HSP Research Institute, Kyoto Research Park,
Shimogyo-ku, Kyoto 600-8813, Japan,1 and
Department of Molecular Microbiology and Biotechnology, The
George S. Wise Faculty of Life Sciences, Tel-Aviv University,
Tel-Aviv, Israel2
The heat shock response in alpha proteobacteria is unique in that a
combination of two regulators is involved: a positive regulator, RpoH
(
32 homolog), found in the alpha, beta, and gamma
proteobacteria, and a negative regulator, HrcA, widely distributed in
eubacteria but not in the gamma proteobacteria. To assess the
differential roles of the two regulators in these bacteria, we cloned
the hrcA-grpE operon of Agrobacterium
tumefaciens, analyzed its transcription, and constructed deletion
mutants lacking RpoH and/or HrcA. The
rpoH mutant and
rpoH
hrcA double mutant were unable to grow above
30°C. Whereas the synthesis of heat shock proteins (e.g., DnaK,
GroEL, and ClpB) was transiently induced upon temperature upshift from
25 to 37°C in the wild type, such induction was not observed in the
rpoH mutant, except that GroEL synthesis was still
partially induced. By contrast, the
hrcA mutant grew
normally and exhibited essentially normal heat induction except for a
higher level of GroEL expression, especially before heat shock. The
rpoH
hrcA double mutant showed the combined
phenotypes of each of the single mutants. The amounts of
dnaK and groE transcripts before and after heat
shock, as determined by primer extension, were consistent with those of
the proteins synthesized. The cellular level of RpoH but not HrcA
increased significantly upon heat shock. We conclude that RpoH plays a
major and global role in the induction of most heat shock proteins,
whereas HrcA plays a restricted role in repressing groE
expression under nonstress conditions.
 |
INTRODUCTION |
In the paradigm of bacterial heat
shock response studied with Escherichia coli,
32 (encoded by rpoH) plays a key role in
controlling the transcription of all major heat shock proteins (HSPs)
in the cytoplasm, including GroE and DnaK chaperone machineries and
ATP-dependent proteases, such as Clp and Lon (10, 42). Upon
heat shock, the cellular level of
32 increases rapidly
both by enhanced translation of rpoH mRNA and by transient
stabilization of
32, and this increase in turn activates
the transcription of heat shock genes. Homologs of rpoH have
been identified from some 20 species of eubacteria that belong to the
alpha, beta, and gamma subgroups of proteobacteria (1, 13, 15, 20,
21, 24, 30, 31); earlier work cited in reference (21). The
rpoH homologs from many gamma proteobacteria share common
structural features with E. coli rpoH, a downstream box,
mRNA secondary structure, and highly conserved amino acid sequence of
region C, that are important for thermoregulation of rpoH
translation and
32 stability and activity in E. coli (21). In these bacteria, the RpoH homologs indeed
exhibit translational induction and stabilization upon heat shock very
similar to that found with E. coli (22).
In contrast, alpha and beta proteobacteria have diverged from the gamma
subgroup in their modes of regulation of rpoH expression. Their rpoH genes do not contain the downstream box or mRNA
secondary structure that are conserved among gamma proteobacteria.
Instead, some rpoH genes from alpha proteobacteria contain
an RpoH-dependent promoter that can be induced upon heat shock
(24, 26, 40). Another important feature found in alpha but
not in gamma proteobacteria is the presence of the CIRCE (for
controlling inverted repeat of chaperone expression)-HrcA regulatory
system. Recent studies of wide groups of eubacteria revealed a variety
of heat shock regulatory mechanisms, either positive regulation by
alternative
factors or negative regulation by specific
repressor-operator systems (see reviews in references
23 and 28). The most widely distributed system is the CIRCE-HrcA system, extensively characterized in Bacillus subtilis as the regulatory mechanism specific
for the groE and dnaK operons (18, 19, 41,
43). CIRCE, with a consensus of TTAGCACTC-N9-GAGTGCTAA,
represents a site for binding the HrcA repressor. HrcA could act
as a stress sensor whose activity is modulated by the GroEL chaperone.
This system has been found in gram-positive bacteria and proteobacteria
and implicated in cyanobacteria and several other groups of eubacteria
(5, 8, 9, 38, 39). Within proteobacteria, CIRCE and/or
hrcA were shown to regulate groE operons of some
alpha proteobacteria, including Agrobacterium tumefaciens
(3, 27, 37). However a CIRCE-like sequence has not been
detected in gamma proteobacteria, except for the groE operon
of Chromatium vinosum (7). It seemed likely that
the CIRCE-HrcA system is operative in the alpha and beta proteobacteria
but not in most gamma proteobacteria. Thus, alpha and beta
proteobacteria appeared to be unique in that they carry both the RpoH
system, with regulatory features different from those of gamma
proteobacteria, and the CIRCE-HrcA system for regulation of the heat
shock response.
In this study, we used A. tumefaciens as a model to study
the differential roles of the RpoH and CIRCE-HrcA systems in the heat
shock response in alpha proteobacteria. The groE and
dnaK operons of A. tumefaciens were previously
isolated and characterized (34-37), and the CIRCE element
was found in the groE, but not in the dnaK,
promoter region. Although the rpoH gene was available from
our previous study (21), no information on hrcA
was at hand. Successful isolation of hrcA and analysis of
the deletion mutants lacking rpoH and/or hrcA
revealed that RpoH plays a major and global role in the induction of
HSPs, whereas the role of HrcA is restricted primarily to repressing
the groE operon under nonstress conditions.
 |
MATERIALS AND METHODS |
Bacterial strains, plasmids, media, and growth conditions.
