Previous Article | Next Article ![]()
Journal of Bacteriology, December 1999, p. 7274-7284, Vol. 181, No. 23
Section of Microbiology, Cornell University,
Ithaca, New York 14853-8101,1 and
Section of Microbiology, University of California, Davis,
California 95616-86652
Received 28 July 1999/Accepted 22 September 1999
Klebsiella oxytoca can assimilate nitrate and nitrite
by using enzymes encoded by the nasFEDCBA operon.
Expression of the nasF operon is controlled by general
nitrogen regulation (Ntr) via the NtrC transcription activator and by
pathway-specific nitrate and nitrite induction via the NasR
transcription antiterminator. This paper reports our analysis of
nasR gene expression. We constructed strains bearing
single-copy Klebsiella spp., members
of the family Enterobacteriaceae, can use nitrate
(NO3 Molecular genetic analysis of K. oxytoca
(pneumoniae) M5al has identified the nasFEDCBA
operon required for nitrate and nitrite assimilation. The
nasFED genes encode a periplasmic binding protein-dependent nitrate and nitrite transporter (64). The nasCA
genes encode assimilatory nitrate reductase, and the nasB
gene encodes assimilatory nitrite reductase (28, 29). The
nasR gene, located immediately upstream of nasF,
encodes a nitrate- and nitrite-responsive positive regulator for
nasF operon expression (19). Expression of the nasF operon is controlled by general nitrogen regulation
(Ntr) via the NtrC transcription activator (reviewed in reference
31) and by pathway-specific nitrate and nitrite
induction via the NasR transcription antiterminator (8, 9,
30). The regulation of nasR gene expression has not
previously been examined.
Ntr control in enterobacteria has been extensively studied (reviewed in
references 34, 38, 44, and 48).
Genes required for Ntr control include rpoN (also called
ntrA and glnF), which encodes the sigma
factor The DNA binding sites for phospho-NtrC are located 100 bp or more
upstream of the transcription initiation site and thereby constitute
upstream activation sequences (UAS) or enhancers. The best-studied
examples are those for the Escherichia coli and
Salmonella typhimurium glnA-ntrBC operon, encoding glutamine
synthetase along with NtrB and NtrC, and the K. oxytoca
(pneumoniae) nifLA operon, encoding the
regulators of dinitrogen fixation (nif) gene expression (41, 45, 50, 63). Formation of a DNA loop facilitates contact between upstream-bound phospho-NtrC and E In enterobacteria, some Ntr-regulated operons are controlled only
indirectly by phospho-NtrC. Rather, the Nac protein activates the
expression of In this paper, we describe a system for integrating single-copy
constructs into the chromosomal rhaBAD-rhaSR locus of
K. oxytoca M5al and illustrate its use in the analysis of
Strains and plasmids.
The strains and plasmids used in this
work are listed in Table 1.
Aerobacter aerogenes M5al was reclassified as K. pneumoniae (61). However, its phenotypic properties
(such as a positive reaction in the indole test) place this strain in
the species K. oxytoca. Genetic crosses were performed by
bacteriophage P1 kc-mediated transduction (39,
60). Standard methods were used for restriction endonuclease
digestion, ligation, and transformation of DNA (35).
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
General Nitrogen Regulation of Nitrate Assimilation
Regulatory Gene nasR Expression in Klebsiella
oxytoca M5al


![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
(nasR-lacZ) operon fusions within the
chromosomal rhaBAD-rhaSR locus. The expression of
rhaBS::[
(nasR-lacZ)] operon
fusions was induced about 10-fold during nitrogen-limited growth.
Induction was reduced in both ntrC and rpoN
null mutants, indicating that Ntr control of nasR gene
expression requires the NtrC and
N (
54)
proteins. Sequence inspection of the nasR control region
reveals an apparent
N-dependent promoter but no apparent
NtrC protein binding sites. Analysis of site-specific mutations coupled
with primer extension analysis authenticated the
N-dependent nasR promoter. Fusion constructs
with only about 70 nucleotides (nt) upstream of the transcription
initiation site exhibited patterns of
-galactosidase expression
indistinguishable from
(nasR-lacZ) constructs with about
470 nt upstream. Expression was independent of the Nac protein,
implying that NtrC is a direct activator of nasR
transcription. Together, these results indicate that nasR
gene expression does not require specific upstream NtrC-binding sequences, as previously noted for argT gene expression in
Salmonella typhimurium (G. Schmitz, K. Nikaido, and G. F.-L. Ames, Mol. Gen. Genet. 215:107-117, 1988).
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
) and nitrite
(NO2
) as sole nitrogen sources during aerobic
growth. Nitrate and nitrite are reduced to ammonium by assimilatory
nitrate and nitrite reductases, respectively (reviewed in reference
31). The resulting ammonium is incorporated into
central metabolism through the action of glutamine synthetase and
glutamate synthase (reviewed in reference 49).
N (
54); ntrC (also
called glnG), which encodes the enhancer binding transcription activator NtrC; and ntrB (also called
glnL), which encodes the protein kinase/phosphoprotein
phosphatase (NtrB) that controls NtrC activity. Promoters recognized by
N-RNA polymerase (E
N) contain GG and GC
at 24 and 12 bp, respectively, upstream of the transcription initiation
site (reviewed in reference 36). The activity of the
NtrB protein is controlled in response to internal nitrogen such that
the phosphorylation state of the NtrC protein is elevated during
nitrogen-limited growth (22, 24). Phosphorylation stimulates
transcription activation by NtrC (reviewed in references
34 and 48).
N to
activate transcription initiation (reviewed in references 34 and 48). Binding to the UAS or
enhancer increases the local concentration of phospho-NtrC.
Nevertheless, NtrC can significantly stimulate transcription, even for
constructs in which the NtrC binding sites have been deleted (14,
46, 50, 53). Indeed, no upstream binding sites have been
identified for NtrC-dependent activation of the S. typhimurium
argT gene, encoding the periplasmic lysine-arginine-ornithine
binding protein (52).
70-dependent operons such as
hut (histidine utilization) and put (proline
utilization) (10, 23, 32). Expression of the nac gene itself is activated by phospho-NtrC during nitrogen-limited growth
(18, 54). However, nasF operon expression is
independent of nac+ (19, 32).
(nasR-lacZ) operon fusions. We demonstrate that
nasR gene expression is subject to Ntr control, requires a
N-dependent promoter, and is independent of
nac+. Deletion analysis revealed that the
regulatory elements for nasR expression lie within 71 bp of
the transcription initiation site.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
TABLE 1.
Strains and plasmids used in this study
Culture media.
Defined, complex, and indicator media for
genetic manipulations were used as described previously
(35). Nitrogen-free medium contained 0.2% (wt/vol) glucose,
1% (wt/vol) sodium citrate, 0.74% (wt/vol) sodium phosphate (pH 8),
and 1 mM MgSO4 (28). This medium was
supplemented with additional nitrogen sources (5 mM NaNO3,
NaNO2, or NH4Cl) as indicated to test nitrogen
utilization phenotypes. Alanyl-glutamine (5 mM) was added to all solid
media used for cultivation of rpoN (Gln
) and
ntrC strains (11).
