional stop site. This product was cloned into
the multiple cloning site of the expression vector
pNLY1::PsusA (17) (Fig.
1). In this construct, the gene of
interest is cloned downstream of a 392-bp PCR fragment containing the
susA promoter (PsusA). This plasmid was called
pSGC23A. pSGC23A was mated to susG, SAB, SAC,
SAG, and susC. These transconjugants were tested by
immunoblotting to confirm SusG expression as well as expression of
other starch proteins. In addition, these strains were tested for
growth on starch.
|
susC(pSGC23A)] with a strain which expresses none of
the starch-associated OMPs (susC). Furthermore, we tested
whether SusG was still exposed on the cell surface when expressed
independently of the other starch-associated OMPs.
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
susG expression in trans.
From previous
studies in which susG was inactivated by an insertional
disruption or a transposon insertion, we knew that SusG was essential
for growth on starch (15). To determine the role of SusG
itself, we needed to express this gene in trans to determine the properties of a strain producing SusG independently of the other
OMPs. In this case, it was important to be particularly careful about
the promoter used to drive susG expression and the effect of
that promoter on expression of chromosomal genes, because we had found
previously that PsusA and susB PsusB
could titrate the regulatory protein, SusR, thus reducing transcription
of the entire susB-susG operon when either promoter region
was provided in trans on a multicopy plasmid (5).
We used PsusA because it is 30-fold weaker and had much less
effect in trans than PsusB. The original shuttle
vector used to clone susG for in trans
complementation, pNLY1, is present at 8 to 10 copies/cell
(17). Consequently, taking into account the lower expression
level of PsusA than of PsusB and the copy number
of the plasmid, expression of susG from this plasmid should
be close to wild-type levels. The susG expression plasmid,
designated pSGC23A, was transferred into an susG
background to test for complementation.
susG(pSGC23A) had a generation time of 1.7 h
on amylopectin, whereas a strain that had wild-type susG,
B. thetaiotaomicron 4007(pNLY1::PsusA), had a
generation time of 1.4 h. Thus, the cloned gene complemented the
mutation, allowing it to grow on starch at about the same rate as the
wild type. In addition, it appeared that the cloned susG was
fully functional and that PsusA did not reduce significantly
expression of the chromosomal sus genes. In Western blots of
membranes from cells grown on minimal medium plus maltose, we noted a
slight overexpression of SusG in the membrane fraction compared to the
wild type, but the amount appeared to be at most twofold higher than
the wild-type level. We also confirmed by Western blotting that the
other OMPs (SusC to SusF) were being expressed at wild-type levels
(Fig. 2). The fact that a slight
overexpression of SusG was not deleterious to the cell suggested that
SusG may not need to achieve a tight stoichiometric balance with the
other OMPs for effective starch degradation. We used this
susG expression plasmid in subsequent experiments to
test SusG's role in starch utilization.
|
susG encodes a starch-hydrolyzing enzyme.
Previous
experiments had shown that cell extracts from B. thetaiotaomicron mutant Ms-4, which had a transposon inserted in susG, appeared to have wild-type levels of
starch-hydrolyzing enzyme activity (1), but the high
activity of SusA in these extracts could have been masking another
enzyme activity. To eliminate the major starch-degrading activity
detected in our assay system (SusA), we constructed a mutant with a
disruption in susA (susA) and compared its
enzymatic activity with that of a double mutant that had disruptions in
both susA and susG (SAG). We used Western blotting to confirm that both mutants lacked SusA but still expressed SusB to SusF normally and that susA produced SusG whereas
SAG lacked SusG.
susA decreased the membrane-associated amylase activity
sixfold (Table 2), yet there was still
detectable membrane-associated activity in this strain. When
susG was disrupted to create the double mutant SAG, this
activity decreased over 13-fold to below detectable levels (Table 2).
