Previous Article | Next Article 
Journal of Bacteriology, December 1999, p. 7571-7579, Vol. 181, No. 24
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Regulation of Expression of the adhE Gene,
Encoding Ethanol Oxidoreductase in Escherichia coli:
Transcription from a Downstream Promoter and Regulation by Fnr
and RpoS
Jorge
Membrillo-Hernández* and
E. C. C.
Lin
Department of Microbiology and Molecular
Genetics, Harvard Medical School, Boston, Massachusetts 02115
Received 12 July 1999/Accepted 6 October 1999
 |
ABSTRACT |
The adhE gene of Escherichia coli, located
at min 27 on the chromosome, encodes the bifunctional NAD-linked
oxidoreductase responsible for the conversion of acetyl-coenzyme A to
ethanol during fermentative growth. The expression of adhE
is dependent on both transcriptional and posttranscriptional controls
and is about 10-fold higher during anaerobic than during aerobic
growth. Two putative transcriptional start sites have been reported:
one at position
292 and the other at
188 from the translational start codon ATG. In this study we show, by using several different transcriptional and translational fusions to the lacZ gene,
that both putative transcriptional start sites can be functional and each site can be redox regulated. Although both start sites are NarL
repressible in the presence of nitrate, Fnr activates only the
188
start site and Fis is required for the transcription of only the
292
start site. In addition, it was discovered that RpoS activates
adhE transcription at both start sites. Under all experimental conditions tested, however, only the upstream start site
is active. Available evidence indicates that under those conditions,
the upstream promoter region acts as a silencer of the downstream
transcriptional start site. Translation of the mRNA starting at
292,
but not the one starting at
188, requires RNase III. The results
support the previously postulated ribosomal binding site (RBS)
occlusion model, according to which RNase III cleavage is required to
release the RBS from a stem-loop structure in the long transcript.
 |
INTRODUCTION |
The reduction of acetyl-coenzyme A
(CoA) to ethanol is essential for disposing of excess reducing
equivalents by Escherichia coli when respiratory pathways
fail to maintain redox balance. For instance, genetic blockage of the
ethanol pathway prevents fermentative growth on glucose or mannitol as
a sole carbon and energy source. The two-step reduction of acetyl-CoA
to ethanol is catalyzed by a bifunctional enzyme encoded by the
adhE gene (Fig. 1) located at
27.9 min (7, 10, 13, 16, 21, 24). In addition, this protein
also functions as a deactivase of pyruvate-formate lyase (13,
14). Expression of adhE is about 10-fold higher during
anaerobic than during aerobic growth, and this regulation is
independent of ArcA and Fnr. The accumulation of reducing equivalents, possibly the NADH concentration or the NADH/NAD ratio, was suggested to
be a signal for transcriptional regulation of adhE (5,
15). Three transcriptional proteins involved in the control of
adhE expression have been identified, but none of them is
directly responsible for redox regulation. The first protein, NarL
(8), represses adhE expression, but this occurs
only in the presence of nitrate (5, 15). The second protein,
Cra (for catabolite repressor activator), represses adhE
expression (19), but this transcriptional regulator is
functional only when complexed with fructose-1-phosphate or
fructose-1,6-bisphosphate as an effector (for a review, see reference
22). The third protein, Fis (for factor for
inversion stimulation) (9, 28), is required for adhE transcription, but Fis is not known to require any
effector for function and the expression of the fis gene
itself is independent of the respiratory condition of growth
(18).