-galactosidase assays was
buffered with 3-(N-morpholino) propanesulfonic acid (MOPS) as previously described (58). The initial pH of this medium was adjusted with NaOH to 8.0. Glucose (40 mM) was used as the sole
carbon source. The nitrogen sources NaNO3,
NaNO2, NH4Cl, and L-glutamine were
each added to 5 mM as indicated. Arginine, hypoxanthine, thiamine, and
uracil were added to stimulate the growth of rpoN strains
(26). For induction of tac-nac expression, 1 mM
isopropyl-
-D-thiogalactopyranoside (IPTG) was added very early in the exponential phase (about 15 Klett units
[54]).
Culture conditions.
Cultures for
-galactosidase assays
were grown at 30°C to minimize deamidation of glutamine
(4). Culture densities were monitored with a Klett-Summerson
photoelectric colorimeter (Klett Manufacturing Co., New York, N.Y.)
equipped with a no. 66 (red) filter. Cultures were aerated at 240 rpm
in 10 ml of medium in 125-ml sidearm flasks. Cultures in the
mid-exponential phase (about 40 Klett units) were harvested, chilled on
ice, and washed with saline. Cell pellets were stored overnight at
20°C, prior to assay for
-galactosidase activity.
-Galactosidase assays.
-Galactosidase assays were done
at room temperature, approximately 21°C. Cell pellets were suspended
in 4 ml of Z buffer (39) and stored on ice.
-Galactosidase activity was measured in CHCl3-sodium
dodecyl sulfate-permeabilized cells by monitoring the hydrolysis of
o-nitrophenyl-
-D-galactopyranoside.
Activities are expressed in terms of cell density (absorbance at 600 nm), using the formula of Miller (39). All reported values
are averages from at least three independent experiments.
DNA sequencing. Double-stranded templates were sequenced on a model 373A stretch DNA sequencer by using dye terminator chemistry and AmpliTaq-FS DNA polymerase (Perkin Elmer/Applied Biosystems Division, Foster City, Calif.). Templates were prepared by using QIAprep spin plasmid kits (Qiagen Inc., Chatsworth, Calif.). DNA sequences were analyzed with programs from DNASTAR Inc. (Madison, Wis.), and database searches were performed with the BLAST programs (1) accessed through the National Center for Biotechnology Information.
DNA oligonucleotides.
In the following sequence, nucleotide
substitutions for site-specific mutagenesis are underlined, added
nucleotide tails are in lower case, and introduced restriction
endonuclease sites are in boldface. Sequences are presented from 5' to
3'. The nucleotide sequences of oligonucleotides used for site-specific
mutagenesis were
24G
A, TCCTTCTATAAGACACGGTTATTGC;
13/
12GC
AT,
TCCTTCTATAAGGCACGGTTATTATTTGGCTGAAGTATAAAGCGTTAA;
29/
28 AT
GC,
TAAGGACTCCTTCTGCAAGGCACGGTTATT;
+36/+38ATG
TAA, GGAGAGGGGTATGAATAATTAAGCGGGCAATACGCCTGAGGT. The
nucleotide sequences of oligonucleotides used for construction of
lacZ fusions were RZF1 (fusion starting from
469),
ttagtcggatccGCTTTCAGCTGGCATTGT; RZF2 (fusion
starting from
71), taactggatcCCGTTCGCGATAATCACAAT; RZF3 (fusion ending at +71),
tggctgtctagaAAACCAGTCGACCACCTCAG; RZF4 (fusion
starting from
14), taactggatccTGCTTGGCTGAAGTATAAA; and RZF5 (fusion ending at +362),
tggctgtctagaCGCAAGCTGGGGCAGATA. The nucleotide
sequences of oligonucleotides used for colony PCR analysis were C1,
CCTGACGCGGGCGCATTTACA; B2, GTCCGGCTCATCGCTGTTCACG; RB1, AATTTCATTTTCAGGATTAGG; and LZ1,
GCGAATGACCTTGAGTTTGTC. The nucleotide sequences of
oligonucleotides used for loop deletion mutagenesis were
nasC
(95-343),
GAAACGGTTACCGCGGTGGATATGCATCCGCTGGACCGCCACTACCGT; and nasB
(86-713),
CGCCTGAGCGAATCGGTCGCCAGCATGCATGCCGACCTGTTCGCCAGCGAT. The nucleotide sequence of the oligonucleotide used for
primer extension was TGCCTGCAGGTCGACTCTAGAAAACCAGT.
Site-specific mutagenesis. Oligonucleotide-directed site-specific mutagenesis was performed by ampicillin selection as described previously (27, 35). The DNA sequence of each mutant insert was determined to confirm the mutational alterations and to ensure that no spurious changes were introduced.
PCR.
PCR-generated DNA fragments from the nasR
control region were amplified (51) from plasmid pVJS2502.
BamHI and XbaI sites were introduced into the
upstream and downstream primers, respectively, for subsequent cloning
to construct
(nasR-lacZ) fusions. Different pairs of
primers resulted in different fusions; for example, primers RZF1 and
RZF3 were used to construct the
(nasR-lacZ)
{
469/+71} fusion, whereas primers RZF2 and RZF3 were used to
construct the
(nasR-lacZ) {
71/+71} fusion (Fig.
1). (Fusions are designated by their
upstream and downstream junctions relative to the transcription initiation site [Fig. 1].)
|
Electrotransformation. A K. oxytoca culture (50 ml) was grown at 37°C in a 250-ml sidearm flask and harvested in the early exponential phase (about 25 to 30 Klett units). The cell pellet was washed three times with 1 M glycerol and then resuspended in 200 µl of 1 M glycerol. A 2- to 5-µl volume of plasmid DNA (100 ng/µl) was mixed with 40 µl of glycerol-washed cells in a 1.5-ml microcentrifuge tube and incubated on ice for 5 min. This mixture was pipetted into a precooled 0.2-cm electroporation cuvette and electroporated at 2.5 kV with an E. coli Pulser electrotransformation apparatus (Bio-Rad, Hercules, Calif.). After the pulse, 1 ml of TY broth (0.8% tryptone, 0.5% yeast extract, 0.5% NaCl) was immediately added to the cuvette, and the cell suspension was quickly transferred into a 1.5-ml microcentrifuge tube and incubated at 30°C for 1 h prior to plating on selective medium.
Construction of plasmid-borne
(nasR-lacZ) and
(nasF-lacZ) operon fusions.
Plasmid pRS415
(56), with the pBR322 replication origin, served as the
vector. The downstream junction was the BamHI site near the
end of MudK #7 (29), which is inserted into codon 304 of
nasR. The upstream cloning site was the
HindIII site distal to ychN, located 471 nucleotides (nt) upstream of the nasR transcription initiation site (Fig. 1). Recloning into a polylinker plasmid placed
this HindIII site adjacent to an EcoRI site,
which was used for cloning into plasmid pRS415. This formed the
(nasR-lacZ) {
471/+910} operon fusion (Fig. 1). A
second plasmid was constructed by joining the NruI site,
just upstream of nasR, to the SmaI cloning site
in plasmid pRS415. This formed the
(nasR-lacZ)
{
64/+911} operon fusion.