Thus, SusG accounts for the residual activity in the susA
mutant. To support this claim, we determined if SusG provided in
trans would restore the enzyme activity. We transferred the
multicopy plasmid pSGC23A into the SAG strain and tested for
starch-degrading activity. In the resulting strain, starch-degrading
activity increased from below detectable levels to over two times that
of the susA strain (Table 2). This increase in activity
over susA was probably due to the slight overexpression of SusG from the multicopy plasmid that we had observed on Western blots (Fig. 2).
|
SAC) and introduced pSGC23A. This strain expressed
neither SusA nor any of the starch-associated OMPs except SusG. The
original SAC strain without the plasmid had no detectable
starch-degrading activity. When the plasmid expressing susG
(pSGC23A) was introduced, starch-degrading activity of this strain was
comparable to that observed for SAG(pSGC23A) (Table 2), confirming
that SusG has enzymatic activity even when the other starch-associated
OMPs are not present. It is interesting that this strain,
SAC(pSGC23A), which expresses SusG but not SusC to SusF, could not
grow at all on starch but could grow on maltose and maltotriose. Thus,
if SusG by itself were degrading starch in vivo to maltose and
maltotriose, this strain should have been able to grow on starch. Data
from our assay (where amylose was the substrate) support the hypothesis that SusG hydrolyzes amylose. The fact that a susG
disruption mutant could not grow on pullulan suggests that SusG also
degrades pullulan and is thus a neopullulanase.
SusG is exposed on the cell surface. Since SusG had enzymatic activity, we wanted to determine if SusG was exposed on the cell surface. If the protein is surface exposed, enzymatic cleavage might occur on the cell surface. We tested for exposure on the cell surface by determining the protease accessibility of SusG in intact cells. After 2 h of proteinase K treatment, SusG was no longer detectable in these cells (Fig. 3). The complete degradation of SusG shows that proteinase K was able to attack SusG on the cell surface. We performed control experiments to confirm that SusG was stable in the absence of proteinase K and that proteinase K degradation of surface-exposed proteins was not destroying the outer membrane. In a control experiment where proteinase K was not added, SusG was stable throughout the course of the experiment. To confirm that the cells treated with proteinase K remained intact during the digestion period, we determined whether SusA, a periplasmic enzyme, was present at the time points where SusG was not present. According to the results of immunoblotting, SusA was present at a constant level at all time points in this experiment (Fig. 3). This confirms that we were seeing surface degradation of OMPs but not disruption of the outer membrane. In a separate experiment, to rule out the possibility that SusA was unusually resistant to proteases, we disrupted cells to release SusA and then added proteinase K. Under these conditions, SusA disappeared within 30 min after addition of proteinase K, confirming that SusA is readily degraded by proteinase K if it is accessible to the enzyme.
|
susC(pSGC23A), which produced SusG but not SusC to SusF.
In intact cells of this strain, SusG was eliminated by proteinase K
treatment after 4 h, somewhat more slowly than SusG in a wild-type
background (Fig. 3). The apparent slower disappearance is probably due
to the fact that there is more SusG in the mutant. Meanwhile, in a
control experiment, SusG was present at a constant level when
proteinase K was not added. Thus, SusG localizes to and is stable in
the outer membrane independent of the other starch-associated OMPs.
SusG exhibits very low affinity for starch and does not play a
significant role in starch binding.
We used membrane fractions
from two different mutants to determine the Km
of SusG for starch hydrolysis and compare it to that of SusA. In the
strain susB, the only membrane-associated starch-degrading enzyme present is SusA, because the polarity of the
insertion prevents the expression of SusG. In strain SAB(pSGC23A), only SusG is produced. The Km of SusG was 3.1 mM. By comparison, the Km of SusA was 0.125 mM,
almost 20 times lower than that of SusG. These results suggest that
SusG has a low affinity for starch. To test the contribution of SusG to
starch binding, we expressed SusG independently of the other OMPs. This
was achieved by placing pSGC23A in an susC background.
