Previous Article | Next Article 
Journal of Bacteriology, December 1999, p. 7531-7544, Vol. 181, No. 24
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Genetic and Functional Analyses of the Conserved
C-Terminal Core Domain of Escherichia coli FtsZ
Xiaolan
Ma and
William
Margolin*
Department of Microbiology and Molecular
Genetics, University of Texas
Houston Medical School, Houston,
Texas 77030
Received 8 July 1999/Accepted 6 October 1999
 |
ABSTRACT |
In Escherichia coli, FtsZ is required for the
recruitment of the essential cell division proteins FtsA and ZipA to
the septal ring. Several C-terminal deletions of E. coli
FtsZ, including one of only 12 amino acids that removes the highly
conserved C-terminal core domain, failed to complement chromosomal
ftsZ mutants when expressed on a plasmid. To identify key
individual residues within the core domain, six highly conserved
residues were replaced with alanines. All but one of these mutants
(D373A) failed to complement an ftsZ chromosomal mutant.
Immunoblot analysis demonstrated that whereas I374A and F377A proteins
were unstable in the cell, L372A, D373A, P375A, and L378A proteins were
synthesized at normal levels, suggesting that they were specifically
defective in some aspect of FtsZ function. In addition, all four of the
stable mutant proteins were able to localize and form rings at
potential division sites in chromosomal ftsZ mutants,
implying a defect in a function other than localization and
multimerization. Because another proposed function of FtsZ is the
recruitment of FtsA and ZipA, we tested whether the C-terminal core
domain was important for interactions with these proteins. Using two
different in vivo assays, we found that the 12-amino-acid truncation of
FtsZ was defective in binding to FtsA. Furthermore, two point mutants
in this region (L372A and P375A) showed weakened binding to FtsA. In
contrast, ZipA was capable of binding to all four stable point mutants
in the FtsZ C-terminal core but not to the 12-amino-acid deletion.
 |
INTRODUCTION |
FtsZ plays a key regulatory and
structural role during bacterial cell division. It self-assembles into
a ring structure on the inner face of the cytoplasmic membrane at the
division site and remains at the leading edge of the invaginating
septum (6, 28, 33). The FtsZ concentration appears to be an
important regulator of its assembly into the ring, because too little
FtsZ results in few rings and the formation of nonseptate filaments while a moderate excess of FtsZ results in division at the cell poles
in addition to midcell (10, 36). Because the midcell localization of all of the other known essential cell division proteins
requires FtsZ, the FtsZ ring is postulated to form the framework that
recruits other components of the putative division machinery. FtsZ has
been shown to interact directly with FtsA and ZipA (12, 14, 21,
34) and appears to recruit them independently to the FtsZ ring
(3, 15, 16, 19). Because many, and perhaps all, of the
periplasmic cell division proteins depend upon FtsA for proper
localization, and FtsA is well conserved in many bacteria, FtsA may
serve as a molecular bridge between the FtsZ ring and the periplasmic proteins.
FtsZ can be thought of as a bacterial cytoskeletal organizer
(22). This idea is especially compelling because of the
functional and structural homology between FtsZ and tubulin, the key
eukaryotic cytoskeletal protein. The crystal structures of FtsZ and
tubulin exhibit striking similarities (17). Like tubulin,
FtsZ hydrolyzes GTP (11, 25, 31), forms protofilaments in
vitro (7, 13) whose assembly depends on GTP (26,
37), and has a similar response to hydrophobic probes
(38). The cytoskeletal behavior of FtsZ is also evident in
the spiral-shaped septa formed by similarly spiral-shaped FtsZ
polymers, indicating that the shape of the FtsZ structure can determine
the shape of the resulting septum (2).
Chloroplasts and nearly all prokaryotes have an FtsZ homolog.
Based on sequence alignments among the many species from which it
has been isolated, FtsZ can be divided into three major domains: a
large, conserved N terminus, a variable linker domain, and a small,
highly conserved C terminus. The N-terminal region of approximately 320 residues is highly conserved throughout all FtsZs and includes the GTP
binding motif that is also found in tubulins. The crystal structure of
Methanococcus jannaschii FtsZ shows that residues 38 to 227 in this region form a Rossmann fold-like GTPase domain (17).
We previously reported that a truncated Escherichia coli FtsZ containing only this N-terminal domain (amino acids 1 to 316)
fused to GFP was able to form large fluorescent polymers in vivo and in
vitro (19, 37). This indicated that the C terminus is
dispensable for polymerization. In contrast, a deletion of 38 residues
at the extreme N terminus abolished the localization of FtsZ-GFP
protein to rings in vivo, suggesting that the N terminus of FtsZ is
essential for ring assembly (19). Similar conclusions have
been drawn from yeast two-hybrid studies of self-association of FtsZ
(12, 34).
The linker domain is characterized by the variability of its sequence
and its length. While this region is fairly short in most organisms, on
the order of 40 to 50 amino acids, several
-proteobacterial species
contain large linkers of 150 to 200 amino acids that are proline and
glutamine rich (23, 29). The specific function of this
linker region has not yet been addressed.
Finally, the extreme C-terminal region is variable in length but
contains a small consensus sequence of 6 to 8 highly conserved residues
that we refer to as the C-terminal core domain (Fig. 1). The core is conserved throughout most
bacteria and chloroplasts, but not the archaea. The extreme C terminus
of the M. jannaschii FtsZ, therefore, lacks the sequence
conservation of the bacterial core domains; in addition, it was
disordered in the crystal and hence not resolved (17). As a
result, the structure and function of the core has not been studied in
detail.

View larger version (43K):
[in this window]
[in a new window]
|
FIG. 1.
Alignment of C-terminal core domains of diverse FtsZ
homologs; the bottom two are plant chloroplast homologs. The invariant
proline residue, corresponding to P375 of E. coli FtsZ, is
highlighted in boldface. The underlined residues denote residues
changed in this study to an alanine. Arabidopsis thaliana
FtsZ refers to one of at least two chloroplast homologs; the other
homolog lacks the homology to the core. Archaeal FtsZs also lack this
domain, as do those from other Mycoplasma species.
|
|
Recently, it was found that a Caulobacter crescentus FtsZ
with the C-terminal 24 residues, including the core domain, deleted displayed a dominant-negative phenotype and was unable to interact with
FtsA in a yeast two-hybrid assay (12). Although this study did not specifically pinpoint the core residues, it suggested that this
domain is important for the FtsZ-FtsA interaction. In addition, studies
with an FtsZ with the entire C-terminal domain (linker plus core)
deleted indicated that either the linker domain, the C-terminal core,
or both are required for recruitment of FtsA and/or ZipA (12,
16). However, the core domain was not specifically targeted in
these studies.
In this paper, we characterize the functional domains of the C terminus
of FtsZ by constructing a series of C-terminal truncations and point
mutations in E. coli ftsZ. We then test the abilities of
these mutant proteins to localize and interact with FtsA and ZipA. Our
data suggest that the extreme C terminus of FtsZ is not required for
its localization but may be important for its interaction with FtsA and
ZipA. Alteration of several consensus residues in the core region
appears to affect only the interaction with FtsA. Furthermore, several
of these point mutant FtsZs display dominant-negative phenotypes.
 |
MATERIALS AND METHODS |
Bacterial strains and growth conditions.
E. coli
strains and plasmids are listed in Table
1. Strain JM105, containing
lacIq on an F' plasmid, was used as the
wild-type E. coli host strain. JFL101 (obtained from J. Lutkenhaus, University of Kansas Medical Center), containing the
ftsZ84(Ts) allele, was used as the thermosensitive ftsZ mutant strain. The ftsZ depletion strain,
here designated WM746, is WX7/pCX41 (35) and was obtained
from W. Cook and L. Rothfield, University of Connecticut Health Center.
The standard growth medium was Luria-Bertani (LB) medium, containing
0.5% NaCl, or LBNS, which contains no added NaCl. This medium was
supplemented with ampicillin (50 µg per ml), chloramphenicol (20 µg
per ml), or tetracycline (10 µg per ml) when needed. E. coli wild-type strains were grown at 37°C, while
temperature-sensitive strains were grown at 32°C (permissive) or 42 to 44°C (nonpermissive) on LBNS medium containing appropriate
antibiotics.
Plasmid construction.
The C-terminal truncation mutants of
ftsZ were generated by PCR amplification. A single forward
primer (5'AAGAGCTCGGAGAGAAACTATG) was used, which includes
the ftsZ native ribosome binding site as well as a
SacI site at the 5' end. The reverse primers were designed
to be complementary to the sequences encoding different regions of the
FtsZ C terminus and also included a stop codon as well as an
XbaI site at the 5' end. Primers for the FtsZ-GFP fusion
proteins, corresponding to these C-terminally truncated FtsZ mutants,
did not contain a stop codon and were in frame with the sequence
encoding the N terminus of GFP. The sequences of the reverse primers
for generating these FtsZ C-terminal deletion mutants were as follows:
5'AATCTAGATTAATAATCCGGCTCTTTCG (Z
C1), 5'TTTTCTAGATTAGTCATTCACGACTTTAG (Z
C1.1),
5'AAATCTAGATTACGGAGCCATCCCATGC (Z
C1.2),
5'AAATCTAGATTAAACCTGCTTATTGGTC (Z
C1.3), and
5'AATCTAGATTAGCCGATACCTGTCGCAAC (Z
C2). The sequences of
the reverse primers for constructing the corresponding FtsZ-GFP fusion
proteins were 5'AATCTAGAATAATCCGGCTCTTTCG (Z
C1),
5'AAATCTAGAGCCGATACCTGTCGCAAC (Z
C2),
5'AAATCTAGAGATAACCACAGTCGCG (Z
C3), and
5'AAATCTAGACTCATCCAGACGCAGG (Z
C4).
E. coli ftsZ derivatives were amplified by PCR from plasmid
pZAQ (
36) containing
E. coli ftsQAZ. The PCR
products were cleaved
with
SacI and
XbaI and
cloned into
SacI- and
XbaI-cleaved pBC
or pGBC.
Derivatives of
ftsZ were then subcloned into pMK4, a
pWM176
derivative that carries a copy of wild-type
ftsZ between
the
XhoI and
SacI sites that is under
tac
promoter control. To
replace part of the wild-type
ftsZ in
pMK4,
KpnI-
SmaI fragments
of
ftsZ
derivatives in pBC were ligated to
KpnI/
Ecl136II-cleaved
pMK4.
Point mutations in
ftsZ were generated by site-directed
mutagenic PCR as previously described (
8). The sequences of
the
mutagenic primers were 5'CGAAAGAGCCGGATTATGCGGATATCCCAGCATTCC
for ZL372A, 5'GATTATCTGGATATCGCAGCATTCCTGCG for
ZD373A, 5'CGGATTATCTGGATGCCCCAGCATTCCTGCGTAAG
for ZI374A,
5'GCCGGATTATCTGGCTATCCCAGCATTCC for ZP375A,
5'TATCTGGATATCCCAGCAGCCCTGCGTAAGCAAGCTG
for ZF377A, and
5'GGATATCCCAGCATTCGCGCGTAAGCAAGCTGATTAA for ZL378A.
The PCR
products were digested with
BstEII and
ClaI to
yield fragments
of approximately 600 bp, of which 200 bp encode the C
terminus
of FtsZ. These fragments were then cloned into the
BstEII and
ClaI sites of pZG, a derivative of pBC
that carries
ftsZ-GFP,
to replace the sequence encoding the
corresponding region of
ftsZ and the downstream GFP coding
region with the point mutations.
All the point mutations were confirmed
by DNA sequencing. To move
the mutant
ftsZs residing in pZG
to pMK4, the plasmids were digested
first with
XhoI,
followed by a fill in of the
XhoI overhang with
Klenow
fragment, and then digested with
KpnI. The fragments
harboring
the mutant
ftsZs were subcloned into
KpnI/
Ecl136II-cleaved pMK4.
The expression and
integrity of FtsZ mutants were confirmed by
immunoblotting with
affinity-purified polyclonal anti-FtsZ.
The
zipA gene was amplified by PCR directly from
E. coli genomic DNA with the upstream primer
5'AAGAGCTCAACAGAGAATATAATGATG
and the downstream primer
5'AATCTAGAGGCGTTGGCGTCTTTG. The PCR
fragment was cleaved
with
SacI and
XbaI and cloned into the
SacI
and
XbaI sites of a derivative of pGBC that
contains a copy of
lacIq at the
EcoRI
site. This procedure placed
zipA under
lac
control
and in frame with the downstream GFP coding sequence. To place
zipA-GFP under arabinose regulation, it was subcloned into
pBAD30
between the
SacI and
SalI
sites.
Complementation tests.
To test the function of the FtsZ
mutant alleles, we transformed the versions cloned in pWM176 into
JFL101 and WM1099, an ftsZ84(Ts) mutant and an
ftsZ depletion strain, respectively. Because pWM176 derivatives and the original ftsZ depletion strain, WM746,
were both tetracycline resistant (Tetr), WM746 was made
Tets by replacing the linked Tetr marker in
leu with a Kanr marker from CAG12131 by P1
transduction; the resulting strain became WM1099.
For complementation experiments, derivatives of pWM176 in JFL101 were
tested for colony growth on LBNS agar containing 10
to 40 µM
isopropyl