(nasF-lacZ) fusions (30) were constructed
similarly, except that the downstream junction was the BamHI
site near the end of MudK #34, which is inserted into codon 53 of
nasF.
Construction of plasmid-borne
(nasR'-'lacZ) gene
(translational) fusions.
Plasmid pNM481 (42), with the
pBR322 replication origin, served as the vector. PCR-generated
nasR inserts, described above, were cloned into plasmid
pALTER-1 for sequence analysis and for site-specific mutagenesis. This
cloning placed the downstream XbaI site next to the
polylinker HindIII site. Therefore, these inserts were
cloned as BamHI-HindIII fragments into
plasmid pNM481.
Construction of the rha integration plasmid.
The
vector pVJS2354, used for integrating lacZ operon fusion
constructs into the chromosomal rhaBAD-rhaSR locus, is based on the allelic-exchange vector pKAS46 (57). Plasmid pKAS46
contains the R6K replication origin and therefore requires the
protein (product of the pir gene) for replication. It also
contains the rpsL+ gene, allowing for the
selection (in an rpsL strain background) of plasmid-free
segregants as Smr colonies (57). We have
previously used plasmid pKAS46 to construct several allelic-replacement
strains of K. oxytoca (64).
TXF97
(59) was cloned into the EcoRI site, resulting in
plasmid pVJS2354.
Construction of chromosomal
rhaBS::[
(nasR-lacZ)] operon
fusions.
Derivatives of plasmid pVJS2354 containing different
nasR upstream regions were constructed by cloning the
PCR-generated nasR inserts described above. Plasmids were
electrotransformed into strain VJSK2216 or derivatives with selection
for Kmr. Integrants (Kmr Sms
Rha+) were streaked on MacConkey-rhamnose-streptomycin
agar, and segregants (Kms Smr
Rha
) were colony purified. The veracity of the resulting
rhaBS::[
(nasR-lacZ)] allelic
replacements was confirmed by colony PCR analysis with primers RB1
(rhaB-rhaA intergenic region) and LZ1 (lacZ) as
previously described (64).
Construction of the
(nasCB) deletion mutant.
Loop deletion mutagenesis and allelic exchange of the
(nasCB)139 deletion into the chromosome of
K. oxytoca were performed essentially as described
previously (64). The deletion
(nasCB)139 was constructed on plasmid pVJS2520
by adding two oligonucleotides (for
nasC, deleting codons
95 through 343, and for
nasB, deleting codons 86 through
713) to a single mutagenesis reaction. The double-deletion
nasC and
nasB was isolated and subjected to
NsiI reduction to generate
(nasCB)139. All deletions are in frame.
Oligonucleotide primers C1 and B2 were used for colony PCR to confirm
the veracity of the allelic exchanges as described previously
(64).
Primer extension. Total RNA was isolated from K. oxytoca VJSK2507 by using the RNeasy method (Qiagen Inc.). Cultures were grown in 20 ml of 10 mM MOPS-glutamine medium in a 250-ml sidearm flask. The cultures were harvested in the latter part of the exponential phase (approximately 60 Klett units).
To determine the 5' end of nasR RNA, a 29-bp oligonucleotide complementary to the fusion junction was first end labeled with [
-32P]ATP (Amersham Life Science Inc., Arlington
Heights, Ill.) by using T4 polynucleotide kinase (New England Biolabs,
Inc., Beverly, Mass.) and then annealed to approximately 40 µg of
isolated RNA. Primer extension reactions with avian myeloblastosis
virus reverse transcriptase (Promega Corp.) were performed by the
method of Kingston (25). The DNA sequence ladder was
generated by using plasmid pVJS2595 as the DNA template and the same
oligonucleotide as primer.
Nucleotide sequence accession number. The DNA sequence reported in this paper has been deposited in the GenBank nucleotide sequence database under accession no. L27824.
| |
RESULTS |
|---|
|
|
|---|
The nasR upstream sequence. We previously reported the sequence of the nasR structural gene (19). For this study, the DNA sequence of the nasR upstream region was determined on both strands. A 354-bp hypothetical ychN gene lies in the opposite orientation to the nasR gene (Fig. 2). The ychN initiation codon is located 68 bp upstream of the assigned nasR initiation codon (see below). The deduced amino acid sequence of the K. oxytoca YchN protein is 88% identical to that of the E. coli YchN protein (5). The function of the YchN protein is unknown.
|
N-dependent promoter lies just upstream of
the nasR initiation codon (Fig. 2). However, potential sites
for binding phospho-NtrC protein (half-site consensus TGCACCA;
reviewed in reference 34) are not evident
(Fig. 2). Below we present experimental evidence that confirms the
identity of this promoter and that also permits us to assign the
transcription initiation site to nucleotide position +1 (Fig. 2). All
nucleotide coordinates described in this paper are therefore in
relation to position +1.
Analysis of plasmid-borne
(nasR-lacZ) operon
fusions.
Finding the presumptive
N-dependent
promoter sequence suggested that nasR gene expression is
controlled by Ntr. To evaluate this possibility, we constructed the
(nasR-lacZ) {
471/+910} operon (transcriptional)
fusion containing DNA from 471 nt upstream to 910 nt downstream of the
transcription initiation site (Fig. 1; see Materials and Methods). We
also constructed a derivative containing DNA from only 64 nt upstream
to 910 nt downstream, with the goal of determining if phospho-NtrC
binding sites lie upstream of position
64. Both plasmids were
introduced into ntr+, ntrC null, and
rpoN null strains of K. oxytoca. Cultures were grown in defined medium supplemented with the nitrogen sources glutamine (nitrogen limiting) or glutamine plus ammonium (nitrogen excess), and assayed for
-galactosidase specific activity.
(nasR-lacZ) {
471/+910} operon
fusion was induced between 5- and 20-fold by nitrogen limitation, and
this induction required ntrC+ (Table
2) (15). Surprisingly,
expression of the
(nasR-lacZ) {
64/+910} fusion was
indistinguishable from expression of the
(nasR-lacZ)
{
471/+910} fusion. Expression of both fusions required ntrC+ (Table 2) and rpoN+
(15), as expected.
|
-galactosidase specific activity
expressed from two previously characterized plasmid-borne
(nasF-lacZ) operon fusions (30). The
(nasF-lacZ) {
141/+277} fusion contains the upstream
phospho-NtrC binding sites, whereas these sites are deleted from the
(nasF-lacZ) {
38/+277} fusion. As expected, the
construct containing 141 bp upstream of the transcription initiation
site directed an approximately 10-fold induction in
-galactosidase
activity in response to nitrogen limitation whereas the construct
containing only 38 bp upstream directed only a 3-fold increase. Again,
induction required both ntrC+ and
rpoN+ (15).