All bacterial strains used are listed in Table
1. The 4-kb SmaI fragment
containing hrcA and grpE was inserted into the
DraI site of pBBR122 (MoBiTec, Göttingen, Germany) to
construct phrcA-grpE. For most experiments, A. tumefaciens cultures were grown at 25°C in complete medium YEB
under constant aeration or on YEB agar (11). For in vivo
labeling experiments, Davis minimal medium (6) supplemented
with 0.2% glucose, 2 µg of thiamine/ml, 50 µg of 18 L-amino acids (excluding methionine and cysteine)/ml, and
1/100 volume of YEB were used. Luria-Bertani broth was used for growing
E. coli.
Construction and screening of charomid library.
Construction
of the charomid library and screening by complementation of the
temperature-sensitive grpE mutant was done essentially as
described previously (21). The DNA inserts of the charomids obtained were subcloned into the pUC-based plasmid vector, and the
nucleotide sequence was determined by standard procedures.
Construction of deletion mutants.
To construct the
rpoH strains, the entire rpoH coding sequence
with an additional 12 bases of the 5' noncoding region was deleted from
the 7-kb BamHI fragment (21) by PCR with primers rpoH-n1r (TATCTATGGTCTGGAACGGCACCCTCTTTGG) and rpoH-r1n
(GGCGACACTCTCTTAAGGAGAGCACGCCATCC) and replaced by the
tetracycline resistance gene from pBR322. The BamHI fragment
lacking rpoH was inserted into pK18mobsacB (32), unable to replicate in A. tumefaciens, and
introduced into cells of A. tumefaciens by
electrotransformation with a Gene Pulsar with Pulse Controller
(Bio-Rad, Richmond, Calif.). Kanamycin-resistant clones that resulted
from homologous recombination between the plasmid and the chromosomal
rpoH region were selected. To obtain the clones that had
lost the inserted plasmid together with the intact copy of
rpoH, clones that became resistant to 10% sucrose by the
loss of sacB were isolated from among the initial
transformants, and those that were sensitive to kanamycin and resistant
to tetracycline were selected. The deletion of rpoH was
confirmed by Southern blot analysis.
Essentially the same selection procedure was used to construct the
hrcA strains. All of the hrcA coding region,
except the four N-terminal codons and the termination codon, was
deleted by PCR with primers hrcA-n1r
(CCGCTGAAAAACCCATCTTGTCCGTTCTTTATCG) and hrcA-r1n
(CCGCATAGGACACATCAGCAAGATCAGAGAATGCGG). The resulting fragment was used to replace the chromosomal hrcA to obtain
the hrcA deletion mutants. In this case, about 50% of the
sucrose-resistant clones from the second selection turned out to be
hrcA, as confirmed by Southern blot analysis.
Antibodies.
For raising polyclonal antibodies against RpoH
and HrcA, coding sequences for each protein were inserted into the
expression vector pThioHisA (Invitrogen, Carlsbad, Calif.), and the
fusion protein with modified thioredoxin was expressed in E. coli, purified with Ni2+ resin, and used for
immunizing rabbits. Rabbit antiserum against E. coli GroEL
was previously described (17). Antisera against two other
E. coli HSPs, DnaK and ClpB, were kind gifts from M. Kohiyama (University of Paris 7) and C. Squires (Tufts University), respectively.
Isolation of RNA and primer extension analysis.
Cells from
50 ml of log-phase culture were quickly chilled, harvested by
centrifugation for 1 min at 13,000 × g, resuspended in
0.25 ml of lysozyme solution (104 U/ml)(Ready-Lyse
Lysozyme; Epicentre Technologies, Madison, Wis.) with isohypotonic
buffer, and mixed with 0.75 ml of ISOGEN-LS (Nippon Gene, Tokyo,
Japan). Total RNA was isolated as described in the manufacturer's
manual. The 5' end of primer HrcA-EX1 (GCCTGATCTTTTGAAAGCGGTGC; complementary to +13 to 35 of the hrcA coding
sequence) or GrpE-Ex1 (TCCGCGACGTCCGCGTCAGGTCC;
complementary to +25 to 47 of the grpE coding
sequence) was labeled with 32P and used for primer
extension analysis of hrcA or grpE, respectively. The fluorescent primer GE1 (fluorescein isothiocyanate labeled; TGCCTAATCCCTCGATC; complementary to +70 to 86 relative to
the transcription start site of groE) or DK1 (fluorescein
isothiocyanate labeled; TGAAGCGAGCTGTCTGAACC; complementary to +58
to 77 relative to the transcription start site of dnaK) was
used for analysis of groE or dnaK mRNA,
respectively, and 16S2 (FAM labeled; TGCCACTCCCCTTGCGGGGC; complementary to +41 to 61 of the 16S rRNA) was used for analysis of 16S rRNA as an internal control. Primer extension analysis was
carried out essentially as described previously (2).
Nucleotide sequence accession number.
The nucleotide
sequence of the entire region around hrcA in A. tumefaciens has been deposited in GenBank under accession no. AF039940.
 |
RESULTS |
Cloning of hrcA and the neighboring genes.
Assuming that hrcA of A. tumefaciens is located
adjacent to grpE as in Caulobacter crescentus
(27), we first screened a charomid library of the
chromosomal DNA fragments for clones that could complement the
temperature-sensitive growth of the grpE280 mutant of
E. coli (KY1454). As expected, the resulting clones contained an open reading frame (ORF) which could code for a GrpE homolog. The putative GrpE protein of A. tumefaciens is 211 amino acids long and has 28.7 and 34.5% identity with the GrpEs of
E. coli and C. crescentus, respectively.
Sequencing of the several clones covering from about 2.5-kbp upstream
to 1.5-kbp downstream of grpE revealed the presence of four
other ORFs that showed homology with the known bacterial genes (Fig.