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 1.
Base sequence and locations of regulatory sites in the
adhE promoter region. The distance between putative
regulatory sequences and the 188 transcriptional start site is
indicated at the bottom.
|
|
In addition to transcriptional controls, translation of the
adhE mRNA depends on the activity of RNase III. It was
suggested that intramolecular base pairing occludes the RBS (ribosomal
binding site) and that cleavage of the obstructing secondary structure liberates the translation. The results of primer extension experiments indicated two putative adhE transcriptional start sites: one
at position
292 and the other at position
188 from the
translational start codon ATG (1). However, the mRNA
starting at position
188 was not seriously considered for three
reasons: (i) the primer extension might be prematurely terminated by a
secondary structure of the full-length adhE mRNA, (ii) the
short transcript starting at position
188 might be a breakdown
product, and (iii) transcription from this site was not likely to
require RNase III cleavage as predicted by the RBS occlusion model. The
focus of the present study is to address the functionality of the
downstream start site.
 |
MATERIALS AND METHODS |
Strains, culture conditions, and reagents.
The relevant
characteristics and sources of the bacterial strains and plasmids used
in this study are given in Table 1.
Luria-Bertani (LB) medium (20) containing 0.1 M MOPS
(morpholinepropanesulfonic acid) and 0.2% glucose was adjusted to pH
7.4 (LB-glucose medium). Minimal medium was prepared as previously
described (19). Culture optical density at 600 nm
(OD600) was determined in a DU640 Beckman spectrophotometer. Aerobic cultures were grown at 37°C with shaking (200 rpm) in 250-ml Erlenmeyer flasks containing 10 ml of medium. Anaerobic cultures were grown at 37°C in 10-ml test tubes filled to
the brim. When used, nitrate was added at 40 mM. The BBL (Cockeysville, Md.) Gas-Pack system was used for anaerobic growth on solid media. Antibiotics, purchased from Sigma, were added when appropriate at the
following concentrations: ampicillin, 200 µg/ml; tetracycline, 15 µg/ml; and kanamycin, 100 µg/ml. Oligonucleotides were custom synthesized by Oligos Etc., Inc. All enzymes were purchased from New
England Biolabs.
Genetic methods and DNA manipulations.
Genetic crosses were
performed by P1vir-mediated transduction (20).
Standard methods were used for restriction endonuclease digestion and
ligation of DNA (20, 23). Plasmid DNA was isolated by using
the QIAPrep system from Qiagen, and the DNA fragments were isolated
from agarose gels with the QIAquick kit (Qiagen). Transformation of
bacteria with plasmid DNA was done by electroporation (23)
with an E. coli Pulser (Bio-Rad). PCRs were carried out in a
Minicycler (MJ Research), using Pfu DNA polymerase from
Stratagene (La Jolla, Calif.).
Construction of adhE operon and protein
fusions.
Different protein and operon fusions of
adhE to lacZ,
(adhE-lacZ), were
constructed on a plasmid and then transferred to
phage by
recombination in vivo (25). To construct
ADHop656 (operon fusion) and
ADHpr656 (protein fusion), a 1.1-kb DNA
fragment was excised from pADH8 by BglII and
BstYI. The product was ligated into the BamHI
site of the plasmid pRS415 (for an operon fusion) and pRS414
(for a protein fusion). The recombinant plasmids were used to transform
strain MC4100 (
lac). Each of these fusions comprises 656 bp upstream of the translational start site of
adhE. To construct
ADHop291 (operon fusion) and
ADHpr291 (protein fusion), primers 291-5 (5'-CAATGAATTCACTGTTAGCTATAATGGCG-3') and 291-3 (5'-GCCGGATCCAGATCTTTCGGAGC-3') were used to amplify a
0.8-kb DNA fragment comprising 291 bp upstream of the adhE
translational start site. The fragment was gel purified, digested with
EcoRI and BamHI, and cloned into pRS415
(operon fusion) and pRS414 (protein fusion). To construct
ADHop2656 (operon fusion), primers 2656-5 (5'-AGCGAGATCCACAAGATAATGGCC-3') and 2656-3 (5'-AGCTGGATCCGTAAGCAAGATTACTCACTTCTGGG-3') were used to
amplify a 0.3-kb DNA fragment comprising a segment from position
656
to position
190 from the adhE translational start site. To
construct
ADHop3656 (operon fusion), primers 3656-5 (5'-AGCGGATCCACAAGATAATGGCC-3') and
3656-3 (5'-CGCTGGATCCCATTATAGCTAACAGTTAATAAATTGTAGTATG-3') were
used to amplify a 0.4-kb DNA fragment comprising a segment from
position
656 to position
267 from the adhE translational start site. For
ADH656TATA, primers 3656-5 and 291-3 were used, but
the plasmid pJMADH3 (see below) was used as a template. The fragments
were gel purified, digested with BamHI and EcoRI,
and cloned into pRS415. The sequence of the inserts was confirmed by
automated sequencing (Core Facility at Harvard Medical School). The
appropriate fusions in the plasmids were recombined onto
RS45 to
yield their correspondent
ADH (Fig.
2). Each fusion was inserted into the