These results indicated that nasR gene expression is subject
to Ntr control and that sequences upstream of position
64 are dispensable for this regulation. However,
-galactosidase activities measured from plasmid-borne fusions exhibited significant differences in independent experiments, perhaps due in part to variations in
plasmid copy number. Therefore, we elected to conduct further analysis
with chromosomal monocopy
(nasR-lacZ) operon fusion constructs.
System for construction of monocopy lacZ operon
fusions.
Our laboratory routinely uses bacteriophage
specialized transduction for constructing single-copy lacZ
operon fusions in Escherichia coli (56). However,
we have been unsuccessful in our efforts to adapt bacteriophage
for
use with K. oxytoca M5al. We therefore elected to follow the
strategy of Shimotsu and Henner (55), who used the
amyE gene of Bacillus subtilis as a target for
integration, via homologous recombination, of fusion constructs into
the chromosome. Two considerations guided our scheme. The first was to
use as the target a locus involved in sugar catabolism, so that we
could readily screen colonies arising from allelic replacements by
virtue of their fermentation-negative phenotype. The second was to
embed the fusion constructs between divergently transcribed genes to
help insulate them from exogenous promoters (16). The
ara and rha operons of enterobacteria satisfy
both of these criteria. K. oxytoca M5al is Ara
Rha+, and so we cloned and analyzed its
rhaBAD-rhaSR-rhaT locus as described in Materials and Methods.
,
Kmr transformants arise only from integration of the
plasmid into the chromosome. The rha locus homology ensures
that most integrations will occur at rha (Fig. 3).
Integration by recombination within rhaR yields an intact
rhaBAD-rhaSR locus (Rha+ phenotype), whereas
integration by recombination within rhaA serves to separate
rhaD from the upstream rhaB promoter
(43). Thus, integration within rhaA is expected
to yield the Rha
phenotype (Fig. 3). In practice,
however, we have observed that virtually all integrants are
Rha+.
|
(nasR-lacZ) construct had replaced the rhaB
and rhaS genes, were thus readily identified as
Smr Rha
colonies (see Materials and Methods).
Candidates were tested for the Lac+ and Kms
phenotype, and then two independent isolates were subjected to colony
PCR analysis to verify the structure of the
rhaBS::[
(nasR-lacZ)] allelic
replacement as described in Materials and Methods (data not shown).
Analysis of monocopy
rhaBS::[
(nasR-lacZ)] operon
fusions.
We constructed four different
rhaBS::
[(nasR-lacZ)] operon
fusions (Fig. 1), with different amounts of upstream and downstream sequence, in order to localize the nasR regulatory elements.
We monitored the expression of these fusions by measuring
-galactosidase activities from cultures grown in defined medium with
limiting or excess nitrogen. The results are shown in Table
3.
|
(nasR-lacZ) constructs (
469/+71,
71/+71, and
71/+362) exhibited indistinguishable patterns of
-galactosidase
synthesis: each was induced about 10-fold by nitrogen limitation (Table
3). This delimits the region extending from positions
71 to +71 as containing all necessary information for Ntr-controlled nasR
expression. The fourth
(nasR-lacZ) construct (
14/+362)
was expressed at a low unregulated level, indicating that the promoter
is deleted from this cloned insert, as expected (see also below). Both
ntrC+ and rpoN+ were
required for Ntr-regulated expression of the monocopy constructs,
(nasR-lacZ) {
469/+71} (Table
4) and
(nasR-lacZ)
{
71/+71} (data not shown), congruent with results from the
analogous plasmid-borne fusions (Table 2).
|
Transcription initiation.
To confirm the
24/
12 element as
the
N-dependent nasR promoter, we constructed
two different site-specific mutants: one with G at position
24
changed to A, and one with GC at positions
13 and
12 changed to AT
(Fig. 2). We constructed
rhaBS::[
(nasR-lacZ) {
469/+71}] operon fusions bearing these alterations and
monitored their expression by measuring
-galactosidase activities
from cultures grown in defined medium with limiting or excess nitrogen. The results are shown in Table 4. The changes at
24 and at
13/
12 both virtually abolished expression. These results establish the
24/
12 sequence identified by sequence inspection as the
nasR promoter.
rhaBS::[
(nasR-lacZ) {
469/+71}] operon fusion. Cultures were grown aerobically in defined medium with limiting nitrogen. The products of reverse transcriptase extension from a primer complementary to sequence spanning the nasR-lacZ fusion junction were resolved by gel
electrophoresis and visualized by radioautography (Fig.
4). The significant background resulted
from the overexposure required to detect the signal from a single copy
of a weakly expressed gene. Nevertheless, the predominant band
corresponded to a 92-bp cDNA (Fig. 4). This band aligns with a T in the
sequence ladder that corresponds to the A residue at position +1 in the
nasR coding strand, appropriately spaced from the
24/
12
promoter (Fig. 2; see above).
|
Nac protein is not required for nasR gene
expression.
Work with K. aerogenes has demonstrated
that expression of certain nitrogen-regulated operons, such as
hut and put, requires the nac gene
product in addition to a functional Ntr system (reviewed in reference
3). The nac gene, which is under positive
regulation by Ntr, encodes a LysR family regulator that couples Ntr
regulation to target
70-dependent operons. Although the
results summarized above establish that the nasR gene is
expressed from a
N-dependent promoter, the absence of
essential regulatory sites upstream of position
71 (i.e., an
enhancer) directed us to evaluate an alternative hypothesis, namely,
that the Nac protein mediates Ntr control of nasR gene expression.
(nasC-lacZ) operon fusion is expressed normally in K. aerogenes (19), demonstrating that
K. aerogenes contains nasR+. Thus,
K. aerogenes provides an appropriate surrogate strain for
examining the Nac dependence of K. oxytoca nasR gene expression.
Plasmid pVJS3004, carrying the
(nasR-lacZ)
{
469/+71} gene (translational) fusion, was used to monitor
nasR gene expression. Plasmid pV16, which contains a
(hutU-lacZ) operon fusion, provided a control for Nac
function (47). We monitored the expression of these fusions
by measuring
-galactosidase activities from cultures grown in
defined medium with limiting or excess nitrogen. The results are shown
in Table 5.
|
(hutU-lacZ) expression was indifferent to the
nitrogen source whereas
(nasR-lacZ) expression remained
nitrogen responsive (Table 5). Finally, an ntrC null allele
abolished
(nasR-lacZ) expression in the
nac::Tn5 tac strain, whereas
(hutU-lacZ) expression was little affected. These results
establish that nitrogen-regulated nasR gene expression is
independent of the Nac protein.
Mutational analysis indicates that the sequence ATA-N9-TAT,
centered at
64, is an important element of Nac DNA binding sites (10, 20, 47). That sequence is also present in the
nasR control region, centered at
22 and thereby
overlapping the promoter sequence (Fig. 2). We therefore constructed a
site-specific mutant changing AT at positions
29 and
28 to GC,
thereby significantly damaging the upstream ATA element while leaving
the promoter elements intact (Fig. 2). However, this double change had
no discernible effect on
(nasR-lacZ) expression (Table
5). This result reinforces the above conclusion, i.e., that
nasR gene expression is Nac independent.