1). One of them, located directly
upstream of grpE, separated by 88 bp, showed an appreciable homology with the hrcA genes of C. crescentus and
other bacteria. The predicted amino acid sequence of putative HrcA was
363 amino acids and showed 47.8 and 25.4% identity with those of
C. crescentus and B. subtilis, respectively. The
ORF further upstream of hrcA on the opposite strand showed
high sequence similarity to the rph gene encoding RNase PH
of E. coli. This gene organization is identical with that
found in C. crescentus (27). On the other hand,
two ORFs located downstream on the opposite strand of grpE, designated ptsN and ORF210 (Fig. 1), had significant
homology with ptsN, encoding phosphotransferase enzyme IIA,
and ORF203, encoding a putative
54 modulating protein of
Bradyrhizobium japonicum, found at the distal end of
the rpoN2 operon (16). A 3' portion of an
ORF, homologous to rpoN, was also found upstream of ORF210.

View larger version (6K):
[in this window]
[in a new window]
|
FIG. 1.
Gene arrangement around hrcA in A. tumefaciens. See the text for an explanation of each of the
putative genes or ORFs.
|
|
Primer extension analysis of hrcA and grpE
transcripts.
To examine transcripts of the hrcA and
grpE genes, primer extension analysis was carried out with
RNAs extracted from wild-type and
rpoH (described below)
cells taken before and after a temperature shift from 25 to
37°C, using primers for the 5' end of each gene. Since the
transcripts detected were very scarce, strains harboring hrcA and grpE on a multicopy plasmid (pBBR122)
were also used. A single transcript initiated at nucleotide
32
relative to the hrcA coding region was detected by using the
hrcA primer, and its amount increased significantly upon
heat shock (Fig. 2a). This transcript was
hardly induced in the
rpoH mutant, suggesting possible involvement of RpoH in heat induction. Curiously, the basal level found at 25°C was higher in the
rpoH
mutant than in the wild type. A putative promoter corresponding to this
transcript showed some similarity to the heat shock promoters of
A. tumefaciens and also to vegetative promoters of E. coli (Fig. 3). An inverted repeat of
12 (6 × 2) bases was found between the
10 and
35 regions of
this promoter. This transcript may represent a bicistronic mRNA, since
no clear hairpin structure that could implicate a transcription
terminator was present between the coding regions of hrcA
and grpE.

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 2.
Transcription analysis of the hrcA and
grpE genes. Cells were grown at 25°C in complete medium to
mid-log phase and exposed to 37°C for 15 min. Samples taken before
and after heat shock were used for RNA extraction.
32P-labeled primers for hrcA (a) or
grpE (b) were hybridized with 10 µg of each RNA and
subjected to primer extension analysis. The cDNA products were resolved
by 6% sequence gels and autoradiographed. Sequence ladders produced by
the same respective primers were run as markers, and the positions
relative to the initiation codons are indicated. The positions of major
signals are marked by boxes. Lanes: 1 and 2, GV3101
(rpoH+); 3 and 4, KN501 ( rpoH); 5 and 6, GV3101(phrcA-grpE); 7 and 8, KN501(phrcA-grpE). +, present; , absent.
|
|

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 3.
Promoter sequences of hrcA, grpE,
and other heat shock genes in A. tumefaciens. An
inverted repeat in the hrcA promoter is shown by arrows. The
start sites of heat-inducible transcripts are underlined. Bases found
in at least five of six possible RpoH-dependent promoters are indicated
in upper case. Consensus deduced from these sequences and those of the
E. coli 32 and 70 promoters
are shown for comparison. References for the sequences are as follows:
groESL, 34; dnaKJ,
35; rpoH and clpP,
19a; E. coli 32 consensus,
10; E. coli 70 consensus,
25.
|
|
Another transcript initiated from between hrcA and
grpE, and induced upon heat shock, was detected by using the
grpE primer (Fig. 2b). The heat inducibility was lost by the
rpoH mutation, although appreciable basal levels of this
transcript remained, suggesting partial contribution of RpoH to the
transcription. Consistently, a putative promoter for this transcript
has some sequence similarity to other heat shock promoters whose
activities depend at least partially on RpoH (Fig. 3) (see below).
Thus, at least two transcripts initiated from upstream of
hrcA and grpE, respectively, were shown to be
involved in transcription of the two genes that may form an operon.
Construction of
rpoH,
hrcA, and the
double-deletion mutants.
To analyze the roles of RpoH and HrcA in
the heat shock response, we introduced
rpoH and
hrcA deletions into the A. tumefaciens chromosome and examined their effects, separately and in combination, on the heat shock response. The entire coding sequence of
A. tumefaciens rpoH on the E. coli
plasmid was replaced by the tetracycline resistance gene
(tet), and
rpoH strains were constructed by
homologous recombination between the
rpoH::tet fragment and
rpoH on the host chromosome at 25°C. Similarly, most of
the coding region of hrcA was deleted from the wild type or
the
rpoH mutant to construct
hrcA or the
rpoH
hrcA double mutant, respectively. All these
deletions were confirmed by Southern blotting. Immunoblotting
analysis with the specific antisera revealed that the band for RpoH or
HrcA, found in the wild-type extract, was not detected in the
corresponding mutant extracts (data not shown). These results suggested
that both the rpoH and hrcA genes exist in single
copies and are expressed in the wild-type cells. The
rpoH
mutant was able to grow at 30°C but not at higher temperatures, and
growth was significantly slower even at permissive temperatures (e.g.,
25°C) (Fig. 4). In contrast, the
hrcA mutant grew normally or slightly faster than the
wild type at physiological temperatures. The double mutant lacking both
RpoH and HrcA exhibited temperature-sensitive growth similar to that of
the
rpoH mutant but grew slightly faster at the
permissive temperature than the
rpoH single mutant.