chromosome of MC4100, and several transductants were isolated for
assays of the activity level of
-galactosidase and Ter tests
(25). A single-copy lysogen bearing each fusion was isolated
for further study.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 2.
Schematic representations of (adhE-lacZ)
operon and (adhE-lacZ) protein fusions in cassettes (identified on right). The numbers indicate base pair
positions from the translational start site. Transcriptional start
sites are denoted by bent arrows.
|
|
-Galactosidase assays.
Exponential-
(OD600, 0.4) or stationary-phase (OD600,
2.5) LB cultures (10 ml) of the desired strains were treated with
chloramphenicol (final concentration, 40 µg/ml) and incubated for an
additional 5 min at 37°C. The cultures were then pelleted, suspended
in 2.5 ml of Z buffer (20), and kept on ice. Specific
-galactosidase activity in cells permeabilized with chloroform and
sodium dodecyl sulfate was assayed at 28°C and is expressed in Miller
units (
OD420 per minute per OD600 unit)
(20). Each culture was assayed at least in triplicate;
typically, these values gave a coefficient of variation (mean divided
by the standard deviation) of <5%. At least three independent
experiments were carried out under each set of growth conditions.
Ethanol oxidoreductase assays.
Cells were disrupted by
sonication, and the extracts were assayed at 25°C, essentially as
previously described (17). The assay mixture (1 ml)
consisted of 1.6 M ethanol, 0.3 M potassium carbonate buffer (pH 10),
and 0.66 mM NAD.
Primer extension.
Total RNA was isolated with the RNAeasy
kit (Qiagen) from cells of strain ECL4010 growing anaerobically. Ten
nanograms of 5'-end-labeled (23) oligonucleotide JM-1
(5'-CGCCAGGGTTTTCCCAGTCACGACG-3') corresponding to positions
+46 to +28 relative to the ATG of the lacZ gene was mixed
with 1 µg of total mRNA in 10 µl of the primer extension buffer (50 mM Tris-HCl [pH 8.3], 50 mM KCL, 10 mM MgCl2, 10 mM
dithiothreitol, 1 mM [each] deoxynucleoside triphosphate, 0.5 mM
spermidine), heated at 75°C for 3 min, and cooled to room temperature
for 10 min. Ten microliters of a prewarmed reverse transcriptase
extension mixture (1 U of avian myeloblastosis virus reverse
transcriptase [New England Biolabs] in primer extension buffer
containing 5.6 mM sodium pyrophosphate) was added to the annealed
primer-RNA complex, incubated at 42°C for 30 min, and ethanol
precipitated. Nucleic acids were resuspended in formamide loading dye
and separated on a 6% denaturing polyacrylamide gel. The size of
the primer-extended product was calculated by running a known sequence
ladder (M13mp18 DNA).
Construction of adhE plasmids and site-directed
mutagenesis.
Plasmids pBR322 bearing adhE alleles
were constructed by inserting a PCR fragment containing the entire
adhE coding region and the desired length of the regulatory
region. The insert of plasmid pJMADH1 was made by using primer 3656-5 (5'-AGCGGGATCCACAAGATAATGGCC-3') and primer JMADH13
(5'- AGCTGGATTCATTGCCCAGAAGGGGCCGTTTATGTTGCCAGACAG CGC-3').
The insert for plasmid pJMADH2 was made by using primer 291-5Bam (5'-CAATGGATCCACTGTTAGCTATAATGGCG-3') and primer
JMADH13. The inserts were gel purified with the QIAquick kit and cloned into pBR322 predigested with BamHI. Site-directed
mutagenesis of the Pribnow TACAAT box was carried out
with the QuickChange kit (Stratagene) with plasmid pJMADH1 as
a template. The primers TATA5
(5'-GTAGCCACCAAATCATACCGGGCCTTATTAACTGTTAGC-3') and TATA3' (5'-GCTAACAGTTAATAAGGCCCGGTATGATTTGGTGGCTAC-3') were used
for site-directed mutagenesis. The new plasmid was designated pJMADH3. Confirmation of the sequences of all the inserts was performed by
automated DNA sequencing (Core Facility at Harvard Medical School).
 |
RESULTS |
Expression and redox regulation of
(adhE-lacZ)291 operon and protein
fusions bearing only the
188 transcriptional start site.
To test
whether the downstream transcriptional start site was functional, we
constructed two pairs of adhE-lacZ fusions differing in the
lengths of their promoter regions: (i) a
(adhE-lacZ)656 operon fusion and a
(adhE'-'lacZ)656 protein fusion extending to position
656 from the translational start site (Fig. 2A and F) and
(ii) a
(adhE-lacZ)291 operon
fusion and a
(adhE'-'lacZ)291 protein
fusion extending to position
291 from the translational start site
(Fig. 2B and G). The pair of long fusions contained both the
292 and
188 transcriptional start sites, whereas the pair of short
fusions contained only the
188 transcriptional start site. Each of
the four fusions was then inserted into the att site of
strain MC4100 (adhE+
lac) to give
strains ECL4013 [
(adhE-lacZ)656],
ECL4012 [
(adhE'-'lacZ)656], ECL4011
[
(adhE-lacZ)291], and ECL4010
[
(adhE'-'lacZ)291]. The adhE+
(adhE-lacZ) merodiploid
reporter strains were grown aerobically or anaerobically in LB-glucose,
and their
-galactosidase activity levels were determined.
Strain ECL4011 [