-
D-thiogalactoside (IPTG) at both 32 and
42°C.
For pWM176 derivatives in WM1099, colony growth was tested on
LB agar with tetracycline and 5 to 20 µM IPTG at both 32 and 44°C.
IPTG concentrations above 20 µM caused significant inhibition
of
colony growth at both 32 and 44°C in WM1099 derivatives carrying
plasmids expressing
ftsZ. Because
ftsZ depletion
takes several
cell cycles to occur, background growth was often
observed for
the WM1099 and WM1099/pWM176 controls at 44°C.
Immunoblot analysis.
JFL101 cells containing the
ftsZ derivatives in pWM176 were grown at 30°C to
exponential phase and then induced with 10 µM IPTG for 90 min at
42°C. JM105 cells harboring the same plasmids were induced with 5 µM IPTG for 3 h at 37°C. The cells were then collected, and
total protein was quantitated with the bicinchoninic acid protein assay
(Pierce). A total of 25 µg of protein for each sample was separated
on sodium dodecyl sulfate-12% polyacrylamide gels and transferred to
nitrocellulose membranes (0.45-µm pore size; Micron Separations
Inc.). The amplified alkaline phosphatase Immuno-Blot Kit (Bio-Rad) was
then used for immunoblotting. Purified anti-FtsZ antiserum at 1:200
dilution was used as the primary antibody, and biotinylated goat
anti-rabbit immunoglobulin G at 1:1,000 dilution was used as the
secondary antibody.
Yeast two-hybrid analysis.
The Saccharomyces
cerevisiae host strain L40 carries a LexA binding DNA sequence
fused with lacZ on the chromosome, so the expression of
lacZ can be activated upon binding of LexA (5). The plasmids used were pACT2.2, containing the GAL4 activation domain
(obtained from S. Elledge, Baylor College of Medicine), and pLEXA,
containing the LexA DNA binding domain (obtained from J. Jones, M. D. Anderson Cancer Center). To clone ftsA into pLEXA, ftsA was amplified by PCR, using
5'AAACATATGATCAAGGCGACGGAC as the upstream primer and
5'TTTGGATCCTTAAAACTCTTTTCGC as the downstream primer. The
PCR product was digested with NdeI, followed by fill in of
the overhangs with Klenow fragment and digestion with BamHI. The cleaved product was ligated to
SmaI/BamHI-cleaved pLEXA, and the resulting
plasmid was designated pWM1208. For cloning ftsZ into
pACT2.2, ftsZ was amplified by PCR with
5'AACATATGTTGAACCAATGGAAC as the upstream primer and
5'AAGGATCCATCAGCTTGCTTACGC as the downstream primer. The PCR
fragment was cleaved with NdeI and BamHI and
cloned into the NdeI and BamHI sites of
pBCIISK(+). The C-terminal ftsZ mutant alleles were cloned
into the same vector by replacing the C-terminal coding region of
ftsZ in pBCII-ftsZ between the SacII site within ftsZ and the BamHI site. The
ftsZ gene and its mutant derivatives were subcloned between
the NdeI and BamHI sites on pACT2.2. These two
plasmids (pWM1208 and pACT2.2-ftsZ or its derivatives) were
then transformed into the yeast reporter strain L40.
-Galactosidase activities were estimated by using a filter assay, with X-Gal (5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside) as a
substrate (4).
Microscopic techniques.
Immunofluorescence staining in
combination with phase-contrast imaging and nucleoid staining with
4',6-diamidino-2-phenylindole (DAPI) were carried out as described
previously (39) with minor modifications. The concentration
of lysozyme used to permeabilize the cells was varied from 0.8 to 2 mg
per ml for different strains to obtain the best results. For FtsZ
staining, we used affinity-purified anti-FtsZ at a final dilution of
1:20. To stain FtsA-GFP or ZipA-GFP, polyclonal anti-GFP antiserum was
used at a 1:200 dilution. To generate the anti-GFP, we purified GFP
from a strain carrying the mut2GFP-overproducing plasmid
(9). The antigen was sent to Cocalico Biologicals Inc.
(Reamstown, Pa.) for antibody production in rabbits. Anti-FtsZ was
similarly obtained from rabbits by using purified overproduced E. coli FtsZ as an antigen and was subsequently affinity purified.
All microscopic images were taken on an Olympus BX60 microscope,
captured in RGB mode with an Optronics DEI-750 camera and a Scion CG-7
frame grabber, and manipulated in Adobe Photoshop. The images were
changed to grayscale mode for publication.
 |
RESULTS |
Function of C-terminal deletions of FtsZ.
To identify the
C-terminal domains of E. coli FtsZ required for in vivo
function, we constructed a series of C-terminal deletions of E. coli ftsZ (Fig. 2) and placed them
under the control of the IPTG-inducible tac promoter in the
IncP plasmid derivative pWM176 (24). We first examined
whether the mutant ftsZs were capable of complementing
the ftsZ84 temperature-sensitive strain JFL101, which
is nonviable at 42°C. A strain containing pMK4 (pWM176 carrying the
wild-type ftsZ) was unable to form colonies on LBNS plates
at 42°C in the absence of IPTG, indicating that uninduced expression
of ftsZ from the plasmid was insufficient to support cell
division. Therefore, different IPTG concentrations were used to induce
complementing levels of FtsZ. In a range of 10 to 40 µM IPTG, strains
harboring pMK4 but not pWM176 formed fast-growing colonies with normal
plating efficiency at 42°C, confirming complementation of the
ftsZ84 mutant by the wild-type ftsZ on pMK4. When
identical induction conditions were used with the deletion derivatives, none of these, including an N-terminal-deletion control, were able to
complement ftsZ84 (Table 2).