View larger version (71K):
[in this window]
[in a new window]
|
FIG. 4.
Growth of the rpoH and hrcA
mutants. Overnight cultures grown in complete medium (YEB) at 25°C
were diluted 10-fold, and 5-µl samples were spotted on the YEB plates
and incubated overnight at the indicated temperatures. WT, GV3101;
rpoH, KN501; hrcA, KN613; rpoH
hrcA, KN201.
|
|
Effects of
rpoH and
hrcA mutations on
HSP synthesis.
The set of mutants described above were examined
for the synthesis of HSPs before and after temperature upshift. When
wild-type cells grown at 25°C were shifted to 37°C, the synthesis
of several HSPs was rapidly and transiently induced (Fig.
5a). Among them, the most abundant
proteins, of about 90, 70, and 60 kDa, were identified as ClpB, DnaK,
and GroEL homolog, respectively, by immunoprecipitation with specific
antisera for the respective proteins of E. coli (data not
shown). In the
rpoH mutant lacking RpoH, none of these
HSPs except GroEL appeared to be induced significantly; GroEL was
synthesized apparently normally at 25°C but was only modestly
enhanced upon heat shock (Fig. 5b). These results suggested that RpoH
is responsible for the heat induction of most, if not all, HSPs in
A. tumefaciens. On the other hand, the
hrcA deletion hardly affected the synthesis of HSP,
except that GroEL synthesis was slightly higher than in the wild type
both before and after temperature upshift (Fig. 5c), indicating the
role of HrcA in repressing GroE expression. The synthesis patterns in
the double mutant were very similar to those in the
rpoH
single mutant except for the higher rates of GroEL expression
throughout (Fig. 5d); thus, the
rpoH and
hrcA mutations exhibited additive effects on the
synthesis of these proteins.

View larger version (96K):
[in this window]
[in a new window]
|
FIG. 5.
Sodium dodecyl sulfate (SDS)-polyacrylamide gel patterns
of HSP synthesis in mutants. The cells were grown in enriched minimal
medium at 25°C and shifted to 37°C at time zero. Samples were taken
at intervals, pulse labeled with [35S]methionine for 2 min, and treated with trichloroacetic acid. Whole cell proteins were
analyzed by SDS-polyacrylamide gel (7.5% gel) electrophoresis and
visualized with a phosphorimager. The bands of the most abundantly
synthesized HSPs (GroEL, DnaK, and ClpB) are marked with open
arrowheads, and other possible HSPs are marked with closed arrowheads.
(a) WT, GV3101; (b) rpoH, KN501; (c) hrcA,
KN613; (d) hrcA rpoH, KN201.
|
|
The synthesis rates of three major HSPs were quantified to further
evaluate the effects of the deletions on the kinetics and extent of
heat shock response. The GroEL synthesis was indeed higher in the
hrcA mutant than in the wild type at all periods tested,
but especially higher rates of derepression were observed before heat
shock and during the shutoff periods, not at the peak of heat induction
(Fig. 6a). A slight but significant
induction of GroEL which peaks at about 10 min was observed in the
rpoH mutant and even in the
hrcA
rpoH
mutant. This induction in the double-deletion mutant may be due to
specific processing and stabilization of the groEL mRNA
(36), since the amount of mRNA immediately downstream of the
5' end of the groE operon did not change significantly upon
heat shock (see below). On the other hand, induction of DnaK and ClpB
in the
hrcA mutant was similar to that in the wild type, except for the slightly lower extents of induction for both proteins (Fig. 6b and c). Synthesis of DnaK and ClpB in the
rpoH
mutant, which could not be accurately determined due to the background, was found by immunoprecipitation to be less than 6 or 4%,
respectively, of the maximum synthesis rates in the wild type (data not
shown).

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 6.
Kinetics of HSP induction upon temperature upshift.
Radioactivity associated with the protein bands of the three major HSPs
shown in Fig. 3 were quantified to analyze the kinetics of induction.
(a) GroEL; (b) DnaK; (C) ClpB. The radioactivity of each band was
plotted after normalization to the maximum synthesis rate in the wild
type, set at 100. DnaK and ClpB in the rpoH and
hrcA rpoH mutants were not plotted, as they were below
the background levels. , GV3101 (wild type); , KN501
( rpoH); , KN613 ( hrcA); , KN201
( hrcA rpoH).
|
|
Analysis of the dnaK and groE transcripts
with the mutants.
To clarify the roles of RpoH and HrcA in the
transcriptional induction of HSP genes, we chose groE and
dnaK operons that had been analyzed previously and examined
the amounts of the respective mRNAs by primer extension (Fig.
7). The groE major transcript markedly increased upon heat shock in the wild type, as reported previously (36). This induction was strikingly affected by
the
rpoH mutation, the mRNA level after heat shock being
less than 40% that of the wild type (Fig. 7a, compare lanes 2 and 6).
However, the basal-level expression before heat shock was hardly
affected by the lack of RpoH (compare lanes 1 and 5). A similar effect was observed in the
hrcA background (compare lanes 4 and
8 and lanes 3 and 7). These results indicated that RpoH contributes greatly to the heat induction but not to the basal-level transcription of groE mRNA. Apparently, the basal transcription depends
mostly on a
factor(s) other than RpoH.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 7.