(
adhE-lacZ)
291] showed a
ninefold-higher

-galactosidase activity level during anaerobic
growth than during
aerobic growth. These activity levels represent 30%
of the respective
values found in strain ECL4013
[

(
adhE-lacZ)
656] (Table
2). A
similar pattern of activity levels
was observed when the strain
bearing the short protein fusion was
compared with that bearing
the long protein fusion (data not shown).
Primer extension analysis
in the strain ECL4010
[

(
adhE'-'lacZ)
291] showed that, as
expected,
the transcriptional start site was at position

188 (Fig.
3).
The results taken together suggest
that the downstream transcriptional
start site (

188) can be
functional by itself and that the promoter
region in this fragment
contains the necessary structure for response
to redox regulation.
View this table:
[in this window]
[in a new window]
|
TABLE 2.
-Galactosidase activities of exponentially growing
cells (OD600, 0.4) bearing different
(adhE-lacZ) operon fusions in
LB-glucose medium
|
|

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 3.
Primer extension analysis of the
(adhE'-'lacZ)291 protein fusion. Primer
JM-1, complementary to positions +46 to +28 of the lacZ
gene, was annealed with total RNA of strain ECL4010 and extended with
avian myeloblastosis virus reverse transcriptase. A known DNA ladder
(lanes G, A, T, and C) was used to calculate the length of the
transcript. The only transcript observed (at 227 nucleotides [nt])
corresponds to the 188 transcriptional start site of the
adhE gene (lane 1).
|
|
Effect of Fnr on the anaerobic expression of
(adhE-lacZ)291 operon and
protein fusions.
A putative Fnr site has been previously noted
(11, 13), but in retrospect its location at position
769
seems too far from the putative adhE transcriptional start
sites. Moreover, in two previous independent studies, no effect of an
fnr null mutation on
(adhE-lacZ) and
adhE+ expressions was observed in the
merodiploids (5, 15). However, we noticed that, centered at
42.5 bp from the
188 transcriptional start site, there is a
9/10 Fnr consensus sequence (TTGAT-N4-ATCAA) (Fig.
1). The location of this box is typical of that found in target
promoters positively regulated by Fnr (27).
To test whether Fnr is involved in the expression of the

(
adhE-lacZ)
291 fusion, we transduced an
fnr::Tn
10 allele into strain
ECL4011
[

(
adhE-lacZ)
291] to yield strain
ECL4020. When the parent
and the transductant were grown
aerobically on LB-glucose medium,
both strains showed low

-galactosidase activity levels. By contrast,
when grown
anaerobically, strain ECL4011 (
fnr+), but not
strain ECL4020 (
fnr::Tn
10), became induced
for

-galactosidase
(Table
2). However, consistent with the results
of previous studies
(
5,
15), Fnr did not activate the
anaerobic expression of
the long fusion in strain ECL4013
[

(
adhE-lacZ)
656 fnr+] and
its isogenic derivative ECL4022
[

(
adhE-lacZ)
656
fnr::Tn
10]
(Table
2). Similar results were
obtained when the protein fusions
were used (data not shown). We also
determined the AdhE activity
levels in cell extracts of these two
strains grown under aerobic
or anaerobic conditions and found the
results concordant with
the

-galactosidase activity levels (data not
shown). Thus, it
seems that Fnr can regulate
adhE expression
from the downstream
transcriptional start site only in the physical
absence of the
upstream
region.
Effect of Cra on the anaerobic expression of
(adhE-lacZ)291 operon and
protein fusions.
From positions
265 to
251 lies the previously
identified Cra box (Fig. 1) (19). To determine whether the
(adhE-lacZ)291 fusion can be regulated,
the cra::kan allele was transduced from strain LJ2805 into strain ECL4011, yielding strain ECL4024
[
(adhE-lacZ)291 cra::kan]. Strains ECL4011 and ECL4024 were then
grown aerobically or anaerobically in LB-glucose medium, and their
-galactosidase activity levels were compared. No significant effect
of Cra was found. A set of experiments with the protein fusions also
showed no Cra effect (data not shown).
Effect of NarL on the anaerobic expression of
(adhE-lacZ)291 operon and
protein fusions.
The NarL box comprises two heptamer
inverted repeats (TACYYMT, where Y is C or T and M is A or C)
separated by 2 bases (8). Sequence scanning revealed a
putative site, TACCCAG-N2-GTGAGTA, located between
positions
199 and
213 from the translational start site, differing
from the consensus in only 1 base in each heptamer (Fig. 1). In
agreement with previous reports (5, 15), the expression of
(adhE-lacZ)656 was strongly repressed both aerobically and anaerobically by nitrate in strain ECL4013
(narL+) but not in its isogenic derivative
ECL4034 (narL::Tn10) (data not shown).
Similarly, the expression of
(adhE-lacZ)291 was nitrate repressible
both aerobically and anaerobically in strain ECL4011 but not in strain
ECL4033 (narL::Tn10) (Table
3). The results were supported by the
responses of the two corresponding protein fusions (data not shown).
View this table:
[in this window]
[in a new window]
|
TABLE 3.
Aerobic and anaerobic -galactosidase activity of
(adhE-lacZ)291 in the presence of 40 mM nitrate and a narL mutationa
|
|
Effect of Fis on the anaerobic expression of
(adhE-lacZ)291 operon and
protein fusions.
To test for a role of Fis, strain ECL4011
[
(adhE-lacZ)291] and the isogenic strain
ECL4027 [
(adhE-lacZ)291
fis::kan] were grown aerobically or anaerobically
in LB-glucose medium and assayed for
-galactosidase activity levels.
As shown in Table 2, the lack of Fis did not affect the ninefold
anaerobic increase in expression of
(adhE-lacZ)291. As expected from our
previous finding (18), a null mutation in fis
greatly diminished the anaerobic expression of the
(adhE-lacZ)656 with the full-length
promoter region. Concordant results were obtained from the
corresponding protein fusions (data not shown). Thus, Fis is required
only for transcriptional initiation from the upstream start site at
292.
Effect of RpoS on the expression of
(adhE-lacZ)291 operon
fusion.
During the course of this study, we were struck by an
observation that the level of
-galactosidase activity of an aerobic culture of strain ECL4011
[
(adhE-lacZ)291] was severalfold higher in stationary- than in exponential-phase cells. Although this phenomenon could be explained by oxygen limitation in the culture, a
growth phase regulation could not be excluded. We therefore monitored
the
-galactosidase activity levels in strain ECL4011 [
(adhE-lacZ)291] and its
fnr::Tn10 and/or
rpoS::kan derivatives during the growth
cycle. We found that, in the wild-type background, the increase in
activity level occurred abruptly at the onset of stationary phase (Fig.
4, top left panel). In the
fnr::Tn10 rpoS+ background, there
was a sixfold increase in activity at the onset of stationary phase
(OD600, 2.0), but the levels reproducibly dropped 50%
afterwards, possibly resulting from specific protein degradation in the
absence of Fnr-promoted synthesis (Fig. 4, top right panel). By
contrast, in the fnr+ rpoS::kan
background, there was no increase in the activity level until the
culture was 5 h into the stationary phase, eventually reaching
five times that found in the exponential-phase cells (Fig. 4, bottom
left panel). It appears that the relatively early increase in the
enzyme activity level in the fnr::Tn10
rpoS+ cells reflected RpoS transcriptional activation
following the onset of stationary phase, whereas the relatively late
increase in the enzyme activity level in the fnr+
rpoS::kan cells reflected Fnr transcriptional
activation in gradual response to anoxia. This interpretation is
consistent with the finding of a low level of
-galactosidase
activity throughout the growth cycle in the
fnr::Tn10 rpoS::kan double
mutant (Fig. 4, bottom right panel).