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 2.
FtsZ truncation and point mutant derivatives. ZC*
represents six mutants with single-residue changes in the C-terminal
core. Slanted hatches represent the N-terminal conserved domain,
horizontal hatches represent the C-terminal core, and the checkered
pattern indicates the C-terminal core that contains mutations. The
numbers indicate the beginning or ending residues relative to those of
wild-type FtsZ. Z C2, Z C3, Z C4, and Z N all contain
C-terminal GFP fusions (see Materials and Methods).
|
|
To verify these results, we performed similar complementation tests in
an
ftsZ depletion strain, WM1099. The chromosomal copy
of
ftsZ in this strain is inactivated by a frameshift mutation,
and viability depends upon an additional copy of
ftsZ on a
plasmid
that is temperature sensitive for replication (
35).
The
ftsZ plasmid pMK4 or its deletion derivatives were
introduced into
WM1099, and growth of the transformants was examined at
both 32
and 44°C. In the presence of 5 µM IPTG, growth of WM1099
containing
pMK4 (wild-type
ftsZ) was no longer temperature
sensitive, whereas
WM1099 containing the vector control (pWM176) or any
of the
ftsZ deletion mutants failed to form colonies with
normal efficiency
at 44°C. In summary, all the deletion mutants were
defective in
complementing either the
ftsZ null or the
ftsZ84(Ts) mutant (Table
2).
Interestingly, one of the
ftsZ deletion mutants, Z

C1.1
(remaining amino acids, 1 to 360), exhibited a dominant-negative
phenotype
when expressed in the wild-type strain JM105 or in JFL101
(
ftsZ84).
Colonies carrying pWM930 (Z

C1.1) grew very
poorly on LB plates
at 32°C with 20 µM or higher concentrations of
IPTG. When inoculated
into LB broth with 5 µM IPTG, cells carrying
pWM930 started filamenting
and reached an average length of 8 cell
units after 3 h of growth.
In contrast, under the same induction
conditions, cells expressing
wild-type
ftsZ from pMK4 or
other truncation mutants remained
normal in length (data not
shown).
Function of point mutations in the C-terminal core of FtsZ.
The failure of Z
C1 (amino acids 1 to 371; pWM737), which lacks only
the C-terminal 12 residues, to complement the ftsZ84(Ts) or
the ftsZ null mutant suggested that residues 372 to 383 are essential for the full function of FtsZ. Sequence alignments of FtsZs
from different species revealed that this extreme C terminus is quite
highly conserved, with at least 6 residues present in most FtsZs and a
central proline residue, corresponding to P375 of E. coli
FtsZ, that is particularly well conserved (Fig. 1). To identify the
critical amino acids in this region, we constructed six ftsZ
mutant alleles with each conserved residue individually changed to
alanine (Fig. 2). Five of these point mutants (ZL372A, ZI374A, ZP375A,
ZF377A, and ZL378A) failed to complement either the
ftsZ84(Ts) or the ftsZ null mutant (Table 2).
Three mutant FtsZ derivatives (ZL372A, ZI374A, and ZP375A) exhibited a
dominant-negative phenotype similar to that of Z
C1.1 (Table 2).
In addition, ZI374A and ZF377A were unstable. By immunoblotting with
anti-FtsZ antibodies, we found that cells synthesizing
ZI374A displayed
a truncated polypeptide that was approximately
4 to 5 kDa smaller than
wild-type FtsZ protein (Fig.
3, lane 5).
ZF377A was largely degraded in both JFL101 (
ftsZ84) and the
WM1099
depletion strain at 42°C (Fig.
3B, lane 7, and data not
shown),
with a 10-kDa band visible on immunoblots (data not
shown). Interestingly,
however, ZF377A was synthesized as a full-length
protein in the
wild-type JM105 strain at either 32 or 42°C
(Fig.
3A, lane 7,
and data not shown). As mentioned above,
ZI374A, although truncated,
was very toxic to both wild-type JM105 and
JFL101 (
ftsZ84) cells
and therefore was judged to
have a dominant-negative effect similar
to that of Z

C1.1.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 3.
Western blot analysis of FtsZ and its derivatives
expressed in JM105 (wild type) and JFL101 (ftsZ84). (A)
JM105 derivatives were grown exponentially at 37°C and then induced
with 5 µM IPTG for 180 min. (B) JFL101 derivatives were grown at
42°C for 30 min before being induced with 10 µM IPTG for 90 min.
The cells were then collected, and total protein was quantitated by
bicinchoninic protein assay (Pierce). An equivalent amount of protein
(25 µg) was loaded onto each lane, followed by sodium dodecyl
sulfate-polyacrylamide gel electrophoresis and immunoblotting.
Lane 1, cells containing pWM176; lane 2, pMK4 (wild-type
ftsZ); lane 3, pWM1202 (ZL372A); lane 4, pWM738
(ZD373A); lane 5, pWM1203 (ZI374A); lane 6, pWM739 (ZP375A); lane 7, pWM1204 (ZF377A); lane
8, pWM1205 (ZL378A); lane 9, pWM737 (Z C1);
lane 10, pWM930 (Z C1.1); lane 11, pWM931
(Z C1.2); lane 12, pWM932 (Z C1.3); lane 13, pWM1201 (Z C2).
|
|
To ensure that differences in complementation and dominant-negative
effects were not caused by significant variations in protein
levels, we
measured cellular protein levels in JM105 and JFL101
containing the
various
ftsZ plasmids. After induction with 5 µM
IPTG for
3 h, cells of the JM105 wild-type strain expressing the
wild-type
FtsZ (from pMK4) were 1 to 2 cell units in length, whereas
cells
synthesizing dominant-negative mutant proteins (ZL372A,
ZI374A, ZP375A,
and Z

C1.1) had already formed filaments with
an average cell length
of 8 cell units. Cells expressing other
mutant
ftsZs,
defined as not being dominant negative, were roughly
2 cell units in
length. After this microscopic inspection, the
FtsZ levels from these
cells were measured by immunoblotting.
The results indicated that the
cellular levels of different FtsZ
derivatives in JM105, as normalized
to total cell protein, did
not vary significantly (Fig.
3A). The levels
of the deletion derivatives
(Fig.
3A, lanes 10 to 13 [lower bands])
appeared to be consistently
lower than those of the point mutants
(lanes 4, 6, 7, 8 [which
include both endogenous FtsZ and the point
mutant FtsZs in the
same band] and lane 5 [lower band]) as judged by
band intensities.
We suspect that one reason for lower signals from the
deletions
might be that the majority of antigenic epitopes on FtsZ are
at
the C terminus; deletion of this region might result in less
efficient
cross-reactivity with the polyclonal antibodies. The FtsZ
band
intensities on the immunoblots were quantitated and found to
be
approximately 40 to 70% of the level of the endogenous FtsZ.
These
results suggest that ZL372A, ZI374A, ZP375A, and Z

C1.1
negatively
affect cell division not because they are present at
abnormally
high levels but because they interfere with the function of
the
wild-type protein when they are at similar levels. In contrast,
wild-type FtsZ only inhibits division when overproduced to higher
than
sevenfold native levels (
36).
In the case of JFL101 derivatives, immunoblots consistently revealed an
approximately threefold-lower level of endogenous
FtsZ84 compared to
that of endogenous FtsZ in JM105 cells at 42°C
(compare lanes 1 in
Fig.
3A and B) as well as 32°C (data not shown).
As a result, levels
of the mutant FtsZ proteins expressed in JFL101
appeared to be
approximately sixfold higher than the endogenous
FtsZ84, even though
most were at about the same absolute levels
as in JM105 (compare lanes
2 to 6, 8 to 9, and 11 to 13 in Fig.
3A and B). Only Z

C1.1 seemed to
be at higher levels in JFL101
than in JM105 (compare lanes 10 in Fig.
3A and B), and, as mentioned
earlier, ZF377A was degraded only in
JFL101 (compare lanes 7 in
Fig.
3A and B). The significance of the
lower FtsZ84 levels is
unclear, although this could be a factor in its
thermosensitivity.
Nevertheless, our data still indicate that the
failure of some
of our FtsZ mutant proteins to complement is not
because their
levels in the cell were inappropriately high or
low.
Localization patterns of FtsZ mutant derivatives.
When
synthesized from plasmids, GFP-tagged FtsZ derivatives lacking the
N-terminal 38 residues (Z
N, containing amino acids 38 to 383)
(19), the C-terminal 89 residues (Z
C3 with amino acids 1 to 294), or the C-terminal 119 residues (Z
C4 with amino acids 1 to
274) did not exhibit detectable fluorescent foci or rings in cells and
instead displayed unlocalized fluorescence (data not shown). These
observations, summarized in Table 3, suggest that residues 1 to 316 may be required for the proper localization of FtsZ to division sites.
To investigate the role of the C-terminal 67 residues (amino acids 317 to 383) in the proper targeting of FtsZ to the division
site, we
determined the subcellular localization of our short
FtsZ C-terminal
deletions (Z

C1 and Z

C2) and point mutants. To
distinguish between
the cloned mutant FtsZs and the endogenous
native FtsZ, we monitored
the localization patterns of FtsZs synthesized
from pWM176 derivatives
in the
ftsZ84(Ts) strain JFL101 and the
ftsZ
depletion strain WM1099. For JFL101, it was essential to
completely
inactivate the endogenous FtsZ (FtsZ84), which is defective
in GTPase
activity but can form functional FtsZ rings on its own
at temperatures
below 42°C (
1,
11,
31). FtsZ84 rings disappear
within 2 min after cells are incubated at 42°C (
1). Therefore,
to
ensure the endogenous FtsZ84 was inactivated, we grew cells
at 42°C
for 30 min before inducing expression of the cloned mutant
ftsZ derivatives with 10 µM IPTG for 60 min. The
localizations
of cloned FtsZ derivatives were examined by
immunofluorescence
microscopy (IFM) with anti-FtsZ antibodies. Under
the conditions
used, both wild-type and mutant FtsZs (except the
unstable ZF377A)
could localize to potential division sites, which
were revealed
by simultaneously staining nucleoids with DAPI
(Fig.
4). All the
mutant proteins (except
ZF377A) were able to form rings, as judged
from the sharp fluorescent
bands observed between nucleoids. Fig.
4C, showing ZL372A, and D,
showing Z

C1.3, represent typical patterns
for point and deletion
mutants, respectively, and were similar
to those exhibited by wild-type
FtsZ expressed from pMK4 (Fig.
4B) except that cells with pMK4 could
divide. In contrast, cells
containing the pWM176 vector control
exhibited unlocalized fluorescence
only (Fig.
4A). The formation of
FtsZ rings by the truncated ZI374A
under the same conditions (data not
shown) suggests that residues
1 to 316 are still present in this
truncated version.