The susC(pSGC23A) strain produced SusA, SusB, and SusG
but not SusC, SusD, SusE, or SusF. This strain did not exhibit
significant binding above the background binding of susC
(Fig. 4). Other proteins seem to be more
directly involved in binding than SusG.
|
susG) may affect binding by these potentially closely associated starch binding proteins. We examined this possibility by
using a starch binding assay. Initially, in doing the assay that
measures binding of [14C]starch to intact cells, we
merely pelleted the cells and did not wash them because we assumed that
binding would be reversible. Subsequently, we found that most of the
[14C]starch remained associated with the cells even after
washing and was thus irreversibly bound. Since the wash step eliminated some of the variation, we used this procedure to compare mutants with
the wild type. Under the aerobic assay conditions used, there was no
uptake and metabolism of the starch. Thus, our assay should measure
only tight binding to the cell surface and not transport.
When a range of starch concentrations was tested for irreversible
binding of starch, it became clear that a susG disruption mutant (susG) bound amounts similar to those bound by the
wild type at saturating conditions of starch. Binding was saturated at
approximately 40 µg of bound starch/mg of cell protein for both
wild-type and susG strains. When SusG expression was
restored by expression in trans
[susG(pSGC23A)], starch binding was again equal to
that of the wild type (Fig. 4). It appears that lack of SusG may have
increased the KD of binding somewhat, but if so,
this difference was barely significant. SusG appears not to play a
significant role in starch binding, and its absence has little
effect on starch binding.
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Our results demonstrate that SusG plays an important role in
starch breakdown. One function is enzymatic hydrolysis of starch. There
are a number of lines of evidence supporting the hypothesis that SusG
is a starch-degrading enzyme and not just a protein that activates an
enzyme. Smith and Salyers (18) partially purified membrane-bound starch-degrading proteins by subjecting Triton X-100
extracts of B. thetaiotaomicron membranes to isoelectric focusing. SusG is the only one of the Sus OMPs that can be solubilized by Triton X-100 (15). Therefore, we would expect SusG to
have been present in these extracts. Smith and Salyers found a fraction of amylase activity with pI of 4.4 to 4.9. SusG has a predicted pI of
4.8 to 4.9, once the putative signal sequence is removed. In this
range, the enzymatic activity was low relative to the other band, now
known to be SusA, but it was still detectable. SusG has significant
sequence similarity to -amylases in the databases, is responsible
for the residual membrane-bound activity in a susA
disruption strain, and has enzyme activity when expressed independently
of the other starch-associated OMPs. Thus, based on current genetic and
previous biochemical evidence, it is reasonable to suggest that SusG
has starch-hydrolyzing activity. Another possible role for SusG is
binding of starch to the cell surface. Our results suggest, however,
that SusG makes little contribution to starch binding. If SusG has
little or no role in binding starch, the binding of starch must be
mediated by other starch OMPs which cooperate with SusG and even
enhance SusG's enzymatic activity.
The cellulosomes of clostridia and the pullulanase system of Klebsiella pneumoniae have cell-associated enzymes that degrade polysaccharides on the cell surface (3, 13). The difference between the two, aside from the outer membrane, is that the cellulosome also contains cellodextrin binding proteins which are in close proximity to the cellulases (11). As a relevant example, in Clostridium cellulolyticum, the cellulose binding domains of CipC are hypothesized to enhance hydrolysis of cellulose by keeping the substrate in a favorable position for enzymatic attack (12). This hypothesis has been difficult to test rigorously because of the lack of a genetic Clostridium system. In our system, however, we can test this hypothesis in living cells that have been genetically modified to produce only some of the proteins involved. B. thetaiotaomicron appears also to have starch binding proteins separate from the enzymes that work in concert with them to cleave the substrate and sequester the protein. Evidence presented here suggests that SusG has a very low affinity for starch, necessitating starch binding proteins to promote hydrolytic attack, which would be similar to the cellulosome's proposed mechanism of polysaccharide hydrolysis.
Taken together, results of our previous and present studies show that OMPs, including a putative porin SusC, are involved in the binding of starch to the outer membrane of B. thetaiotaomicron. Starch binding by OMPs has been shown to be an essential step for this process (2). SusG appears to act primarily as an enzyme cleaving the starch bound by those proteins to smaller oligomers which can then traverse the membrane.
| |
ACKNOWLEDGMENTS |
|---|
This study was supported by grant AI17876 from the National Institutes of Health.