Translation initiation. Previous sequence analysis revealed the presumed nasR translation initiation region, as indicated in Fig. 2, where the presumed Shine-Dalgarno region and two potential initiation codons (encoding Met-1 and Met-4, as shown) are underlined (19). However, we had no direct evidence to show that nasR translation initiates at one of these ATG codons rather than further downstream (for example, the underlined GTG codon for Val-11). We wished to more precisely localize the start of nasR translation, in order to provide a context for evaluating transcriptional regulatory signals.
To determine if either ATG codon serves in initiating translation, we first constructed a plasmid-borne
(nasR'-'lacZ)
{
469/+71} gene (translational) fusion (Fig. 1; see Materials and
Methods), in which the synthesis of the active NasR-LacZ fusion protein is directed by nasR translation initiation signals. The
cloned insert results in the in-frame fusion of the nasR
codon for Phe-15 to lacZ codon 9. (Ten additional codons
derived from polylinker sequence were introduced at the fusion
junction.) We also constructed a site-specific mutant in which the
second ATG codon, at nucleotides 36 to 38, was changed to ochre (TAA;
Fig. 2). Both plasmids were introduced into K. oxytoca, and
-galactosidase specific activity was measured after growth in
defined medium with limiting nitrogen. Whereas the wild-type fusion
expressed about 230 Miller units, activity from the ochre fusion was
negligible (about 1.5 Miller units).
The high activity expressed from the wild-type plasmid establishes the
nasR translation initiation site as being located upstream of nucleotides 69 to 71 (codon 15). The very low activity expressed from the ochre (nt 36 to 38) mutant shows that translation initiates either at this second ATG or further upstream. Based on spacing from
the Shine-Dalgarno sequence, we assign the first ATG (+27 to +29) as
the likely nasR initiation codon. Irrespective of which ATG
is the initiator, the short untranslated leader region seemingly presents an insufficient target for either antitermination or translational autoregulation by NasR protein.
Effects of nitrate and nitrite on nasR gene
expression.
The NasR protein is a nitrate- and nitrite-responsive
regulator of nasF operon transcription antitermination. To
determine whether nasR gene expression is autoregulated, we
examined the effects of nitrate and nitrite on expression of the
rhaBS::[
(nasR-lacZ) {
469/+71}] operon fusion. Indeed, nasR gene
expression was decreased by about threefold during growth with nitrate
and nitrite (Table 6). A nasR
null allele abolished this nitrate- and nitrite-dependent inhibition
while having no effect on Ntr-dependent ammonium inhibition (Table 6).
On their face, these results could suggest that the NasR protein is a
weak negative regulator of nasR gene expression.
|
(nasFED) deletion
eliminates the nitrate and nitrite uptake system, without affecting the
expression of nasCBA genes encoding assimilatory nitrate and
nitrite reductases (64). The strain carrying this deletion
exhibited nitrate-insensitive nasR gene expression, although
nitrite inhibition was unaffected (Table 6). In fact, nitrite is
efficiently transported by a second, uncharacterized pathway in
nasFED mutants (under the growth conditions used
[64]), and so this result indicates that nitrate must
be transported to exert its inhibitory effect on nasR gene expression.
The
(nasCB) deletion eliminates assimilatory nitrate and
nitrite reductase activities while leaving the
nasFED-encoded transport system intact. The strain carrying
this deletion exhibited nitrate- and nitrite-insensitive
nasR gene expression (Table 6), indicating that nitrate and
nitrite must be converted to ammonium to exert their inhibitory effect
on nasR gene expression. Finally, the nasD::
insertion eliminates both nitrate
transport (through inactivation of the nasD gene
[64]) as well as assimilatory nitrate and nitrite reductase activities (through strong polarity on nasCBA
expression [29]). Again, nitrate- and
nitrite-dependent inhibition of nasR gene expression was
abolished in this strain. Together, these results indicate not that
NasR is a negative regulator of nasR gene expression but,
rather, that nitrate and nitrite conversion to ammonium influences Ntr
regulation sufficiently to measurably decrease nasR gene
expression. [We do not understand why nitrate caused an approximately
twofold increase in
(nasR-lacZ) expression in the various
nas mutants (Table 6).]
| |
DISCUSSION |
|---|
|
|
|---|
K. oxytoca (pneumoniae) M5al is a
genetically amenable enterobacterium that has been widely used for
studies of dinitrogen fixation and Ntr (60). Previous
studies have shown that nasF (nitrate assimilation) operon
expression is subject to dual regulation: phospho-NtrC-dependent
activation of a
N-dependent promoter, and NasR-dependent
nitrate- and nitrite-responsive transcription antitermination (8,
9, 30). We report here our analysis of nasR gene
regulation. We found that nasR gene expression was modulated
about 10-fold by Ntr. This regulation required a
N-dependent promoter and the
ntrC+ gene and was independent of the
nac+ gene. However, deletion of upstream
sequences had no discernible effect on
ntrC+-dependent stimulation of
(nasR-lacZ) expression. Thus, like the S. typhimurium argT promoter (2, 52), the nasR
promoter may not require an upstream binding site for full-level NtrC activation.
The nasR promoter.
Sequence inspection identified
the critical elements of a
N-dependent promoter
GG
and GC
upstream of the nasR coding region (Fig. 2).
Site-specific changes at
24 and at
12 plus
13 both virtually
abolished
(nasR-lacZ) expression, as did introduction of
an rpoN null allele (Table 4; rpoN encodes
N). A deletion to
14 likewise eliminated
(nasR-lacZ) expression (Table 3), demonstrating that no
other promoters lie between
14 and +362 (Fig. 1). Primer extension
analysis provided independent support for these conclusions (Fig. 4).
Therefore, nasR gene expression is controlled by a single
N-dependent promoter.
24 GG and
12 GC elements are critical for
N-dependent promoter function, nucleotides surrounding
the
12 sequence also contribute to promoter function and activation
(reviewed in references 34 and
36). One example comes from study of the
NifA-activated K. oxytoca nifH promoter. Transcription from a mutant promoter, changed from the wild-type CCCTGC to
TTTTGC, is much less dependent on NifA binding to the UAS,
perhaps due to increased affinity for
N (6,
7). Note that the corresponding region of the nasR promoter, TATTGC, is also T rich (Fig. 2). Nevertheless, it
is not yet possible to predict reliably the
N-dependent
promoter function from sequence inspection alone (62).
The Nac protein does not control nasR expression.
One mechanism for controlling nitrogen-regulated gene expression
involves the Nac protein, which is known to activate only
70-dependent promoters (3). However,
(nasR-lacZ) expression was indifferent to
nac+ in K. aerogenes W70 (Table 5).