View larger version (64K):
[in this window]
[in a new window]
|
FIG. 4.
Localization of FtsZ and its derivatives in JFL101
[ftsZ84(Ts)] cells. JFL101 derivatives containing various
plasmids were grown at 42°C for 30 min, induced with 10 µM IPTG for
60 min, and then fixed for staining. Simultaneously, FtsZ was stained
by anti-FtsZ and visualized by IFM (A to D), nucleoids were stained
with DAPI and visualized by fluorescence microscopy (A' to D'), and
cell morphologies were visualized by phase-contrast microscopy (A" to
D"). (A to A") JFL101 containing pWM176; (B to B")
JFL101 containing pMK4 (wild-type ftsZ); (C to C") JFL101
containing pWM1202 (ZL372A); (D to D") JFL101 containing
pWM932 (Z C1.3).
|
|
For FtsZ to be significantly depleted in strain WM1099, it was
necessary to rapidly deplete the temperature-sensitive plasmid
(pCX41)
that carries a copy of the
ftsZ gene. WM1099 cells were
grown at 42°C for 5 h until they became extremely filamentous
(approximately 32 cell units long on average) or when the endogenous
FtsZ protein was no longer detectable as bands on immunoblots
(data not
shown) or by IFM (Fig.
5A). At this time
point, expression
of the
ftsZ mutant alleles carried on
pWM176 was induced with
5 µM IPTG for 40 min. Cells expressing most
of the mutant FtsZ
proteins and the pWM176 vector control remained
filamentous, as
expected (Fig.
5A", C", D"). In contrast, expression of
wild-type
FtsZ from pMK4 induced rapid cell divisions and usually led
to
cells with normal length (Fig.
5B"), indicating that cell division
could be restored in these depleted cells. ZD373A, although it
complemented both
ftsZ84 and the
ftsZ null mutant
for colony formation
on plates, only induced divisions of some cells
while many cells
remained filamentous (data not shown). This result is
consistent
with the idea that colony formation is a less stringent
measurement
of normal cell division function than direct observation of
individual
dividing cells.

View larger version (57K):
[in this window]
[in a new window]
|
FIG. 5.
Localization of FtsZ and its derivatives in WM1099
(ftsZ depletion strain) cells. WM1099 derivatives were grown
at 42°C for 5 h before induction with 5 µM IPTG for 40 min and
fixation. Simultaneously, FtsZ was stained by anti-FtsZ and visualized
by IFM (A to D), nucleoids were stained with DAPI and visualized by
fluorescence microscopy (A' to D'), and cell morphologies were
visualized by phase-contrast microscopy (A" to D"). (A to A") WM1099
containing pWM176; (B to B") WM1099 with pMK4 (wild-type
ftsZ); (C to C") WM1099 with pWM1202 (ZL372A); (D
to D") WM1099 with pWM932 (Z C1.3).
|
|
We also used IFM to investigate FtsZ localization in the
ftsZ depletion strain WM1099. Cells synthesizing the FtsZ
point mutant
derivatives (with the exception of the unstable ZI374A and
ZF377A
proteins) exhibited regularly spaced sharp bands (Fig.
5C,
showing
immunostaining of ZL372A). These bands were presumably FtsZ
rings
and appeared similar to bands in cells synthesizing wild-type
FtsZ from pMK4 (Fig.
5B). Cells containing the pWM176 vector exhibited
only weak unlocalized fluorescence (Fig.
5A). The FtsZ bands were
located at potential division sites between nucleoids, as shown
by
double staining for FtsZ and nucleoids with DAPI. The FtsZ
deletion
derivatives (Z

C1,

C1.1 to -1.3, and

C2, all containing
residues 1 to 316) and ZI374A were also able to localize regularly
to
potential division sites; the frequency of localization, defined
as the
number of rings per unit cell length, was proportional
to the level of
induction by IPTG (data not shown). Interestingly,
however, these FtsZ
derivatives appeared as dots (Fig.
5D, showing
Z

C1.3) rather than
the sharp bands formed by the same derivatives
synthesized in JFL101
(Fig.
4D). Therefore, it appears that FtsZ
deletion mutants containing
at least residues 1 to 316 are able
to localize to division sites in
either strain background but
at 42°C they can form clear rings only
in JFL101. A summary of
the localization results is shown in Table
3.
Protein-protein interactions between FtsA and FtsZ deletion
derivatives.
To examine interactions between FtsA and FtsZ mutant
derivatives, we developed a simple and novel in vivo protein-protein interaction assay. This assay was based on our previous
observations that when FtsA-GFP is co-overproduced with FtsZ,
fluorescent spiral structures assemble throughout the cell.
Similar spirals are often found after overproduction of FtsZ-GFP, but
not after overproduction of FtsA-GFP. Because FtsZ-GFP, but not
FtsA-GFP, was able to form extensive spirals when overexpressed, we
previously postulated that fluorescent spirals in cells overproducing
FtsA-GFP and FtsZ resulted from association of FtsA-GFP with FtsZ
polymers (24). This assay was then used to test interspecies
FtsZ-FtsA interactions in situ and revealed a significantly stronger
interaction between rhizobial FtsA-GFP and its cognate FtsZ than with
E. coli FtsZ (21).
For the present study, we used this assay to determine whether FtsA-GFP
could bind to spiral polymers assembled by our mutant
FtsZ derivatives.
In this system, the
ftsA-GFP fusion was under
the control of
the IPTG-inducible
lac promoter in pBC, a
colE1 plasmid derivative. As with the complementation and localization
experiments described above, expression of wild-type
ftsZ or
its
mutant alleles was driven by the
tac promoter in the
compatible
IncP plasmid, pWM176. JFL101 (
ftsZ84) cells
harboring both
ftsA-GFP
and
ftsZ were grown at
32°C until they reached early exponential
phase and then shifted to
42°C for 30 min to inactivate the endogenous
FtsZ84. Overproduction
of FtsA-GFP and FtsZ or its derivatives
was subsequently induced with
200 µM IPTG for 1 h at 42°C. The
cellular structures formed by
these proteins were examined by
IFM, using anti-GFP and anti-FtsZ to
detect FtsA-GFP and FtsZ
derivatives,
respectively.
In control cells expressing FtsA-GFP and wild-type FtsZ, immunostaining
of FtsA-GFP revealed spiral structures that were identical
to those
previously visible in live cells by GFP fluorescence
(
19)
(Fig.
6B). In contrast, when synthesized
in combination
with any of the truncated FtsZ derivatives, FtsA-GFP
immunostaining
revealed only diffuse fluorescence (Fig.
6E, showing
Z

C1). Weak
spiral-like patterns that were not easily discernible
above background
fluorescence were often observed in these cells. These
patterns
could have been caused by nonspecific staining with anti-GFP,
because a high fluorescence background was usually seen even in
cells
expressing only GFP or FtsA-GFP in the absence of functional
FtsZ (Fig.
6A and data not shown). It is also possible that FtsZ84
might be able
to copolymerize with the mutant FtsZ proteins, resulting
in some
FtsA-GFP binding. Staining of parallel samples of cells
expressing the
truncation mutant with anti-FtsZ revealed mostly
fluorescent spirals
(Fig.
6E', showing Z

C1), although the delineation
of the structures
was not as sharp as with FtsA-GFP in FtsZ-producing
cells visualized
with anti-GFP (Fig.
6B). The simplest explanation
for these
observations is that the C-terminal truncation mutants
of FtsZ were
able to form spiral polymers but unable to recruit
FtsA-GFP efficiently
to the polymers. This in turn suggests that
the 12-amino-acid
C-terminal core domain of FtsZ is important
for efficient interaction
with FtsA-GFP.