Transcription analyses of the groE and
dnaK genes. Cells were grown at 25°C in complete medium to
mid-log phase and exposed to 37°C for 15 min. Samples taken before
and after heat shock were used for RNA extraction. The amount of heat
shock transcripts was determined by primer extension analysis. The
extension reaction was carried out with each of the groE (a)
or dnaK (b) primers complementary to the region downstream
of the known transcription start sites of each operon and with 16S rRNA
primer labeled with different fluorescent dyes. The cDNA products were
analyzed on 8% sequence gels. Four experiments with two separate RNA
samples were carried out. The transcripts were quantified by using 16S
rRNA as an internal reference and then normalized to the value for the
heat-shocked wild-type cells, and average values are presented with
standard errors. Open and shaded bars, RNA from nonstressed cells;
solid bars, RNA from heat-shocked cells.
|
|
On the other hand, the
hrcA deletion caused about a
twofold increase in the groE transcript under nonstress
conditions in both the rpoH+ and
rpoH strains (Fig. 7a, compare lanes 1 and 3 and lanes 5 and 7) but had little effect on the transcript level obtained after
heat shock (compare lanes 2 and 4 and lanes 6 and 8). Thus, the
repression by HrcA is exerted efficiently during steady-state growth
but much less so upon temperature upshift. This was consistent with the
previous Northern analyses of transcripts from the groE operon with deletions or mutations in the CIRCE sequence
(37). These results are also in good agreement with findings
with other bacteria (27, 33, 41).
When both rpoH and hrcA were deleted, no
induction of groE transcription was observed upon heat
shock, in contrast to the partial induction observed with either of the
single mutants. It appears, therefore, that the two regulatory factors,
RpoH and HrcA, work independently and that their activities are mostly responsible for heat induction of groE transcription in
A. tumefaciens.
Transcriptional regulation of dnaK which does not contain
CIRCE appeared simpler. The major transcript, initiated from the single
known start site, markedly increased upon heat shock in the wild type
and in the
hrcA mutant, whereas no induction was detected
in the
rpoH mutant or the
rpoH
hrcA
double mutant (Fig. 7b), indicating that dnaK
transcriptional induction upon heat shock depends solely on RpoH. On
the other hand, the
hrcA mutation caused significant
reduction in dnaK transcript both before and after heat
shock. This reduction, consistent with the reduced rate of DnaK
synthesis (Fig. 6b), may be attributed to the increased level of GroE
which might somehow reduce the activity of RpoH.
Increased expression of RpoH but not HrcA during heat shock
response.
To analyze the expression of RpoH and HrcA in A. tumefaciens, we raised antisera against recombinant RpoH and HrcA
and used them to determine the changes in protein levels during the
heat shock response by immunoblotting. A significant level of RpoH protein was detected in cells grown at 25°C, and its level was markedly enhanced (by four- to fivefold) upon the shift to 37°C. After reaching the maximum at about 15 min, the RpoH level gradually decreased to near the preshift level after about 30 min (Fig. 8a). In spite of the increase of
hrcA transcript observed, the HrcA protein was not induced
by the heat shock and the HrcA level did not change significantly for
at least 50 min after the shift to 37°C (Fig. 8b).

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 8.
The cellular levels of RpoH and HrcA during the heat
shock response. Cells of wild-type A. tumefaciens (GV3101)
were grown to mid-log phase in complete medium at 25°C and shifted to
37°C at time zero. Samples were taken at the indicated times, mixed
with an equal volume of 2× sodium dodecyl sulfate (SDS) loading
buffer, and boiled for 5 min. Equal amounts of protein adjusted by the
optical density (in Klett units) of the culture were loaded on the
SDS-polyacrylamide gels (12.5% gels), blotted onto a nitrocellulose
membrane (Hybond ECL; Amersham Life Science), and detected with rabbit
antiserum against RpoH (a) or HrcA (b) by chemiluminescence
techniques.
|
|
 |
DISCUSSION |
Previous work indicated the involvement of the CIRCE-HrcA system
in regulation of the groE operons in alpha proteobacteria, including A. tumefaciens (3, 27, 37). These
studies showed that the repression of groE transcription is
mediated by the CIRCE-HrcA system, particularly under nonstress
conditions. However, the role of this system in the heat induction of
groE could not be directly examined, because heat shock
induction occurred even when hrcA or CIRCE had been deleted,
presumably by contribution of the heat shock
factor, RpoH. Here we
have shown that both HrcA and RpoH contribute independently to the heat
shock response of groE transcription in A. tumefaciens, since the single-deletion mutants lacking either
hrcA or rpoH could still respond to heat shock,
albeit weakly, and enhanced groE transcripts significantly whereas the double deletions virtually abolished the ability to respond
to high temperature.
In B. subtilis and perhaps other low-G+C gram-positive
bacteria, the CIRCE-HrcA system plays a key regulatory role in
expression of both the groE and dnaK operons
encoding major chaperones (33, 41). In contrast, CIRCE is
found in many species of alpha proteobacteria but only in the
groE operons (3, 4, 37, 38), implying that
groE is probably the only target regulated by the CIRCE-HrcA system in this group. The present study revealed that HrcA is indeed
involved in the regulation of groE transcription of A. tumefaciens by repressing it under nonstress conditions and
releasing the repression upon heat stress. However, HrcA contributes
only modestly to the temperature regulation of groE
transcription, which is also controlled by RpoH. In addition, the heat
shock regulation of GroE in this bacterium is not confined to
transcriptional control but also involves specific processing and
stabilization of groEL mRNA (36): thus, the
contribution of HrcA to the heat shock response of GroE is further
limited. The specific stabilization of groEL mRNA may
explain the slight induction of GroEL synthesis in the
rpoH
hrcA double mutant and the higher rate of GroEL synthesis in
the
hrcA mutant upon heat shock (Fig. 6a), neither of
which was observed at the transcript level as determined for the
groES segment (Fig. 7a).
As for the heat induction of other HSPs, no appreciable effect was
observed from the lack of HrcA, although induction of both ClpB and
DnaK was slightly reduced (Fig. 6b and c). Since no direct effect of
HrcA on dnaK transcription is expected, this may be an
indirect effect of the increased GroE level in the
hrcA
mutant, which might diminish the stress caused by heat shock and reduce the RpoH-mediated heat shock response.