Site-specific mutational analysis further demonstrated that a sequence
(ATA-N9-TAT [Fig. 2]) that might be construed as a Nac
protein binding site (10, 20, 47) was irrelevant for
nasR gene control (Table 5). Therefore, Ntr control of
nasR gene expression does not involve the Nac protein.
How does phospho-NtrC protein activate nasR gene
expression?
The only other known mechanism for nitrogen-regulated
gene expression in enterobacteria involves phospho-NtrC protein, which activates transcription initiation at
N-dependent
promoters (reviewed in references 34, 38, 44, and
48). For most of these, including the well-studied
glnA, nifL, and glnH promoters,
activation is stimulated by phospho-NtrC binding to upstream sites, the
proximal boundaries of which are located 70 to 100 bp upstream of the
24 GG element.
300 failed to reveal even
a single 17-mer with fewer than 7 of 14 mismatches (Fig. 2).
Furthermore, deletions to positions
64 and
71 had no influence on
(nasR-lacZ) expression (Tables 2 and 3). Thus, any
upstream NtrC binding site must have its distal boundary no more than
39 bp upstream of the
24 GG element (Fig. 2); the proximal boundary
of such a 17-mer would be at position
47. Such a location is
unprecedented. Additionally, any NtrC binding sites in this region
would overlap with the beginning of the ychN gene (Fig. 2),
which, unlike the nasRFEDCBA region, is conserved in
E. coli K-12 (5). Finally, any downstream NtrC
binding site must have its distal boundary upstream of +71.
Nonetheless, nasR gene expression was fully dependent upon
ntrC+, even in fusion constructs with only 64 or
71 nt upstream of the transcription initiation site (Table 2 and data
not shown). (The residual twofold nitrogen regulation in
ntrC null strains is an unexplained peculiarity of
Klebsiella spp. [32].)
These observations mimic those made by Schmitz et al., who found that
Ntr control of argT gene expression operates through a
N-dependent promoter (52). Further analysis
demonstrated that sequences within 44 bp of the transcription
initiation site are sufficient to confer essentially wild-type Ntr
control
about fivefold
on expression of
(argT-galK)
operon fusions. Furthermore, NtrC protein failed to protect
argT control region DNA from DNase I digestion under
conditions where the glnA, ntrBC, and
dhuA NtrC binding sites were well protected (2).
Together, these results indicate that argT gene expression
is independent of upstream or downstream NtrC binding sites.
Although stimulatory, upstream binding sites are not essential for
phospho-NtrC activation of the glnA or nifLA
promoters (53). Expression of single- or low-copy
(glnA-lacZ) operon fusion constructs during
nitrogen-limited growth is reduced by 10-fold or less upon deletion of
the upstream binding sites, whereas introduction of an ntrC
null allele reduces expression by about 100-fold (12, 50).
Likewise,
(nifL-lacZ) expression is reduced but not
eliminated upon deletion of the upstream binding sites (14,
40). Thus, significant phospho-NtrC-dependent transcription activation can occur even without specific DNA binding sites
(46).
Schneider et al. suggested that "minimal" Ntr-controlled promoters
with no NtrC binding sites (such as the argT promoter) may
allow differentially regulated gene expression, perhaps in response to
different nitrogen sources (53). Presumably, phospho-NtrC activation of these promoters results from nonspecific binding to DNA
(46). It would be tempting to speculate that the nucleotide sequences of these minimal promoters provide sufficient activation in
the absence of activator binding sites (see above). However, the
S. typhimurium argT and K. oxytoca nasR promoters
exhibit little sequence similarity aside from the conserved
24 and
12 elements. Evaluating this and other ideas will require further investigation.
Ntr control of nitrate assimilation. Manifestation of the nitrate assimilation phenotype involves at least two targets for Ntr control (Fig. 5). The first target is expression of the nasF structural gene operon, which is controlled by phospho-NtrC binding to a conventional upstream sequence (30). The second target is expression of the nasR regulatory gene, also apparently controlled by phospho-NtrC albeit in an unconventional manner. Thus, growth under nitrogen-sufficient conditions serves to dampen nasF operon expression both directly (by decreasing Ntr activation of the nasF promoter) and indirectly (by decreasing synthesis of the NasR regulatory protein) (Fig. 5).
|
Effect of nitrate and nitrite on nasR gene
expression.
Both nitrate and nitrite decreased
(nasR-lacZ) expression only in
nasR+ strains (Table 6). However, this
diminution required both the transport and reduction of nitrate and
nitrite. Thus, the observed inhibition of
(nasR-lacZ)
expression is due to decreased Ntr activation in response to formation
of ammonium from nitrate. Furthermore, the short distance (26 bp)
between the transcription initiation site and the probable
nasR initiation codon is insufficient to contain a regulated
transcription terminator, which is the target of NasR action in the
nasF operon. Thus, we conclude that nasR gene
expression is not subject to transcriptional autoregulation.
| |
ACKNOWLEDGMENTS |
|---|
Catherine Dunn (University of California, Davis) performed
experiments to confirm and extend the results summarized in Table 2.
Robert Bender, Alexander Ninfa, and an anonymous reviewer provided
invaluable constructive critique of an early version of the manuscript.
We are obliged to Mike Merrick for sharing many useful K. oxytoca M5al strains. We thank Karen Skorupski for providing her
allelic exchange vector in advance of publication, Thomas Linn for the
TXF97 transcriptional fusion vector, Brian Janes and Robert Bender
for the K. aerogenes nac strains, and Susan Egan for
E. coli rha mutants. Automated DNA sequence analyses were
performed by the Cornell University Biotechnology Program central
services group.
This study was supported by U.S. Department of Energy grant 91ER20027 from the Division of Energy Biosciences and by Hatch project CA-D*-MIC-6572-H from the California Agricultural Experiment Station.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Section of Microbiology, University of California, One Shields Ave., Davis, CA 95616-8665. Phone: (530) 754-7994. Fax: (530) 752-9014. E-mail: vjstewart{at}ucdavis.edu.
Present address: Biological Research and Development, Fort Dodge
Animal Health, Fort Dodge, IA 50501.
Present address: Department of Molecular Biology & Genetics,
Cornell University, Ithaca, NY 14853.
§ Present address: Department of Fungal Molecular Biology, Novo Nordisk Biotech, Inc., Davis, CA 95616.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403-410[Medline]. |
| 2. | Ames, G. F.-L., and K. Nikaido. 1985. Nitrogen regulation in Salmonella typhimurium. Identification of an ntrC protein-binding site and definition of a consensus binding sequence. EMBO J. 4:539-547[Medline]. |
| 3. | Bender, R. A. 1991. The role of the NAC protein in the nitrogen regulation of Klebsiella aerogenes. Mol. Microbiol. 5:2575-2580[Medline]. |
| 4. |
Bender, R. A.,
K. A. Janssen,
A. D. Resnick,
M. Blumenberg,
F. Foor, and B. Magasanik.
1977.
Biochemical parameters of glutamine synthetase from Klebsiella aerogenes.