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 6.
Association of FtsA-GFP with FtsZ spirals in JFL101
[ftsZ84(Ts)]. JFL101 cells containing plasmids
synthesizing FtsA-GFP and an FtsZ derivative were grown at 42°C for
30 min and then induced with 200 µM IPTG for 60 min. Parallel samples
were fixed and stained with anti-GFP antibodies for FtsA-GFP and
stained with anti-FtsZ antibodies for FtsZ, followed by IFM. (A to E)
FtsA-GFP; (A' to E') FtsZ. (A and A') WM1234 (JFL101 containing pWM633
[ftsA-GFP] and pWM176); (B and B') WM1235 (pMK4
[wild-type ftsZ]); (C and C') WM1242 (pWM738
[ZD373A]); (D and D') WM1244 (pWM739
[ZP375A]); (E and E') WM1236 (pWM737
[Z C1]).
|
|
Protein-protein interactions between FtsA and FtsZ point mutant
derivatives.
This possibility prompted us to test the interactions
between FtsA-GFP and the C-terminal core point mutants of FtsZ in the same assay. When stained with anti-FtsZ, cells overproducing wild-type FtsZ (Fig. 6B') or any of the FtsZ point mutants (Fig. 6C' and D' and
data not shown), except the unstable mutants ZI374A and ZF377A,
exhibited fluorescent spirals. This was expected, because the same
mutants were all able to form fluorescent rings in ftsZ84 cells. However, anti-GFP staining revealed fluorescent FtsA-GFP spirals
when FtsA-GFP was cosynthesized with ZD373A and ZL378A (Fig. 6C,
showing ZD373A, and data not shown) but diffuse fluorescence with
weak background patterns when cosynthesized with ZL372A and ZP375A
(Fig. 6D, showing ZP375A, and data not shown). These results suggest
that L372A and P375A, the two stable point mutants within the
conserved core that cannot complement an ftsZ mutant, are also defective in efficiently interacting with FtsA-GFP.
To determine if the FtsZ-FtsA interactions measured above in cells in
which FtsZ84 was thermoinactivated were similar in a
strain with FtsZ
depleted, we performed the interaction assays
in the
ftsZ
depletion strain WM1099. FtsZ was depleted under the
conditions
mentioned above, followed by co-overproduction of FtsA-GFP
and one of
the various FtsZ derivatives. FtsA-GFP was poorly expressed
in this
strain with the
lac promoter, so we used the
arabinose-inducible
araBAD promoter on plasmid pBAD30
instead. Cells harboring both
this plasmid and one of the plasmids
containing an
ftsZ derivative
were grown at 42°C for
5 h to deplete endogenous FtsZ and then
induced with 0.2%
arabinose and 10 µM IPTG for 1 h. This resulted
in significantly
higher production of FtsA-GFP compared to that
of the FtsZ derivatives,
because the
araBAD promoter is strong
and because it,
unlike
lac, is either fully repressed or fully
induced in
individual cells (
32). As in the
ftsZ84
strain, the
FtsZ C-terminal-deletion derivatives failed to interact
strongly
with FtsA-GFP, with anti-GFP immunostaining revealing mostly
diffuse
fluorescence with a weak background pattern. As expected, clear
fluorescent FtsA-GFP spirals appeared in cells cosynthesizing
ZD373A or
ZL378A. In addition, we also occasionally observed FtsA-GFP
spirals in
a small fraction of cells cosynthesizing ZL372A or
ZP375A (data not
shown). The FtsZ/FtsA-GFP ratio in these experiments
with WM099 cells
was estimated by immunoblotting to be about 2
to 5, whereas JFL101
cells had a ratio of approximately 60 to
70, which is close to the
estimated ratio of FtsZ to FtsA in wild-type
cells (data not shown). It
is possible, therefore, that the very
high levels of FtsA-GFP in the
WM1099 derivatives and the abnormally
low FtsZ/FtsA ratio that resulted
caused a significant enhancement
of a normally weak protein-protein
interaction.
Yeast two-hybrid analysis of FtsA interactions with mutant
FtsZs.
To test independently whether there was indeed a reduced
interaction between FtsA-GFP and the truncated FtsZs, ZL372A, or ZP375A, as observed in the JFL101 (ftsZ84) strain, we
used a yeast two-hybrid assay to measure FtsZ-FtsA interaction. We
cloned native ftsA into the yeast vector pLEXA that
carries the LexA DNA binding domain. Either wild-type ftsZ
or its mutant alleles were fused in frame to the coding region of the
GAL4 activation domain (GAL4AD) in pACT2.2. Combinations of the hybrid
plasmids were then introduced into the yeast reporter strain L40, and
the resulting cotransformants were tested for
-galactosidase
activity. The pLEXA-ftsZ construct could not be used
because of high background activity (Table
4). However, control experiments showed
that cells containing pLEXA-ftsA and
pACT2.2-virE2 (VirE2 is an unrelated protein that is part of
the Agrobacterium tumefaciens T-DNA transport system) did
not have background
-galactosidase activity (Table 4).
Cotransformants expressing both LexA-FtsA and GAL4AD-FtsZ displayed
considerable
-galactosidase activity: the colonies were blue within
2 h of incubation on a filter containing X-Gal. On the other hand,
when LexA-FtsA was combined with a GAL4AD fusion of any mutant FtsZ protein except ZD373A, the yeast colonies were white on the filters after overnight incubation, suggesting a lack of interaction with FtsA
and the FtsZ mutant. A positive but somewhat weaker interaction (pale
blue on the filter) was detected between FtsA and ZD373A (Table 4).
Taken together, the results from the yeast two-hybrid assay were
consistent with the E. coli in vivo interaction assay in the
thermosensitive ftsZ84 mutant. The data are summarized in
Table 5.
Interaction between ZipA and FtsZ mutant derivatives.
The
interaction between ZipA and FtsZ was initially demonstrated by
affinity blotting (14) and recently demonstrated by yeast
two-hybrid analysis and cosedimentation (16, 30). We wanted
to test whether an interaction could be detected between ZipA-GFP and
FtsZ in our E. coli in vivo assay. As with the FtsA-GFP studies, a zipA-GFP fusion was cloned downstream of either
the lac promoter in pBC or the BADp promoter in
pBAD30 and was introduced along with pWM176 carrying ftsZ or
its derivatives into either the ftsZ84 thermosensitive
strain JFL101 or the ftsZ depletion strain WM1099. Cells
harboring both plasmids were grown under conditions of FtsZ
inactivation or depletion, as described above for FtsZ-FtsA
interactions, and ZipA-GFP and FtsZ were detected in cells by IFM with
anti-GFP and anti-FtsZ antibodies, respectively.
When ZipA-GFP was cosynthesized with wild-type FtsZ in either JFL101 or
WM1099, it exhibited fluorescent spiral structures
similar to those
observed with FtsA-GFP. Results from experiments
in WM1099 are shown in
Fig.
7, and ZipA-GFP spirals are apparent
in Fig.
7B and C. ZipA-GFP was expressed at very high levels when
produced from the
BADp promoter in the depletion strain and,
as
a result, inhibited cell division as reported previously
(
14).
Some cells remained filamentous even when wild-type
FtsZ was cosynthesized
from plasmid pMK4 (Fig.
7B'). The excess
ZipA-GFP also caused
a high background of staining with IFM, most
easily seen in cells
with FtsZ depleted (Fig.
7A and A'). However, the
spiral structures
could be easily distinguished from the diffuse
fluorescence displayed
by ZipA-GFP when it was cosynthesized with any
of the truncated
FtsZs (Fig.
7D, showing Z

C1); these mutants, as
explained above,
exhibit a punctate pattern in the depletion strain
(Fig.
7D').
When cosynthesized with the stable point mutant derivatives
ZL372A,
ZD373A, ZP375A, and ZL378A, ZipA-GFP and the FtsZ derivative
made
clear spiral patterns (Fig.
7C, showing ZP375A) that mimicked
patterns formed by the FtsZ derivatives (Fig.
7C'). Therefore,
ZL372A
and ZP375A, which are defective in interacting with FtsA-GFP,
appear to
be capable of interacting with ZipA-GFP in this assay.
Spirals of
ZipA-GFP were not observed in cells expressing the
unstable mutants
ZI374A or ZF377A, and these proteins did not
form spirals shown by
anti-FtsZ staining.