The hrcA transcript of A. tumefaciens, determined
by semiquantitative primer extension, was significantly induced after
heat shock. Since the putative promoter has some similarity to other heat shock promoters, contribution of RpoH to this promoter was expected, as in the case of C. crescentus (27).
Indeed, the possible contribution of RpoH to this transcription was
suggested, because heat induction observed with the wild type was not
found in the
rpoH mutant. In addition, the level of this
transcript seen under nonstress condition was higher in the
rpoH mutant than in the wild type, suggesting possible
involvement of another regulatory mechanism for the transcription.
Currently, the nature of the mechanism remains unknown; an inverted
repeat found between the
35 and
10 regions might play a role in
this or other regulation of HrcA expression. In this connection, an
interesting paradox is that the heat-induced transcription of
hrcA did not result in significant enhancement of HrcA
protein upon heat shock. The transcriptional induction might produce
untranslatable RNA, or HrcA might be destabilized at high temperature.
Further work is needed to solve these problems.
In contrast to the restricted role of HrcA, RpoH appears to be
responsible for heat induction of most HSPs, acting as a global regulator of the heat shock response, like
32 in
E. coli. When produced in E. coli, RpoH of
A. tumefaciens can correctly recognize the dnaK
and groE heat shock promoters of E. coli
(20). Since most of the HSP genes so far examined in
A. tumefaciens, groESL, dnaKJ,
grpE, rpoH, and clpP, contain heat-inducible promoters similar to the heat shock promoters of E. coli (Fig. 3), RpoH was anticipated to be responsible for
transcription of these promoters. As expected, the deletion of
rpoH resulted in a complete or partial loss of heat-induced
transcription from the dnaK or groE promoter,
respectively (Fig. 7). Furthermore, all the heat shock proteins
detected by pulse labeling were markedly affected in the
rpoH mutant, clearly implying that induction of
most if not all HSPs in A. tumefaciens is
primarily controlled by RpoH.
In spite of a major role of RpoH in the synthesis of HSP, the
rpoH mutant of A. tumefaciens showed a
relatively mild temperature sensitivity, the inability to grow only
above 30°C, compared with the E. coli
rpoH mutant,
which cannot grow above 20°C. This may be related to the relatively
high basal expression of GroEL in A. tumefaciens in the
absence of RpoH (Fig. 5 to 7), in view of the findings with the
E. coli
rpoH mutant and its temperature-resistant revertants that the cellular level of GroE primarily determines the
upper limit of growth temperature (17). The expression of GroEL in the
rpoH mutant depends on the transcript
initiated apparently from the same start site used in the
rpoH+ strain. We don't know which sigma
factor(s) is responsible for this transcription in the
rpoH mutant, but it seems likely that the same
sigma is responsible for basal level transcription of groE,
grpE, and other heat shock genes in the
rpoH+ strain. Such a sigma factor would not be
activated by heat shock, as judged by the groE transcription
in the
rpoH
hrcA double mutant or by dnaK
transcription in the
rpoH mutants. The existence of a
multiple RpoH-like
factor(s), as was found in B. japonicum, seems unlikely, because neither proteins that can
cross-react with anti-RpoH polyclonal antibodies nor a DNA fragment
that hybridizes with an rpoH fragment even with very low
stringencies was found in cell extracts or genomic DNA of
rpoH cells, respectively. However a very distant
relative of RpoH might exist and be responsible for basal transcription
of heat shock genes, including groE. Alternatively, the
vegetative sigma factor SigA, a
70 homolog, could
recognize the groE promoter, which has some similarity to
70 promoters, especially at its
35 region
(34). Also, the region upstream of
35 might be important
for the high basal activity of the groE promoter, since
deletion of bases
37 to
53 greatly reduces transcription from this
promoter (37); an AT stretch present in this region may act
like an UP element (29). In any event, the potentially high
basal activity specifically seen with the groE promoter may
provide a basis for negative control by the CIRCE-HrcA system
even in the absence of activation by RpoH, leading to efficient and
versatile regulation by the combination of two systems.
We found that the amount of RpoH increases markedly upon heat shock and
reaches a maximum at about 15 min. This induction seems to be
autoregulated primarily at the level of transcription initiated from an
RpoH-dependent promoter (19a), as reported in C. crescentus (26, 40). If that is the case, an additional mechanism(s) which not only triggers but also terminates the
positive-feedback circuit should exist for modulating RpoH induction.
Indeed, the induction of DnaK and ClpB peaks within 10 min after
temperature upshift, when the cellular level of RpoH still continues to
increase, suggesting that a certain mechanism controlling RpoH activity is involved. Further work on the regulation of RpoH in A. tumefaciens should reveal the nature of both conserved and
divergent strategies in the regulation of RpoH and of the heat shock
response in proteobacteria.
We are grateful to M. Kohiyama and C. Squires for providing
antibodies and to A. Oka for helpful discussion. We also thank Masako
Nakayama and Seiji Takahara for technical assistance.
| 1.
|
Andersson, S. G.,
A. Zomorodipour,
J. O. Andersson,
T. Sicheritz-Ponten,
U. C. Alsmark,
R. M. Podowski,
A. K. Naslund,
A. S. Eriksson,
H. H. Winkler, and C. G. Kurland.
1998.
The genome sequence of Rickettsia prowazekii and the origin of mitochondria.
Nature
396:133-140[Medline].
|
| 2.
|
Ausubel, F. M.,
R. Brent,
R. E. Kingston,
D. D. Moore,
J. G. Seidman,
J. A. Smith, and K. Struhl (ed.).
1987.
Current protocols in molecular biology.