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 4.
Effect of mutations in rpoS and/or
fnr on the -galactosidase activity of the
(adhE-lacZ)291 operon fusion
throughout the growth cycle. The open squares represent the
OD600, and the solid circles represent -galactosidase
activity in Miller units.
|
|
Since the RpoS effect was unexpected, we tested whether a similar
influence was exerted by the regulator on the full-length
promoter. We
found that strain ECL4013
[

(
adhE-lacZ)
656] also
exhibited a
10-fold increase in the

-galactosidase activity level
during
stationary phase. This induction was lowered by 30 to 40%
when an
rpoS::
kan allele was introduced (data not
shown).
-Galactosidase synthesis specified by the
(adhE-lacZ)291 protein fusion is exempt
from RNase III requirement.
The availability of the fusion without
the
292 transcriptional start offered an opportunity to test
genetically the proposed model of RBS occlusion by the
secondary structure of the 5' region (1). Since
the abbreviated mRNA is no longer expected to form the elaborate 5'
stem-loop complex (Fig. 5), translation
of the open reading frame may no longer require the intervention of
RNase III. As shown in Table 4, the
-galactosidase activity level specified by the
(adhE-lacZ)291 protein fusion is
independent of RNase III (compare strain ECL4010 with strain ECL4018).
In further support of the RBS occlusion model, we found that when the
lacZ open reading frame possessing its own RBS was placed sufficiently downstream of the adhE RBS, as in the case of
the
(adhE-lacZ)656 operon fusion
(Fig. 2A), the synthesis of
-galactosidase also became RNase III
independent (compare strain ECL4013 with strain ECL4017). As expected,
the
-galactosidase activity level specified by the
(adhE-lacZ)656 protein fusion (in which
the translation of lacZ depended on the adhE RBS
[Fig. 2F]) remained RNase III dependent (compare strain ECL4012
with strain ECL4016).