View larger version (61K):
[in this window]
[in a new window]
|
FIG. 7.
Binding of ZipA-GFP to FtsZ rings and spirals in the
ftsZ depletion strain WM1099. WM1099 containing pWM1206
(zipA-GFP) and various ftsZ derivatives were
grown at 42°C for 4 h and then induced by 0.2%
L-arabinose and 10 µM IPTG for 60 min. As described in
the legend to Fig. 6, parallel samples were taken. One was stained with
anti-GFP for ZipA-GFP and the other was stained with anti-FtsZ for
FtsZ. The cells were observed by IFM for ZipA-GFP (A to D) and for FtsZ
(A' to D'). (A and A') WM1221 (WM1099 containing pWM1206
[zipA-GFP] and pWM176); (B and B') WM1222 (pWM1206 plus
pMK4 [wild-type ftsZ]); (C and C') WM1231 (pWM1206 plus
pWM739 [ZP375A]); (D and D') WM1223 (pWM1206 plus pWM737
[Z C1]).
|
|
Similar experiments were performed in the JFL101 background, in which
the ZipA-GFP was expressed at lower levels from the
lac
promoter. The results were similar (Table
5), supporting
the idea that
ZipA-GFP, even at lower concentrations, is able
to associate strongly
with four of the FtsZ point mutant proteins
but is unable to bind
detectably to any of the truncated FtsZs,
including the 12-amino-acid
truncation. This C-terminal core domain
of FtsZ thus appears to be
essential for interaction with both
FtsA and
ZipA.
 |
DISCUSSION |
We have shown that the C-terminal conserved core domain of FtsZ is
essential for function, because a plasmid expressing a 12-amino-acid
deletion of this domain cannot complement a chromosomal ftsZ
mutation. Additional evidence for the importance of this conserved
region comes from alanine scan mutagenesis. Most of the
single-residue alterations between L372 and L378, with the exception of
ZD373A, cannot fully substitute for the native protein. Even cells
synthesizing ZD373A as the only functional FtsZ exhibited moderate filamentation, indicating that despite its ability to allow an
ftsZ mutant to form colonies at the restrictive temperature, this mutant FtsZ is not completely normal. Synthesis of wild-type FtsZ
in the same plasmid system in the same strains, on the other hand,
resulted in mostly normal-length cells.
The loss of the entire C-terminal core had a more severe effect on FtsZ
function than any one of the single-amino-acid substitutions. For
example, after depletion of FtsZ in WM1099, the stable point mutants of FtsZ (ZL372A, ZD373A, ZP375A, and ZL378A) assembled into
rings at potential division sites within the filaments. However, the
C-terminal-truncation mutants containing at least residues 1 to 316, such as Z
C1, exhibited a regular punctate pattern within the
filaments. This result indicates that they can localize to potential
division sites and aggregate but cannot assemble into normal rings like
the point mutants. The inability of these deleted derivatives to form
normal rings was somewhat unexpected because Z
C2, containing only
residues 1 to 316, is still able to form large polymers in vitro when
fused to GFP (37).
Despite their failure to form rings in the depletion strain, these
C-terminally truncated FtsZs with at least residues 1 to 316 formed
rings in the ftsZ84(Ts) mutant JFL101 at 42°C. This strain-specific difference in the behavior of the truncated FtsZs can
be rationalized by partial function of the thermoinactivated FtsZ84. In
JFL101, several thousand FtsZ84 proteins are estimated to be present
per cell at 42°C, despite the fact that rings are not formed under
these conditions. The ability to suppress this defect by overproducing
FtsZ84 (27) or increasing ZipA levels (30)
indicates that FtsZ84 is competent for assembly into functional rings
but is less efficient at higher temperatures and requires a higher
critical concentration than the wild-type protein. In our experiments,
we speculate that exogenous synthesis of one of our mutant FtsZs in
JFL101 at 42°C increases the total FtsZ concentration, stimulating
the assembly of FtsZ84, which in turn allows the incorporation of the
truncated FtsZs into a morphologically normal ring.
The ability of the stable point mutants and some of the truncated FtsZs
to form rings on their own or in concert with otherwise thermoinactivated FtsZ84 indicates that the structures of these proteins are not significantly perturbed by the mutations. Moreover, dominant-negative effects were displayed by several of the mutant proteins even when present at less than wild-type levels. Such effects
indicate that these mutant proteins retain normal structural motifs
that allow them to interfere with the function of the native FtsZ. The
most likely avenue for such interference is by coassembling with native
FtsZ to form mixed rings. Why would such rings, which appear normal by
fluorescence microscopy, be defective for septation? One hypothesis is
that the heteropolymer cannot properly interact with a downstream
protein such as FtsA. Although some of the point mutants that exhibit
defects in associating with FtsA in our assays (ZL372A, ZI374A, and
ZP375A) exhibit a clear dominant-negative phenotype, other mutants,
such as several of the truncation mutants that are also defective in
FtsA interactions, are not dominant negative. Therefore, this
explanation for the phenotypes is unlikely to be correct. A
defect in interacting with ZipA would also not explain the
dominant-negative phenotypes because there is little correlation
between these two characteristics. It is also intriguing that the
smallest deletion (Z
C1) has no dominant-negative phenotype but a
larger deletion (Z
C1.1; deletion of 23 amino acids) does and
still-larger deletions (Z
C1.2 and 1.3 and Z
C2) do not. By inference, the dominant-negative phenotype of ZI374A may be caused by
the posttranslational truncation of the protein observed on immunoblots. Although the truncation point for ZI374A is not yet established, we speculate that the resulting protein is similar in
structure and function to the Z
C1.1 truncation.
Interestingly, a 24-amino-acid C-terminal truncation of
C. crescentus FtsZ exhibited a
dominant-negative effect (12) similar to our
23-amino-acid truncation of E. coli FtsZ (Z
C1.1), as well as some of our point mutants. As with our truncated E. coli FtsZs synthesized in cells with native FtsZ depleted, the
truncated C. crescentus FtsZ localized in a punctate pattern
in C. crescentus cells. Moreover, truncated C. crescentus FtsZ was also defective in interacting with C. crescentus FtsA in the yeast two-hybrid system. The similarity of
these results suggests that the dominant-negative effects may have
general significance. However, for the reasons mentioned above, it is
unlikely that the defect in FtsZ-FtsA interactions is the cause of the
dominant-negative phenotype.
The results described here suggest that the last 12 amino acids of FtsZ
are important for its efficient interaction with both ZipA and
FtsA. This finding is consistent with the determinants of C. crescentus FtsZ that are needed for FtsA recruitment
(12) and also with recent results implicating the
C terminus of FtsZ in ZipA recruitment (16). Our
studies of single-residue mutants in the C-terminal core have
pinpointed two conserved residues, L372 and the invariant residue P375,
that appear to have important roles in FtsA recruitment. ZipA
recruitment, on the other hand, does not appear to be affected by these
point mutations, suggesting that other single-residue changes may be
necessary to detectably affect ZipA binding.
Our results demonstrate a correlation between noncomplementation by the
FtsZ mutants and defective interaction with FtsA. However, it is
not yet clear from our data or various genome sequence comparisons
whether the defect in FtsA interaction is the sole reason for the
noncomplementation. Mycobacterium tuberculosis, for example,
lacks ftsA yet has the equivalent of L372 and P375; conversely, Aquifex aeolicus has ftsA but has
only the P375 and not the L372 equivalent (Fig. 1). Our working
hypothesis is that at least our C-terminal point mutants may be
defective for complementation solely because they are defective for
FtsA interaction. This idea seems reasonable, because these mutant
proteins can (i) form rings at division sites by themselves and (ii)
interact with ZipA.
The effects of ZL372A and ZP375A on the production of fluorescent
spirals with FtsA-GFP were clear and reproducible with the JFL101
[ftsZ84(Ts)] strain. However, the results with the WM1099 depletion strain were less conclusive, as spirals were sometimes observed with all the stable point mutant FtsZs. One likely explanation for this discrepancy is that because FtsA-GFP was synthesized in the
depletion strain with the strong araBAD promoter, FtsA-GFP levels were about 10- to 20-fold higher than those of FtsZ in the
experiments with the depletion strain than with JFL101. This high level
of protein may sometimes have forced an interaction between FtsA-GFP
and ZL372A or ZP375A proteins that does not normally occur efficiently
at lower FtsA-GFP levels. Because FtsA is normally present at 50- to
100-fold-lower levels than FtsZ, we favor the idea that the results in
the JFL101 background are more physiologically relevant and that ZL372A
and ZP375A are truly defective in binding to FtsA. Importantly, the
yeast two-hybrid data are entirely consistent with this conclusion.