J. Bacteriol.
129:1001-1009 |
| 5. |
Blattner, F. R.,
G. Plunkett III,
C. A. Bloch,
N. T. Perna,
V. Burland,
M. Riley,
J. Collado-Vides,
J. D. Glasner,
C. K. Rode,
G. F. Mayhew,
J. Gregor,
N. W. Davis,
H. A. Kirkpatrick,
M. A. Goeden,
D. J. Rose,
B. Mau, and Y. Shao.
1997.
The complete genome sequence of Escherichia coli K-12.
Science
277:1453-1474 |
| 6. |
Buck, M., and W. Cannon.
1989.
Mutations in the RNA polymerase recognition sequence of the Klebsiella pneumoniae nifH promoter permitting transcriptional activation in the absence of NifA binding to upstream activator sequences.
Nucleic Acids Res.
17:2597-2612 |
| 7. |
Cannon, W.,
F. Claverie-Martin,
S. Austin, and M. Buck.
1993.
Core RNA polymerase assists binding of the transcription factor 54 to promoter DNA.
Mol. Microbiol.
8:287-298[Medline].
|
| 8. | Chai, W., and V. Stewart. 1998. NasR, a novel RNA-binding protein, mediates nitrate-responsive transcription antitermination of the Klebsiella oxytoca M5al nasF operon leader in vitro. J. Mol. Biol. 283:339-351[Medline]. |
| 9. | Chai, W., and V. Stewart. 1999. RNA sequence requirements for NasR-mediated, nitrate-responsive transcription antitermination of the Klebsiella oxytoca M5al nasF operon leader. J. Mol. Biol. 292:203-216[Medline]. |
| 10. | Chen, L.-M., G. T. J., R. A. Bender, S. Swift, and S. Maloy. 1998. Genetic analysis, using P22 challenge phage, of the nitrogen activator protein DNA-binding site in the Klebsiella aerogenes put operon. J. Bacteriol. 180:571-577. |
| 11. | Christie, A., and M. Butler. 1994. Growth and metabolism of a murine hybridoma in cultures containing glutamine-based dipeptides. Focus (Gibco BRL) 16:9-13. |
| 12. |
Dixon, R.
1984.
Tandem promoters determine regulation of the Klebsiella pneumoniae glutamine synthetase (glnA) gene.
Nucleic Acids Res.
12:7811-7830 |
| 13. |
Dixon, R. A.
1984.
The genetic complexity of nitrogen fixation.
J. Gen. Microbiol.
130:2745-2755 |
| 14. | Drummond, M., J. Clements, M. Merrick, and R. Dixon. 1983. Positive control and autogenous regulation of the nifLA promoter in Klebsiella pneumoniae. Nature 301:302-307[Medline]. |
| 15. | Dunn, C. A., and V. Stewart. Unpublished observations. |
| 16. |
Elliott, T.
1992.
A method for constructing single-copy lac fusions in Salmonella typhimurium and its application to the hemA-prfA operon.
J. Bacteriol.
174:245-253 |
| 17. | Espin, G., A. Alvarez-Morales, and M. Merrick. 1981. Complementation analysis of glnA-linked mutations which affect nitrogen fixation in Klebsiella pneumoniae. Mol. Gen. Genet. 184:213-217[Medline]. |
| 18. |
Feng, J. L.,
T. J. Goss,
R. A. Bender, and A. J. Ninfa.
1995.
Activation of transcription initiation from the nac promoter of Klebsiella aerogenes.
J. Bacteriol.
177:5523-5534 |
| 19. |
Goldman, B. S.,
J. T. Lin, and V. Stewart.
1994.
Identification and structure of the nasR gene encoding a nitrate- and nitrite-responsive positive regulator of nasFEDCBA (nitrate assimilation) operon expression in Klebsiella pneumoniae M5al.
J. Bacteriol.
176:5077-5085 |
| 20. |
Goss, T. J., and R. A. Bender.
1995.
The nitrogen assimilation control protein, Nac, is a DNA binding transcription activator in Klebsiella aerogenes.
J. Bacteriol.
177:3546-3555 |
| 21. |
Groisman, E. A., and M. J. Casadaban.
1986.
Mini-Mu bacteriophage with plasmid replicons for in vivo cloning and lac gene fusing.
J. Bacteriol.
168:357-364 |
| 22. | Ikeda, T. P., A. E. Shauger, and S. Kustu. 1996. Salmonella typhimurium apparently perceives external nitrogen limitation as internal glutamine limitation. J. Mol. Biol. 259:589-607[Medline]. |
| 23. |
Janes, B., and R. A. Bender.
1998.
Alanine catabolism in Klebsiella aerogenes: molecular characterization of the dadAB operon and its regulation by the nitrogen assimilation control protein.
J. Bacteriol.
180:563-570 |
| 24. |
Jiang, P., and A. J. Ninfa.
1999.
Regulation of autophosphorylation of Escherichia coli nitrogen regulator II by the PII signal transduction protein.
J. Bacteriol.
181:1906-1911 |
| 25. | Kingston, R. E. 1987. Primer extension, p. 4.8.1-4.8.3. In F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.), Current protocols in molecular biology, vol. 1. Wiley Interscience, Boston, Mass |
| 26. |
Kustu, S.,
D. Burton,
E. Garcia,
L. McCarter, and N. McFarland.
1979.
Nitrogen control in Salmonella: regulation by the glnR and glnF gene products.
Proc. Natl. Acad. Sci. USA
76:4576-4580 |
| 27. |
Lewis, M. K., and D. V. Thompson.
1990.
Efficient site directed in vitro mutagenesis using ampicillin selection.
Nucleic Acids Res.
18:3439-3443 |
| 28. |
Lin, J. T.,
B. S. Goldman, and V. Stewart.
1993.
Structures of genes nasA and nasB, encoding assimilatory nitrate and nitrite reductases in Klebsiella pneumoniae M5al.
J. Bacteriol.
175:2370-2378 |
| 29. |
Lin, J. T.,
B. S. Goldman, and V. Stewart.
1994.
The nasFEDCBA operon for nitrate and nitrite assimilation in Klebsiella pneumoniae M5al.
J. Bacteriol.
176:2551-2559 |
| 30. | Lin, J. T., and V. Stewart. 1996. Nitrate and nitrite-mediated transcription antitermination control of nasF (nitrate assimilation) operon expression in Klebsiella pneumoniae M5al. J. Mol. Biol. 256:423-435[Medline]. |
| 31. | Lin, J. T., and V. Stewart. 1998. Nitrate assimilation by bacteria. Adv. Microb. Physiol. 38:1-30. |
| 32. |
Macaluso, A.,
E. A. Best, and R. A. Bender.
1990.
Role of the nac gene product in the nitrogen regulation of some NTR-regulated operons of Klebsiella aerogenes.
J. Bacteriol.
172:7249-7255 |
| 33. |
MacNeil, D.,
J. Zhu, and W. J. Brill.
1981.
Regulation of nitrogen fixation in Klebsiella pneumoniae: isolation and characterization of strains with nif-lac fusions.