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 5.
Probable structures of the 5' untranslated regions of
two different adhE transcripts. The MFold program
(29) was used to model the thermodynamically most favorable
secondary structure of the 5' segment of adhE transcript
starting at position 292 (A) or 188 (B).
|
|
Qualitative evidence for the silencing of the downstream start site
by the upstream start region.
One phenotype of the
adhE::kan mutant strain (ECL3999) is its
inability to grow anaerobically on glucose minimal medium (15, 16). To test the abilities of various adhE constructs
to complement an adhE null mutation, we used three different
pBR322-based plasmids: (i) pJMADH1, containing the adhE
structural gene plus its regulatory region up to position
656 from
the translational start site; (ii) pJMADH2, similar to pJMADH1 but
lacking the region upstream of position
291; and (iii) pJMADH3,
similar to pJMADH1 but with the putative Pribnow TACAAT box
of the
292 site changed to CGGGCC. As shown in Table
5, the first and second, but not the
third, plasmid restored the ability of strain ECL3999
(adhE::kan) to grow anaerobically on minimal
glucose medium. It should be mentioned that pJMADH1 transformants
appeared as visible colonies after 18 h of incubation but pJMADH2
transformants appeared only after 48 h. Transformants of pJMADH3,
however, gave rise to two colonies (probably suppressor mutants) after
72 h of incubation. These results lend support to the notion that
the upstream regulatory region silences transcription initiated at
position
188, at least under the experimental conditions employed.
Quantitative evidence for the silencing of the downstream start
site by the upstream start region.
Two approaches were designed to
test the hypothesis that the upstream promoter region (up to position
656) acts as a silencer of downstream transcription. First, if the
downstream promoter is ordinarily not contributing to the net
transcription of adhE, then a
(adhE-lacZ)
fusion containing the
292, but not the
188, transcriptional start
site should express lacZ at an undiminished level.
Accordingly, we constructed two operon fusions with abbreviated promoters: (i)
(adhE-lacZ)2656, comprising
an adhE segment from bp
656 to
290 joined to a
lacZ sequence that includes its own RBS, and (ii)
(adhE-lacZ)3656, comprising an
adhE segment from bp
656 to
267 joined to a
lacZ sequence that includes its own RBS (Fig. 2C and D,
respectively). Strains bearing a single copy of either fusion exhibited
a
-galactosidase activity level that was indistinguishable from that
of the
(adhE-lacZ)656-bearing strain, when
grown aerobically or anaerobically (data not shown).
Second, if the mere presence of the upstream region is silencing the
downstream transcriptional start site, as indicated by
the plasmid
complementation studies, then even the presence of
a nonfunctional
upstream start site may prevent transcription
from the

188
site. Accordingly, we constructed strain ECL4054,
bearing a single copy
of the

(
adhE-lacZ)
656TATA
operon fusion
in which the upstream putative Pribnow box
(TACAAT from bp

304
to

298 [Fig.
2E]) was
changed to CGGGCC. When grown aerobically,
this strain
showed a

-galactosidase activity level 60% lower
than that of the
strain bearing the

(
adhE-lacZ)
656
operon fusion
with the wild-type promoter sequence. When grown
anaerobically,
strain ECL4054
[

(
adhE-lacZ)
656TATA] did not show an
increase
in

-galactosidase activity (data not shown), confirming
that
even the presence of a nonfunctional upstream promoter region
prevents transcription from position