Future experiments with purified proteins should allow more precise
biochemical definition of the binding affinities between the various
FtsZ mutants and FtsA. Such experiments should also be able to
determine if the mutations in the C-terminal core disrupt an actual
binding surface for FtsA and/or ZipA or instead indirectly cause
structural changes in FtsZ that weaken the binding of these proteins.
Why does synthesis of high levels of FtsZ in conjunction with FtsA-GFP
or ZipA-GFP result in FtsZ spirals? FtsZ spirals caused by the
ftsZ26 mutation can function normally in cell division (2), although spirals caused by overproduction of FtsZ alone (20), FtsZ-GFP, or co-overproduction of FtsZ and FtsA-GFP
appear to be nonfunctional (19). The conditions controlling
the assembly of spirals and their different morphologies and pitches in
the cell are not known. We favor the idea that spirals represent a hyperstable form of FtsZ polymers and that ZipA and FtsA, at least when
present at certain levels, are able to promote stabilization of FtsZ
polymers. Biochemical and genetic evidence for such a stabilization
function for ZipA has recently been reported (30). A better
understanding of this phenomenon should prove useful in the design of
drugs that, like taxol with microtubules, can inactivate the bacterial
division system by hyperstabilizing FtsZ polymers.
 |
ACKNOWLEDGMENTS |
We thank W. Cook and L. Rothfield for the FtsZ depletion strain;
X.-R. Zhou, P. Christie, J. Jones, and S. Elledge for the yeast
two-hybrid vectors and advice concerning the yeast two-hybrid assay; T. Vida for help with yeast culture and transformation; and X.-C. Yu and
Q. Sun for the anti-FtsZ antibody and help with the immunofluorescence assays.
This work was supported by National Science Foundation grant
MCB-9513521 and National Institutes of Health Grant 1R55-GM/OD54380-01.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology and Molecular Genetics, University of Texas
Houston
Medical School, 6431 Fannin, Houston, TX 77030. Phone: (713) 500-5452. Fax: (713) 500-5499. E-mail:
margolin{at}utmmg.med.uth.tmc.edu.
 |
REFERENCES |
| 1.
|
Addinall, S. G.,
C. Cao, and J. Lutkenhaus.
1997.
Temperature shift experiments with an ftsZ84(Ts) strain reveal rapid dynamics of FtsZ localization and indicate that the Z ring is required throughout septation and cannot reoccupy division sites once constriction has initiated.
J. Bacteriol.
179:4277-4284[Abstract/Free Full Text].
|
| 2.
|
Addinall, S. G., and J. Lutkenhaus.
1996.
FtsZ-spirals and -arcs determine the shape of the invaginating septa in some mutants of Escherichia coli.
Mol. Microbiol.
22:231-237[Medline].
|
| 3.
|
Addinall, S. G., and J. Lutkenhaus.
1996.
FtsA is localized to the septum in an FtsZ-dependent manner.
J. Bacteriol.
178:7167-7172[Abstract/Free Full Text].
|
| 4.
|
Bai, C., and S. J. Elledge.
1997.
Gene identification using the yeast two-hybrid system.
Methods Enzymol.
283:141-156[Medline].
|
| 5.
|
Bartel, P. L., and S. Fields.
1995.
Analyzing protein-protein interactions using two-hybrid system.
Methods Enzymol.
254:241-263[Medline].
|
| 6.
|
Bi, E., and J. Lutkenhaus.
1991.
FtsZ ring structure associated with division in Escherichia coli.
Nature (London)
354:161-164[Medline].
|
| 7.
|
Bramhill, D., and C. M. Thompson.
1994.
GTP-dependent polymerization of Escherichia coli FtsZ protein to form tubules.
Proc. Natl. Acad. Sci. USA
91:5813-5817[Abstract/Free Full Text].
|
| 8.
|
Chen, B., and A. E. Przybyla.
1994.
An efficient site-directed mutagenesis method based on PCR.
BioTechniques
17:657-659[Medline].
|
| 9.
|
Cormack, B. P.,
R. H. Valdivia, and S. Falkow.
1996.
FACS-optimized mutants of the green fluorescent protein (GFP).
Gene
173:33-38[Medline].
|
| 10.
|
Dai, K., and J. Lutkenhaus.
1991.
ftsZ is an essential cell division gene in Escherichia coli.
J. Bacteriol.
173:3500-3506[Abstract/Free Full Text].
|
| 11.
|
de Boer, P.,
R. Crossley, and L. Rothfield.
1992.
The essential bacterial cell-division protein FtsZ is a GTPase.
Nature (London)
359:254-256[Medline].
|
| 12.
|
Din, N.,
E. M. Quardokus,
M. J. Sackett, and Y. V. Brun.
1998.
Dominant C-terminal deletions of FtsZ that affect its ability to localize in Caulobacter and its interaction with FtsA.
Mol. Microbiol.
27:1051-1063[Medline].
|
| 13.
|
Erickson, H. P.,
D. W. Taylor,
K. A. Taylor, and D. Bramhill.
1996.
Bacterial cell division protein FtsZ assembles into protofilament sheets and minirings, structural homologs of tubulin polymers.
Proc. Natl. Acad. Sci. USA
93:519-523[Abstract/Free Full Text].
|
| 14.
|
Hale, C. A., and P. de Boer.
1997.
Direct binding of FtsZ to ZipA, an essential component of the septal ring structure that mediates cell division in E. coli.
Cell
88:175-185[Medline].
|
| 15.
|
Hale, C. A., and P. A. de Boer.
1999.
Recruitment of ZipA to the septal ring of Escherichia coli is dependent on FtsZ and independent of FtsA.
J. Bacteriol.
181:167-176[Abstract/Free Full Text].
|
| 16.
|
Liu, Z.,
A. Mukherjee, and J. Lutkenhaus.
1999.
Recruitment of ZipA to the division site by interaction with FtsZ.
Mol. Microbiol.
31:1853-1861[Medline].
|
| 17.
|
Löwe, J., and L. A. Amos.
1998.
Crystal structure of the bacterial cell-division protein FtsZ.
Nature (London)
391:203-206[Medline].
|
| 18.
|
Lutkenhaus, J.,
H. Wolf-Watz, and W. D. Donachie.
1980.
Organization of the genes in the ftsA-envA region of the Escherichia coli genetic map and identification of a new fts locus (ftsZ).
J. Bacteriol.
142:615-620[Abstract/Free Full Text].
|
| 19.
|
Ma, X.,
D. W. Ehrhardt, and W. Margolin.
1996.
Colocalization of cell division proteins FtsZ and FtsA to cytoskeletal structures in living Escherichia coli cells by using green fluorescent protein.
Proc. Natl. Acad. Sci. USA
93:12998-13003[Abstract/Free Full Text].
|
| 20.
| Ma, X., and W. Margolin. Unpublished data.
|
| 21.
|
Ma, X.,
Q. Sun,
R. Wang,
G. Singh,
E. L. Jonietz, and W. Margolin.
1997.
Interactions between heterologous FtsA and FtsZ proteins at the FtsZ ring.
J. Bacteriol.
179:6788-6797[Abstract/Free Full Text].
|
| 22.
|
Margolin, W.
1998.
A green light for the bacterial cytoskeleton.
Trends Microbiol.
6:233-238[Medline].
|
| 23.
|
Margolin, W.,
J. C. Corbo, and S. R. Long.
1991.
Cloning and characterization of a Rhizobium meliloti homolog of the Escherichia coli cell division gene ftsZ.
J. Bacteriol.
173:5822-5830[Abstract/Free Full Text].
|
| 24.
|
Margolin, W., and S. R. Long.
1994.
Rhizobium meliloti contains a novel second copy of the cell division gene ftsZ.
J. Bacteriol.
176:2033-2043[Abstract/Free Full Text].
|
| 25.
|
Mukherjee, A.,
K. Dai, and J. Lutkenhaus.
1993.
Escherichia coli cell division protein FtsZ is a guanine nucleotide binding protein.
Proc. Natl. Acad. Sci. USA
90:1053-1057[Abstract/Free Full Text].
|
| 26.
|
Mukherjee, A., and J. Lutkenhaus.
1998.
Dynamic assembly of FtsZ regulated by GTP hydrolysis.
EMBO J.
17:462-469[Medline].
|
| 27.
|
Phoenix, P., and G. R. Drapeau.
1988.
Cell division control in Escherichia coli K12: some properties of the ftsZ84 mutation and suppression of this mutation by the product of a newly identified gene.
J. Bacteriol.
170:4338-4342[Abstract/Free Full Text].
|
| 28.
|
Pogliano, J.,
K. Pogliano,
D. S. Weiss,
R. Losick, and J. Beckwith.
1997.
Inactivation of FtsI inhibits constriction of the FtsZ cytokinetic ring and delays the assembly of FtsZ rings at potential division sites.
Proc. Natl. Acad. Sci. USA
94:559-564[Abstract/Free Full Text].
|
| 29.
|
Quardokus, E.,
N. Din, and Y. V. Brun.
1996.
Cell cycle regulation and cell type-specific localization of the FtsZ division initiation protein in Caulobacter.
Proc. Natl. Acad. Sci. USA
93:6314-6319[Abstract/Free Full Text].
|
| 30.
|
Raychaudhuri, D.
1999.
ZipA is a MAP-Tau homolog and is essential for structural integrity of the cytokinetic FtsZ ring during bacterial cell division.
EMBO J.
18:2372-2383[Medline].
|
| 31.
|
Raychaudhuri, D., and J. T. Park.
1992.
Escherichia coli cell-division gene ftsZ encodes a novel GTP-binding protein.
Nature (London)
359:251-254[Medline].
|
| 32.
|
Siegele, D. A., and J. C. Hu.
1997.
Gene expression from plasmids containing the araBAD promoter at subsaturating inducer concentrations represents mixed populations.
Proc. Natl. Acad. Sci. USA
94:8168-8172[Abstract/Free Full Text].
|
| 33.
|
Sun, Q., and W. Margolin.
1998.
FtsZ dynamics during the cell division cycle of live Escherichia coli.
J. Bacteriol.
180:2050-2056[Abstract/Free Full Text].
|
| 34.
|
Wang, X.,
J. Huang,
A. Mukherjee,
C. Cao, and J. Lutkenhaus.
1997.
Analysis of the interaction of FtsZ with itself, GTP, and FtsA.
J. Bacteriol.
179:5551-5559[Abstract/Free Full Text].
|
| 35.
|
Wang, X. D.,
P. A. de Boer, and L. I. Rothfield.
1991.
A factor that positively regulates cell division by activating transcription of the major cluster of essential cell division genes of Escherichia coli.
EMBO J.
10:3363-3372[Medline].
|
| 36.
|
Ward, J. E., and J. Lutkenhaus.
1985.
Overproduction of FtsZ induces minicells in E. coli.
Cell
42:941-949[Medline].
|
| 37.
|
Yu, X.-C., and W. Margolin.
1997.
Ca2+-mediated GTP-dependent dynamic assembly of bacterial cell division protein FtsZ into asters and polymer networks in vitro.
EMBO J.