We thank Nadja B. Shoemaker for constructing pNLY1::PsusA and pGERM as well as providing excellent technical advice. We also thank Jorge Frias-Lopez for superb technical advice on the proteinase K accessibility experiments.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Microbiology, University of Illinois at Urbana-Champaign, 601 South Goodwin Ave., Urbana, IL 61801. Phone: (217) 244-2938. Fax: (217) 244-6697. E-mail: jshipman{at}uiuc.edu.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
| 1. |
Anderson, K. L., and A. A. Salyers.
1989.
Biochemical evidence that starch breakdown by Bacteroides thetaiotaomicron involves outer membrane starch-binding sites and periplasmic starch-degrading enzymes.
J. Bacteriol.
171:3192-3198 |
| 2. |
Anderson, K. L., and A. A. Salyers.
1989.
Genetic evidence that outer membrane binding of starch is required for starch utilization by Bacteroides thetaiotaomicron.
J. Bacteriol.
171:3199-3204 |
| 3. | Beguin, P., and M. Lemaire. 1996. The cellulosome: an exocellular, multiprotein complex specialized in cellulose degradation. Crit. Rev. Biochem. Mol. Biol. 31:201-236[Medline]. |
| 4. |
D'elia, J. N., and A. A. Salyers.
1996.
Contribution of a neopullulanase, a pullulanase and an -glucosidase to growth of Bacteroides thetaiotaomicron on starch.
J. Bacteriol.
178:7173-7179 |
| 5. |
D'elia, J. N., and A. A. Salyers.
1996.
Effect of regulatory levels on utilization of starch by Bacteroides thetaiotaomicron.
J. Bacteriol.
178:7180-7186 |
| 6. | Hanahan, D. 1983. Studies on the transformation of Escherichia coli with plasmids. J. Mol. Biol. 166:557-580[Medline]. |
| 7. | Kanazawa, K., Y. Kobayashi, M. Nakano, M. Sakurai, N. Gotoh, and T. Nishino. 1995. Identification of three porins in the outer membrane of Bacteroides fragilis. FEMS Microbiol. Lett. 127:181-186. |
| 8. |
Lederberg, E. M., and S. M. Cohen.
1974.
Transformation of Salmonella typhimurium by plasmid deoxyribonucleic acid.
J. Bacteriol.
119:1072-1074 |
| 9. |
Lowry, O. H.,
N. J. Rosebrough,
A. L. Farr, and R. J. Randall.
1951.
Protein measurement with the Folin phenol reagent.
J. Biol. Chem.
193:265-275 |
| 10. | Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y |
| 11. |
Pages, S.,
A. Belaich,
C. Tardif,
C. Reverbel-Leroy,
C. Gaudin, and P. Belaich.
1996.
Interaction between the endoglucanase CelA and the scaffolding protein CipC of the Clostridium cellulolyticum cellulosome.
J. Bacteriol.
178:2279-2286 |
| 12. | Pages, S., L. Gal, A. Belaich, C. Gaudin, C. Tardif, and J.-P. Belaich. 1997. Role of scaffolding protein CipC of Clostridium cellulolyticum in cellulose degradation. Appl. Environ. Microbiol. 179:2810-2816. |
| 13. |
Pugsley, A. P.
1993.
The complete general secretory pathway in gram-negative bacteria.
Microbiol. Rev.
57:50-108 |
| 14. |
Reeves, A. R.,
J. N. D'elia,
J. Frias, and A. A. Salyers.
1996.
A Bacteroides thetaiotaomicron outer membrane protein that is essential for utilization of maltooligosaccharides and starch.
J. Bacteriol.
178:823-830 |
| 15. |
Reeves, A. R.,
G.-R. Wang, and A. A. Salyers.
1997.
Characterization of four outer membrane proteins that play a role in utilization of starch by Bacteroides thetaiotaomicron.
J. Bacteriol.
179:643-649 |
| 16. |
Shoemaker, N. B.,
C. Getty,
E. P. Guthrie, and A. A. Salyers.
1986.
Regions in Bacteroides plasmids pBFTM10 and pB8-51 that allow Escherichia coli-Bacteroides shuttle vectors to be mobilized by IncP plasmids and by a conjugative Bacteroides tetracycline resistance element.