188.
 |
DISCUSSION |
The emergence of AdhE from a fusion of an alcohol oxidoreductase
with an aldehyde oxidoreductase (13) might be an important turning point in the evolution of ethanol fermentation by E. coli. The fused protein not only would facilitate an
intramolecular interconversion of acetyl-CoA to ethanol but also would
provide additional domain surfaces to acquire the deactivase activity for pyruvate formate-lyase (14). There may well be other
acquired biochemical functions yet to be discovered. For instance, we
do not yet know the biological significance of spirosome structures arising from the AdhE molecules (13, 14).
The acquisition of multiple functions by the AdhE protein can be
expected to have advanced hand in hand with the elaboration of
increasingly complex control of gene expression. The embellishment and
enlargement of the promoter, associated with the recruitment of
different regulatory proteins, should be a part of this process. The
direct roles of Cra (19) and Fis (18, 28) have
been established, although the functional significance of Fis control remains a puzzle. The physiological role of Fnr is still in question, and the nature and significance of the RpoS effect on adhE
expression require exploration.
In the meantime, the regulatory element responsible for redox
control continues to elude identification. Only a few genes, including
adhE, are expressed at significantly increased levels anaerobically without intervention by Fnr (11). In some
cases, the increased expression is dependent on DNA supercoiling.
Examples include tppB, torA, pepN, and
tonB (12). In other cases, such as hya
and cyx (2-4), the increased expression is
dependent on the anaerobic transcriptional factor AppY. We found that
the anaerobic expression of adhE is independent of AppY but
is influenced by DNA topology (data not shown).
At the posttranslational level, the AdhE protein is rapidly and
irreversibly inactivated during aerobic metabolism. The
Fe2+ bound to the alcohol oxidoreductase domain of the
protein is responsible for this inactivation by catalyzing the
oxidative destruction of certain amino acid residues via the Fenton
reaction (26). Enzyme inactivation upon the shift from
anaerobic to aerobic metabolism accelerates the diversion of the
inefficient fermentative mode of energy generation by covalent
dismutation to the highly efficient mode of energy generation by respiration.
The key enigma, highlighted by this study, is the presence of two
transcriptional start sites in the adhE promoter. The actual existence of the transcript starting at position
188 in cell extracts
(1) and the ability of Fnr to activate the anaerobic expression of the 5'-truncated
(adhE-lacZ)291 fusion suggest that under
certain conditions the silencer effect of the upstream promoter
region can be lifted to allow significant transcription at the
188
site. How can such conditions be discovered? A possible approach would
be to characterize the suppressor mutation(s) that allowed the
anaerobic expression of adhE from the
188 start site (in
plasmid pJMADH3 [Table 5]). A successful result might even reveal the
teleonomic basis for two adhE transcriptional start sites and the significance of the RNase III requirement for the translation of the long transcript.
Alternatively, the
188 site could be a vestige in the adhE
promoter that is evolving away from Fnr control. However, such a
hypothesis is not only difficult to test but is also
unattractive in view of the parsimonious use of DNA in
prokaryotes, which should include the prompt deletion of
superfluous DNA. Moreover, Fnr sites in adhE are found in
the genomes of other bacterial species, including
Actinobacillus pleuropneumoniae, Clostridium
acetobutylicum, Lactococcus lactis, and
Salmonella typhimurium.
 |
ACKNOWLEDGMENTS |
This work was supported by Public Health Service grants GM40993
and GM39693.
We thank Reid Johnson, Tove Atlung, Valley Stewart, and Mary Berlyn for
strains used in this study.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology and Molecular Genetics, Harvard Medical School, Boston, MA
02115. Phone: (617) 432-1926. Fax: (617) 738-7664. E-mail: jmh{at}hms.harvard.edu.
 |
REFERENCES |
| 1.
|
Aristarkhov, A.,
A. Mikulskis,
J. G. Belasco, and E. C. C. Lin.
1996.
Translation of the adhE transcript to produce ethanol dehydrogenase requires RNase III cleavage in Escherichia coli.
J. Bacteriol.
178:4327-4332[Abstract/Free Full Text].
|
| 2.
|
Atlung, T., and L. Brøndsted.
1994.
Role of the transcriptional activator AppY in regulation of the cyx appA operon of Escherichia coli by anaerobiosis, phosphate starvation, and growth phase.
J. Bacteriol.
176:5414-5422[Abstract/Free Full Text].
|
| 3.
|
Brøndsted, L., and T. Atlung.
1994.
Anaerobic regulation of the hydrogenase 1 (hya) operon of Escherichia coli.
J. Bacteriol.
176:5423-5428[Abstract/Free Full Text].
|
| 4.
|
Brøndsted, L., and T. Atlung.
1996.
Effect of growth conditions on expression of the acid phosphatase (cyx-appA) operon and the appY gene, which encodes a transcriptional activator of Escherichia coli.
J. Bacteriol.
178:1556-1564[Abstract/Free Full Text].
|
| 5.
|
Chen, Y. M., and E. C. C. Lin.
1991.
Regulation of the adhE gene, which encodes ethanol dehydrogenase in Escherichia coli.
J. Bacteriol.
173:8009-8013[Abstract/Free Full Text].
|
| 6.
|
Crasnier-Mednansky, M.,
M. C. Park,
W. K. Studley, and M. H. Saier, Jr.
1997.
Cra-mediated regulation of Escherichia coli adenylate cyclase.
Microbiology
143:785-792[Abstract/Free Full Text].