16:5455-5463[Medline].
|
| 38.
|
Yu, X.-C., and W. Margolin.
1998.
Inhibition of assembly of bacterial cell division protein FtsZ by the hydrophobic dye bis-8-anilino-1-naphthalene-sulfonate.
J. Biol. Chem.
273:10216-10222[Abstract/Free Full Text].
|
| 39.
|
Yu, X.-C., and W. Margolin.
1999.
FtsZ ring clusters in min and partition mutants: role of both the Min system and the nucleoid in regulating FtsZ ring localization.
Mol. Microbiol.
32:315-326[Medline].
|
Journal of Bacteriology, December 1999, p. 7531-7544, Vol. 181, No. 24
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Schmitz, A. J., Glynn, J. M., Olson, B. J.S.C., Stokes, K. D., Osteryoung, K. W.
(2009). Arabidopsis FtsZ2-1 and FtsZ2-2 Are Functionally Redundant, But FtsZ-Based Plastid Division Is Not Essential for Chloroplast Partitioning or Plant Growth and Development. Mol Plant
0: ssp077v1-ssp077
[Abstract]
[Full Text]
-
Martin, A., Lang, D., Hanke, S. T., Mueller, S. J.X., Sarnighausen, E., Vervliet-Scheebaum, M., Reski, R.
(2009). Targeted Gene Knockouts Reveal Overlapping Functions of the Five Physcomitrella patens FtsZ Isoforms in Chloroplast Division, Chloroplast Shaping, Cell Patterning, Plant Development, and Gravity Sensing. Mol Plant
0: ssp076v1-ssp076
[Abstract]
[Full Text]
-
Camberg, J. L., Hoskins, J. R., Wickner, S.
(2009). ClpXP protease degrades the cytoskeletal protein, FtsZ, and modulates FtsZ polymer dynamics. Proc. Natl. Acad. Sci. USA
106: 10614-10619
[Abstract]
[Full Text]
-
Beuria, T. K., Mullapudi, S., Mileykovskaya, E., Sadasivam, M., Dowhan, W., Margolin, W.
(2009). Adenine Nucleotide-dependent Regulation of Assembly of Bacterial Tubulin-like FtsZ by a Hypermorph of Bacterial Actin-like FtsA. J. Biol. Chem.
284: 14079-14086
[Abstract]
[Full Text]
-
Gonzalez, M. D., Beckwith, J.
(2009). Divisome under Construction: Distinct Domains of the Small Membrane Protein FtsB Are Necessary for Interaction with Multiple Cell Division Proteins. J. Bacteriol.
191: 2815-2825
[Abstract]
[Full Text]
-
Singh, J. K., Makde, R. D., Kumar, V., Panda, D.
(2008). SepF Increases the Assembly and Bundling of FtsZ Polymers and Stabilizes FtsZ Protofilaments by Binding along Its Length. J. Biol. Chem.
283: 31116-31124
[Abstract]
[Full Text]
-
Maggi, S., Massidda, O., Luzi, G., Fadda, D., Paolozzi, L., Ghelardini, P.
(2008). Division protein interaction web: identification of a phylogenetically conserved common interactome between Streptococcus pneumoniae and Escherichia coli. Microbiology
154: 3042-3052
[Abstract]
[Full Text]
-
Yoder, D. W., Kadirjan-Kalbach, D., Olson, B. J. S. C., Miyagishima, S.-y., DeBlasio, S. L., Hangarter, R. P., Osteryoung, K. W.
(2007). Effects of Mutations in Arabidopsis FtsZ1 on Plastid Division, FtsZ Ring Formation and Positioning, and FtsZ Filament Morphology in Vivo. Plant Cell Physiol
48: 775-791
[Abstract]
[Full Text]
-
Corbin, B. D., Wang, Y., Beuria, T. K., Margolin, W.
(2007). Interaction between Cell Division Proteins FtsE and FtsZ. J. Bacteriol.
189: 3026-3035
[Abstract]
[Full Text]
-
Maple, J., Moller, S. G.
(2007). Plastid Division: Evolution, Mechanism and Complexity. ANN BOT (LOND)
99: 565-579
[Abstract]
[Full Text]
-
Watt, R. M., Wang, J., Leong, M., Kung, H.-f., Cheah, K. S.E., Liu, D., Danchin, A., Huang, J.-D.
(2007). Visualizing the proteome of Escherichia coli: an efficient and versatile method for labeling chromosomal coding DNA sequences (CDSs) with fluorescent protein genes. Nucleic Acids Res
35: e37-e37
[Abstract]
[Full Text]
-
Osawa, M., Erickson, H. P.
(2006). FtsZ from Divergent Foreign Bacteria Can Function for Cell Division in Escherichia coli.. J. Bacteriol.
188: 7132-7140
[Abstract]
[Full Text]
-
Dubytska, L., Godfrey, H. P., Cabello, F. C.
(2006). Borrelia burgdorferi ftsZ Plays a Role in Cell Division.. J. Bacteriol.
188: 1969-1978
[Abstract]
[Full Text]
-
Vicente, M., Rico, A. I., Martinez-Arteaga, R., Mingorance, J.
(2006). Septum Enlightenment: Assembly of Bacterial Division Proteins. J. Bacteriol.
188: 19-27
[Full Text]
-
Osawa, M., Erickson, H. P.
(2005). Probing the domain structure of FtsZ by random truncation and insertion of GFP. Microbiology
151: 4033-4043
[Abstract]
[Full Text]
-
Jensen, S. O., Thompson, L. S., Harry, E. J.
(2005). Cell Division in Bacillus subtilis: FtsZ and FtsA Association Is Z-Ring Independent, and FtsA Is Required for Efficient Midcell Z-Ring Assembly. J. Bacteriol.
187: 6536-6544
[Abstract]
[Full Text]
-
Feucht, A., Errington, J.
(2005). ftsZ mutations affecting cell division frequency, placement and morphology in Bacillus subtilis. Microbiology
151: 2053-2064
[Abstract]
[Full Text]
-
Ferguson, D. J. P., Henriquez, F. L., Kirisits, M. J., Muench, S. P., Prigge, S. T., Rice, D. W., Roberts, C. W., McLeod, R. L.
(2005). Maternal Inheritance and Stage-Specific Variation of the Apicoplast in Toxoplasma gondii during Development in the Intermediate and Definitive Host. Eukaryot Cell
4: 814-826
[Abstract]
[Full Text]
-
Wissel, M. C., Wendt, J. L., Mitchell, C. J., Weiss, D. S.
(2005). The Transmembrane Helix of the Escherichia coli Division Protein FtsI Localizes to the Septal Ring. J. Bacteriol.
187: 320-328
[Abstract]
[Full Text]
-
Addinall, S. G., Small, E., Whitaker, D., Sturrock, S., Donachie, W. D., Khattar, M. M.
(2005). New Temperature-Sensitive Alleles of ftsZ in Escherichia coli. J. Bacteriol.
187: 358-365
[Abstract]
[Full Text]
-
Goehring, N. W., Gueiros-Filho, F., Beckwith, J.
(2005). Premature targeting of a cell division protein to midcell allows dissection of divisome assembly in Escherichia coli. Genes Dev.
19: 127-137
[Abstract]
[Full Text]
-
Corbin, B. D., Geissler, B., Sadasivam, M., Margolin, W.
(2004). Z-Ring-Independent Interaction between a Subdomain of FtsA and Late Septation Proteins as Revealed by a Polar Recruitment Assay. J. Bacteriol.
186: 7736-7744
[Abstract]
[Full Text]
-
Piette, A., Fraipont, C., den Blaauwen, T., Aarsman, M. E. G., Pastoret, S., Nguyen-Disteche, M.
(2004). Structural Determinants Required To Target Penicillin-Binding Protein 3 to the Septum of Escherichia coli. J. Bacteriol.
186: 6110-6117
[Abstract]
[Full Text]
-
Santra, M. K., Beuria, T. K., Banerjee, A., Panda, D.
(2004). Ruthenium Red-induced Bundling of Bacterial Cell Division Protein, FtsZ. J. Biol. Chem.
279: 25959-25965
[Abstract]
[Full Text]
-
Johnson, J. E., Lackner, L. L., Hale, C. A., de Boer, P. A. J.
(2004). ZipA Is Required for Targeting of DMinC/DicB, but Not DMinC/MinD, Complexes to Septal Ring Assemblies in Escherichia coli. J. Bacteriol.
186: 2418-2429
[Abstract]
[Full Text]
-
Osteryoung, K. W., Nunnari, J.
(2003). The Division of Endosymbiotic Organelles. Science
302: 1698-1704
[Abstract]
[Full Text]
-
Stricker, J., Erickson, H. P.
(2003). In Vivo Characterization of Escherichia coli ftsZ Mutants: Effects on Z-Ring Structure and Function. J. Bacteriol.
185: 4796-4805
[Abstract]
[Full Text]
-
Geissler, B., Elraheb, D., Margolin, W.
(2003). A gain-of-function mutation in ftsA bypasses the requirement for the essential cell division gene zipA in Escherichia coli. Proc. Natl. Acad. Sci. USA
100: 4197-4202
[Abstract]
[Full Text]
-
Errington, J., Daniel, R. A., Scheffers, D.-J.
(2003). Cytokinesis in Bacteria. Microbiol. Mol. Biol. Rev.
67: 52-65
[Abstract]
[Full Text]
-
Ding, Z., Zhao, Z., Jakubowski, S. J., Krishnamohan, A., Margolin, W., Christie, P. J.
(2002). A Novel Cytology-Based, Two-Hybrid Screen for Bacteria Applied to Protein-Protein Interaction Studies of a Type IV Secretion System. J. Bacteriol.
184: 5572-5582
[Abstract]
[Full Text]
-
Ohashi, T., Hale, C. A., de Boer, P. A. J., Erickson, H. P.
(2002). Structural Evidence that the P/Q Domain of ZipA Is an Unstructured, Flexible Tether between the Membrane and the C-Terminal FtsZ-Binding Domain. J. Bacteriol.
184: 4313-4315
[Abstract]
[Full Text]
-
Hale, C. A., de Boer, P. A. J.
(2002). ZipA Is Required for Recruitment of FtsK, FtsQ, FtsL, and FtsN to the Septal Ring in Escherichia coli. J. Bacteriol.
184: 2552-2556
[Abstract]
[Full Text]
-
Dziadek, J., Madiraju, M. V. V. S., Rutherford, S. A., Atkinson, M. A. L., Rajagopalan, M.
(2002). Physiological consequences associated with overproduction of Mycobacterium tuberculosis FtsZ in mycobacterial hosts. Microbiology
148: 961-971
[Abstract]
[Full Text]
-
Yim, L., Vandenbussche, G., Mingorance, J., Rueda, S., Casanova, M., Ruysschaert, J.-M., Vicente, M.
(2000). Role of the Carboxy Terminus of Escherichia coli FtsA in Self-Interaction and Cell Division. J. Bacteriol.
182: 6366-6373
[Abstract]
[Full Text]
-
Kiessling, J., Kruse, S., Rensing, S. A., Harter, K., Decker, E. L., Reski, R.
(2000). Visualization of a Cytoskeleton-like Ftsz Network in Chloroplasts. JCB
151: 945-950
[Abstract]
[Full Text]
-
Hale, C. A., Rhee, A. C., de Boer, P. A. J.
(2000). ZipA-Induced Bundling of FtsZ Polymers Mediated by an Interaction between C-Terminal Domains. J. Bacteriol.
182: 5153-5166
[Abstract]
[Full Text]
-
Haney, S. A., Glasfeld, E., Hale, C., Keeney, D., He, Z., de Boer, P.
(2001). Genetic Analysis of the Escherichia coli FtsZ{middle dot}ZipA Interaction in the Yeast Two-hybrid System. CHARACTERIZATION OF FtsZ RESIDUES ESSENTIAL FOR THE INTERACTIONS WITH ZipA AND WITH FtsA. J. Biol. Chem.
276: 11980-11987
[Abstract]
[Full Text]