J. Bacteriol.
166:959-965 |
| 17. | Shoemaker, N. B., G.-R. Wang, and A. A. Salyers. Multiple gene products and an excision required sequence (XRS) necessary for the excision of the mobilizable Bacteroides element NBU1. Submitted for publication. |
| 18. |
Smith, K. A., and A. A. Salyers.
1991.
Characterization of a neopullulanase and an -glucosidase from Bacteroides thetaiotaomicron 95-1.
J. Bacteriol.
173:2962-2968 |
| 19. |
Tancula, E.,
M. J. Feldhaus,
L. A. Bedzyk, and A. A. Salyers.
1992.
Location and characterization of genes involved in binding of starch to the surface of Bacteroides thetaiotaomicron.
J. Bacteriol.
174:5609-5616 |
| 20. |
Valentine, P., and A. A. Salyers.
1992.
Analysis of proteins associated with growth of Bacteroides ovatus on the branched galactomannan guar gum.
Appl. Environ. Microbiol.
58:1534-1540 |
Journal of Bacteriology, December 1999, p. 7206-7211, Vol. 181, No. 23
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Shim, J.-H., Park, J.-T., Hong, J.-S., Kim, K. W., Kim, M.-J., Auh, J.-H., Kim, Y.-W., Park, C.-S., Boos, W., Kim, J.-W., Park, K.-H.
(2009). Role of Maltogenic Amylase and Pullulanase in Maltodextrin and Glycogen Metabolism of Bacillus subtilis 168. J. Bacteriol.
191: 4835-4844
[Abstract] [Full Text] -
Wexler, H. M.
(2007). Bacteroides: the Good, the Bad, and the Nitty-Gritty. Clin. Microbiol. Rev.
20: 593-621
[Abstract] [Full Text] -
Xie, G., Bruce, D. C., Challacombe, J. F., Chertkov, O., Detter, J. C., Gilna, P., Han, C. S., Lucas, S., Misra, M., Myers, G. L., Richardson, P., Tapia, R., Thayer, N., Thompson, L. S., Brettin, T. S., Henrissat, B., Wilson, D. B., McBride, M. J.
(2007). Genome Sequence of the Cellulolytic Gliding Bacterium Cytophaga hutchinsonii. Appl. Environ. Microbiol.
73: 3536-3546
[Abstract] [Full Text] -
Ramsay, A. G., Scott, K. P., Martin, J. C., Rincon, M. T., Flint, H. J.
(2006). Cell-associated {alpha}-amylases of butyrate-producing Firmicute bacteria from the human colon.. Microbiology
152: 3281-3290
[Abstract] [Full Text] -
Nikaido, H.
(2003). Molecular Basis of Bacterial Outer Membrane Permeability Revisited. Microbiol. Mol. Biol. Rev.
67: 593-656
[Abstract] [Full Text] -
Cho, K. H., Cho, D., Wang, G.-R., Salyers, A. A.
(2001). New Regulatory Gene That Contributes to Control of Bacteroides thetaiotaomicron Starch Utilization Genes. J. Bacteriol.
183: 7198-7205
[Abstract] [Full Text] -
Cho, K. H., Salyers, A. A.
(2001). Biochemical Analysis of Interactions between Outer Membrane Proteins That Contribute to Starch Utilization by Bacteroides thetaiotaomicron. J. Bacteriol.
183: 7224-7230
[Abstract] [Full Text] -
Wang, J., Wang, G.-R., Shoemaker, N. B., Salyers, A. A.
(2001). Production of Two Proteins Encoded by the Bacteroides Mobilizable Transposon NBU1 Correlates with Time-Dependent Accumulation of the Excised NBU1 Circular Form. J. Bacteriol.
183: 6335-6343
[Abstract] [Full Text] -
Shipman, J. A., Berleman, J. E., Salyers, A. A.
(2000). Characterization of Four Outer Membrane Proteins Involved in Binding Starch to the Cell Surface of Bacteroides thetaiotaomicron. J. Bacteriol.
182: 5365-5372
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»