Wiley, New York, N.Y
|
| 3.
|
Babst, M.,
H. Hennecke, and H. M. Fischer.
1996.
Two different mechanisms are involved in the heat-shock regulation of chaperonin gene expression in Bradyrhizobium japonicum.
Mol. Microbiol.
19:827-839[Medline].
|
| 4.
|
Baldini, R. L.,
M. Avedissian, and S. L. Gomes.
1998.
The CIRCE element and its putative repressor control cell cycle expression of the Caulobacter crescentus groESL operon.
J. Bacteriol.
180:1632-1641[Abstract/Free Full Text].
|
| 5.
|
Ballard, S. A.,
M. Go,
R. Segers, and B. Adler.
1998.
Molecular analysis of the dnaK locus of Leptospira interrogans serovar copenhageni.
Gene
216:21-29[Medline].
|
| 6.
|
Davis, B. D.
1949.
Isolation of biochemically deficient mutants of bacteria by means of penicillin.
Proc. Natl. Acad. Sci. USA
35:1-10[Free Full Text].
|
| 7.
|
Ferreyra, R. G.,
F. C. Soncini, and A. M. Viale.
1993.
Cloning, characterization, and functional expression in Escherichia coli of chaperonin (groESL) genes from the phototrophic sulfur bacterium Chromatium vinosum.
J. Bacteriol.
175:1514-1523[Abstract/Free Full Text].
|
| 8.
|
Glatz, A.,
I. Horvath,
V. Varvasovszki,
E. Kovacs,
Z. Torok, and L. Vigh.
1997.
Chaperonin genes of the Synechocystis PCC 6803 are differentially regulated under light-dark transition during heat stress.
Biochem. Biophys. Res. Commun.
239:291-297[Medline].
|
| 9.
|
Grandvalet, C.,
G. Rapoport, and P. Mazodier.
1998.
hrcA, encoding the repressor of the groEL genes in Streptomyces albus G, is associated with a second dnaJ gene.
J. Bacteriol.
180:5129-5134[Abstract/Free Full Text].
|
| 10.
|
Gross, C. A.
1996.
Function and regulation of the heat shock proteins, p. 1382-1399.
In
F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology. ASM Press, Washington, D.C.
|
| 11.
|
Hirayama, T.,
T. Muranaka,
H. Ohkawa, and A. Oka.
1988.
Organization and characterization of the virCD genes from Agrobacterium rhizogenes.
Mol. Gen. Genet.
213:229-237[Medline].
|
| 12.
|
Holsters, M.,
B. Silva,
F. Van Vliet,
C. Genetello,
M. De Block,
P. Dhaese,
A. Depicker,
D. Inze,
G. Engler, and R. Villarroel.
1980.
The functional organization of the nopaline A. tumefaciens plasmid pTiC58.
Plasmid
3:212-230[Medline].
|
| 13.
|
Huang, L. H.,
Y. H. Tseng, and M. T. Yang.
1998.
Isolation and characterization of the Xanthomonas campestris rpoH gene coding for a 32-kDa heat shock sigma factor.
Biochem. Biophys. Res. Commun.
244:854-860[Medline].
|
| 14.
|
Ishiai, M.,
C. Wada,
Y. Kawasaki, and T. Yura.
1992.
Mini-F plasmid mutants able to replicate in Escherichia coli deficient in the DnaJ heat shock protein.
J. Bacteriol.
174:5597-5603[Abstract/Free Full Text].
|
| 15.
|
Karls, R. K.,
J. Brooks,
P. Rossmeissl,
J. Luedke, and T. J. Donohue.
1998.
Metabolic roles of a Rhodobacter sphaeroides member of the 32 family.
J. Bacteriol.
180:10-19[Abstract/Free Full Text].
|
| 16.
|
Kullik, I.,
S. Fritsche,
H. Knobel,
J. Sanjuan,
H. Hennecke, and H. M. Fischer.
1991.
Bradyrhizobium japonicum has two differentially regulated, functional homologs of the 54 gene (rpoN).
J. Bacteriol.
173:1125-1138[Abstract/Free Full Text].
|
| 17.
|
Kusukawa, N., and T. Yura.
1988.
Heat shock protein GroE of Escherichia coli: key protective roles against thermal stress.
Genes Dev.
2:874-882[Abstract/Free Full Text].
|
| 18.
|
Mogk, A.,
G. Homuth,
C. Scholz,
L. Kim,
F. X. Schmid, and W. Schumann.
1997.
The GroE chaperonin machine is a major modulator of the CIRCE heat shock regulon of Bacillus subtilis.
EMBO J.
16:4579-4590[Medline].
|
| 19.
|
Mogk, A.,
A. Volker,
S. Engelmann,
M. Hecker,
W. Schumann, and U. Volker.
1998.
Nonnative proteins induce expression of the Bacillus subtilis CIRCE regulon.
J. Bacteriol.
180:2895-2900[Abstract/Free Full Text].
|
| 19a.
| Nakahigashi, K. Unpublished results.
|
| 20.
|
Nakahigashi, K.,
M. Kanemori,
M. Morita,
H. Yanagi, and T. Yura.
1998.
Conserved function and regulation of 32 homologues in Gram-negative bacteria.
J. Biosci.
23:407-414.
|
| 21.
|
Nakahigashi, K.,
H. Yanagi, and T. Yura.
1995.
Isolation and sequence analysis of rpoH genes encoding 32 homologs from gram negative bacteria: conserved mRNA and protein segments for heat shock regulation.
Nucleic Acids Res.
23:4383-4390.
|
| 22.
|
Nakahigashi, K.,
H. Yanagi, and T. Yura.
1998.
Regulatory conservation and divergence of 32 homologs from Gram-negative bacteria: Serratia marcescens, Proteus mirabilis, Pseudomonas aeruginosa, and Agrobacterium tumefaciens.