J. Bacteriol.
145:348-357 |
| 34. | Magasanik, B. 1996. Regulation of nitrogen utilization, p. 1344-1356. In F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed. ASM Press, Washington, D.C. |
| 35. | Maloy, S. R., V. Stewart, and R. K. Taylor. 1996. Genetic analysis of pathogenic bacteria. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y |
| 36. |
Merrick, M. J.
1993.
In a class of its own the RNA polymerase sigma factor 54 ( N).
Mol. Microbiol.
10:903-909[Medline].
|
| 37. |
Merrick, M. J., and J. R. Coppard.
1989.
Mutations in genes downstream of the rpoN gene (encoding 54) of Klebsiella pneumoniae affect expression from 54-dependent promoters.
Mol. Microbiol.
3:1765-1775[Medline].
|
| 38. |
Merrick, M. J., and R. A. Edwards.
1995.
Nitrogen control in bacteria.
Microbiol. Rev.
59:604-622 |
| 39. | Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y |
| 40. | Minchin, S. D., S. Austin, and R. A. Dixon. 1988. The role of activator binding sites in transcriptional control of the divergently transcribed nifF and nifLA promoters from Klebsiella pneumoniae. Mol. Microbiol. 2:433-442[Medline]. |
| 41. | Minchin, S. D., S. Austin, and R. A. Dixon. 1989. Transcriptional activation of the Klebsiella pneumoniae nifLA promoter by NTRC is face-of-the-helix dependent and the activator stabilizes the interaction of sigma 54-RNA polymerase with the promoter. EMBO J. 8:3491-3499[Medline]. |
| 42. | Minton, N. P. 1984. Improved plasmid vectors for the isolation of translational lac gene fusions. Gene 31:269-273[Medline]. |
| 43. |
Moralejo, P.,
S. M. Egan,
E. Hidalgo, and J. Aguilar.
1993.
Sequencing and characterization of a gene cluster encoding the enzymes for L-rhamnose metabolism in Escherichia coli.
J. Bacteriol.
175:5585-5594 |
| 44. | Ninfa, A. J., M. R. Atkinson, E. S. Kamberov, J. Feng, and E. G. Ninfa. 1995. Control of nitrogen assimilation by the NRI-NRII two-component system of enteric bacteria, p. 67-88. In J. A. Hoch, and T. J. Silhavy (ed.), Two-component signal transduction. ASM Press, Washington, D.C. |
| 45. | Ninfa, A. J., L. J. Reitzer, and B. Magasanik. 1987. Initiation of transcription at the bacterial glnAP2 promoter by purified E. coli components is facilitated by enhancers. Cell 50:1039-1046[Medline]. |
| 46. | North, A. K., and S. Kustu. 1997. Mutant forms of the enhancer-binding protein NtrC can activate transcription from solution. J. Mol. Biol. 267:17-36[Medline]. |
| 47. |
Pomposiello, P. J.,
B. Janes, and R. A. Bender.
1998.
Two roles for the DNA recognition site of the Klebsiella aerogenes nitrogen assimilation control protein.
J. Bacteriol.
180:578-585 |
| 48. | Porter, S. C., A. K. North, and S. Kustu. 1995. Mechanism of transcriptional activation by NtrC, p. 147-158. In J. A. Hoch, and T. J. Silhavy (ed.), Two-component signal transduction. ASM Press, Washington, D.C. |
| 49. | Reitzer, L. J. 1996. Ammonia assimilation and the biosynthesis of glutamine, glutamate, aspartate, asparagine, L-alanine, and D-alanine, p. 391-407. In F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed. ASM Press, Washington, D.C. |
| 50. | Reitzer, L. J., and B. Magasanik. 1986. Transcription of glnA in E. coli is stimulated by activator bound to sites far from the promoter. Cell 45:785-792[Medline]. |
| 51. |
Saiki, R. K.,
D. H. Gelfand,
S. Stoffel,
S. J. Scharf,
R. Higuchi,
G. T. Horn,
K. B. Mullis, and H. A. Erlich.
1988.
Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase.
Science
239:487-491 |
| 52. | Schmitz, G., K. Nikaido, and G. F.-L. Ames. 1988. Regulation of a transport operon promoter in Salmonella typhimurium: identification of sites essential for nitrogen regulation. Mol. Gen. Genet. 215:107-117[Medline]. |
| 53. |
Schneider, B. L.,
S. P. Shiau, and L. J. Reitzer.
1991.
Role of multiple environmental stimuli in control of transcription from a nitrogen-regulated promoter in Escherichia coli with weak or no activator-binding sites.
J. Bacteriol.
173:6355-6363 |
| 54. |
Schwacha, A., and R. A. Bender.
1993.
The product of the Klebsiella aerogenes nac (nitrogen assimilation control) gene is sufficient for activation of the hut operons and repression of the gdh operon.
J. Bacteriol.
175:2116-2124 |
| 55. | Shimotsu, H., and D. J. Henner. 1986. Construction of a single-copy integration vector and its use in analysis of regulation of the trp operon of Bacillus subtilis. Gene 43:85-94[Medline]. |
| 56. | Simons, R. W., F. Houman, and N. Kleckner. 1987. Improved single and multicopy lac-based cloning vectors for protein and operon fusions. Gene 53:85-96[Medline]. |
| 57. | Skorupski, K., and R. T. Taylor. 1996. Positive selection vectors for allelic exchange. Gene 169:47-52[Medline]. |
| 58. |
Stewart, V., and J. Parales, Jr.
1988.
Identification and expression of genes narL and narX of the nar (nitrate reductase) locus in Escherichia coli K-12.
J. Bacteriol.
170:1589-1597 |
| 59. | St. Pierre, R., and T. Linn. 1996. A refined vector system for in vitro construction of single-copy transcriptional or translational fusions of lacZ. Gene 169:65-68[Medline]. |
| 60. | Streicher, S., E. Gurney, and R. C. Valentine. 1972. The nitrogen-fixation genes. Nature 239:495-499[Medline]. |
| 61. |
Streicher, S. L.,
K. T. Shanmugam,
F. Ausubel,
C. Morandi, and R. B. Goldberg.
1974.
Regulation of nitrogen fixation in Klebsiella pneumoniae: evidence for a role of glutamine synthetase as a regulator of nitrogenase synthesis.
J. Bacteriol.
120:815-821 |
| 62. |
Wang, L., and J. D. Gralla.
1998.
Multiple in vivo roles for the 12 region elements of sigma 54 promoters.
J. Bacteriol.
180:5626-5631 |
| 63. |
Wong, P.-K.,
D. Popham,
J. Keener, and S. Kustu.
1987.
In vitro transcription of the nitrogen fixation regulatory operon nifLA of Klebsiella pneumoniae.
J. Bacteriol.
169:2876-2880 |
| 64. |
Wu, Q., and V. Stewart.
1998.
NasFED proteins mediate assimilatory nitrate and nitrite transport in Klebsiella oxytoca (pneumoniae) M5al.
J. Bacteriol.
180:1311-1322 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»