J. Bacteriol.
180:2402-2408[Abstract/Free Full Text].
|
| 23.
|
Narberhaus, F.
1999.
Negative regulation of bacterial heat shock genes.
Mol. Microbiol.
31:1-8[Medline].
|
| 24.
|
Narberhaus, F.,
P. Krummenacher,
H. M. Fischer, and H. Hennecke.
1997.
Three disparately regulated genes for 32-like transcription factors in Bradyrhizobium japonicum.
Mol. Microbiol.
24:93-104[Medline].
|
| 25.
|
Record, M. T., Jr.,
W. S. Reznikoff,
M. L. Craig,
K. L. McQuade, and P. J. Cshlax.
1996.
Escherichia coli RNA polymerase (E 70), promoters, and the kinetics of the steps of transcription initiation, p. 792-821.
In
F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology. ASM Press, Washington, D.C.
|
| 26.
|
Reisenauer, A.,
C. D. Mohr, and L. Shapiro.
1996.
Regulation of a heat shock 32 homolog in Caulobacter crescentus.
J. Bacteriol.
178:1919-1927[Abstract/Free Full Text].
|
| 27.
|
Roberts, R. C.,
C. Toochinda,
M. Avedissian,
R. L. Baldini,
S. L. Gomes, and L. Shapiro.
1996.
Identification of a Caulobacter crescentus operon encoding hrcA, involved in negatively regulating heat-inducible transcription, and the chaperone gene grpE.
J. Bacteriol.
178:1829-1841[Abstract/Free Full Text].
|
| 28.
|
Ron, E. Z.,
G. Segal,
M. Robinson, and D. Graur.
1998.
Control elements in the regulation of bacterial heat shock response, p. 143-152.
In
E. Rosenberg (ed.), Microbial ecology and infectious disease. ASM Press, Washington, D.C.
|
| 29.
|
Ross, W.,
K. K. Gosink,
J. Salomon,
K. Igarashi,
C. Zou,
A. Ishihama,
K. Severinov, and R. L. Gourse.
1993.
A third recognition element in bacterial promoters: DNA binding by the subunit of RNA polymerase.
Science
262:1407-1413[Abstract/Free Full Text].
|
| 30.
|
Sahu, G. K.,
R. Chowdhury, and J. Das.
1997.
The rpoH gene encoding 32 homolog of Vibrio cholerae.
Gene
189:203-207[Medline].
|
| 31.
|
Sato, S., and H. Ishikawa.
1997.
Expression and control of an operon from an intracellular symbiont which is homologous to the groE operon.
J. Bacteriol.
179:2300-2304[Abstract/Free Full Text].
|
| 32.
|
Schafer, A.,
A. Tauch,
W. Jager,
J. Kalinowski,
G. Thierbach, and A. Puhler.
1994.
Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutamicum.
Gene
145:69-73[Medline].
|
| 33.
|
Schulz, A., and W. Schumann.
1996.
hrcA, the first gene of the Bacillus subtilis dnaK operon, encodes a negative regulator of class I heat shock genes.
J. Bacteriol.
178:1088-1093[Abstract/Free Full Text].
|
| 34.
|
Segal, G., and E. Z. Ron.
1993.
Heat shock transcription of the groESL operon of Agrobacterium tumefaciens may involve a hairpin-loop structure.
J. Bacteriol.
175:3083-3088[Abstract/Free Full Text].
|
| 35.
|
Segal, G., and E. Z. Ron.
1995.
The dnaKJ operon of Agrobacterium tumefaciens: transcriptional analysis and evidence for a new heat shock promoter.
J. Bacteriol.
177:5952-5958[Abstract/Free Full Text].
|
| 36.
|
Segal, G., and E. Z. Ron.
1995.
The groESL operon of Agrobacterium tumefaciens: evidence for heat shock-dependent mRNA cleavage.
J. Bacteriol.
177:750-757[Abstract/Free Full Text].
|
| 37.
|
Segal, G., and E. Z. Ron.
1996.
Heat shock activation of the groESL operon of Agrobacterium tumefaciens and the regulatory roles of the inverted repeat.
J. Bacteriol.
178:3634-3640[Abstract/Free Full Text].
|
| 38.
|
Segal, G., and E. Z. Ron.
1996.
Regulation and organization of the groE and dnaK operons in Eubacteria.
FEMS Microbiol. Lett.
138:1-10[Medline].
|
| 39.
|
Tan, M.,
B. Wong, and J. N. Engel.
1996.
Transcriptional organization and regulation of the dnaK and groE operons of Chlamydia trachomatis.
J. Bacteriol.
178:6983-6990[Abstract/Free Full Text].
|
| 40.
|
Wu, J., and A. Newton.
1997.
The Caulobacter heat shock sigma factor gene rpoH is positively autoregulated from a 32-dependent promoter.
J. Bacteriol.
179:514-521[Abstract/Free Full Text].
|
| 41.
|
Yuan, G., and S. L. Wong.
1995.
Isolation and characterization of Bacillus subtilis groE regulatory mutants: evidence for orf39 in the dnaK operon as a repressor gene in regulating the expression of both groE and dnaK.
J. Bacteriol.
177:6462-6468[Abstract/Free Full Text].
|
| 42.
|
Yura, T.,
H. Nagai, and H. Mori.
1993.
Regulation of the Escherichia coli heat-shock response.
Annu. Rev. Microbiol.
47:321-350[Medline].
|
| 43.
|
Zuber, U., and W. Schumann.
1994.
CIRCE, a novel heat shock element involved in regulation of heat shock operon dnaK of Bacillus subtilis.
J. Bacteriol.
176:1359-1363[Abstract/Free Full Text].
|