|
| 7.
|
Cunningham, P. R., and D. P. Clark.
1986.
The use of suicide substrates to select mutants of Escherichia coli lacking enzymes of alcohol fermentation.
Mol. Gen. Genet.
205:487-493[Medline].
|
| 8.
|
Darwin, A. J., and V. Stewart.
1996.
The NAR modulon systems: nitrate and nitrite regulation of anaerobic gene expression, p. 343-359.
In
E. C. C. Lin, and A. S. Lynch (ed.), Regulation of gene expression in Escherichia coli. R. G. Landes Company, Austin, Tex
|
| 9.
|
Finkel, S. E., and R. C. Johnson.
1992.
The Fis protein: it's not just for DNA inversion anymore.
Mol. Microbiol.
6:3257-3265[Medline].
|
| 10.
|
Goodlove, P. E.,
P. R. Cunningham,
J. Parker, and D. P. Clark.
1989.
Cloning and sequence analysis of the fermentative alcohol dehydrogenase-encoding gene of Escherichia coli.
Gene
85:209-214[Medline].
|
| 11.
|
Guest, J. G.,
J. Green,
A. S. Irvine, and S. Spiro.
1996.
The FNR modulon and the FNR-regulated gene expression, p. 343-359.
In
E. C. C. Lin, and A. S. Lynch (ed.), Regulation of gene expression in Escherichia coli. R. G. Landes Company, Austin, Tex
|
| 12.
|
Jamieson, D. J., and C. F. Higgins.
1986.
Two genetically distinct pathways for transcriptional regulation of anaerobic gene expression in Salmonella typhimurium.
J. Bacteriol.
168:389-397[Abstract/Free Full Text].
|
| 13.
|
Kessler, D.,
I. Leibrecht, and J. Knappe.
1991.
Pyruvate formate-lyase deactivase and acetyl-CoA reductase activities of Escherichia coli reside on a polymeric protein particle encoded by adhE.
FEBS Lett.
281:59-63[Medline].
|
| 14.
|
Kessler, D.,
W. Herth, and J. Knappe.
1992.
Ultrastructure and pyruvate formate-lyase radical quenching property of the multienzyme AdhE protein of Escherichia coli.
J. Biol. Chem.
267:18073-18079[Abstract/Free Full Text].
|
| 15.
|
Leonardo, M. R.,
P. R. Cunningham, and D. P. Clark.
1993.
Anaerobic regulation of the adhE gene encoding the fermentative alcohol dehydrogenase of Escherichia coli.
J. Bacteriol.
175:870-878[Abstract/Free Full Text].
|
| 16.
|
Lorowitz, W., and D. P. Clark.
1982.
Escherichia coli mutants with a temperature-sensitive alcohol dehydrogenase.
J. Bacteriol.
152:935-938[Abstract/Free Full Text].
|
| 17.
|
McPhedran, P.,
B. Sommer, and E. C. C. Lin.
1961.
Control of ethanol dehydrogenase levels in Aerobacter aerogenes.
J. Bacteriol.
81:852-857[Free Full Text].
|
| 18.
|
Membrillo-Hernández, J.,
O. Kwon,
P. De Wulf,
S. E. Finkel, and E. C. C. Lin.
1999.
Regulation of adhE (encoding ethanol oxidoreductase) by the Fis protein in Escherichia coli.
J. Bacteriol.
181:7390-7393[Abstract/Free Full Text].
|
| 19.
|
Mikulskis, A.,
A. Aristarkhov, and E. C. C. Lin.
1997.
Regulation of expression of the ethanol dehydrogenase gene (adhE) in Escherichia coli by the catabolite repressor activator protein Cra.
J. Bacteriol.
179:7129-7134[Abstract/Free Full Text].
|
| 20.
|
Miller, J. H.
1972.
A short course in bacterial genetics.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y
|
| 21.
|
Rudolph, F. D.,
D. L. Purich, and H. J. Fromm.
1968.
Coenzyme A-linked aldehyde dehydrogenase from Escherichia coli. I. Purification, properties and kinetic studies of the enzyme.
J. Biol. Chem.
243:5536-5545.
|
| 22.
|
Saier, M. H., Jr., and T. M. Ramseier.
1996.
The catabolite repressor/activator (Cra) protein of enteric bacteria.
J. Bacteriol.
178:3411-3417[Free Full Text].
|
| 23.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y
|
| 24.
|
Schmitt, B.
1975.
Aldehyde dehydrogenase activity of a complex particle from Escherichia coli.
Biochimie
57:1001-1004[Medline].
|
| 25.
|
Simons, R. W.,
F. Houman, and N. Kleckner.
1987.
Improved single and multicopy lac-based cloning vectors for protein and operon fusions.
Gene
53:85-96[Medline].
|
| 26.
|
Tamarit, J.,
E. Cabiscol, and J. Ros.
1998.
Identification of the major oxidatively damaged proteins in Escherichia coli cells exposed to oxidative stress.
J. Biol. Chem.
273:3027-3032[Abstract/Free Full Text].
|
| 27.
|
Wing, H. J.,
S. M. Williams, and S. J. Busby.
1995.
Spacing requirements for transcription activation by Escherichia coli Fnr protein.
J. Bacteriol.
177:6704-6710[Abstract/Free Full Text].
|
| 28.
|
Xu, J., and R. C. Johnson.
1995.
Identification of genes negatively regulated by Fis: Fis and RpoS comodulate growth-phase-dependent gene expression in Escherichia coli.
J. Bacteriol.
177:938-947[Abstract/Free Full Text].
|
| 29.
|
Zucker, M.
1989.
On finding all suboptimal foldings of an RNA molecule.
Science
244:48-52[Abstract/Free Full Text].
|
Journal of Bacteriology, December 1999, p. 7571-7579, Vol. 181, No. 24
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Constantinidou, C., Hobman, J. L., Griffiths, L., Patel, M. D., Penn, C. W., Cole, J. A., Overton, T. W.
(2006). A Reassessment of the FNR Regulon and Transcriptomic Analysis of the Effects of Nitrate, Nitrite, NarXL, and NarQP as Escherichia coli K12 Adapts from Aerobic to Anaerobic Growth. J. Biol. Chem.
281: 4802-4815
[Abstract]
[Full Text]
-
Goh, E.-B., Bledsoe, P. J., Chen, L.-L., Gyaneshwar, P., Stewart, V., Igo, M. M.
(2005). Hierarchical Control of Anaerobic Gene Expression in Escherichia coli K-12: the Nitrate-Responsive NarX-NarL Regulatory System Represses Synthesis of the Fumarate-Responsive DcuS-DcuR Regulatory System. J. Bacteriol.
187: 4890-4899
[Abstract]
[Full Text]
-
Echave, P., Tamarit, J., Cabiscol, E., Ros, J.
(2003). Novel Antioxidant Role of Alcohol Dehydrogenase E from Escherichia coli. J. Biol. Chem.
278: 30193-30198
[Abstract]
[Full Text]
-
Echave, P., Esparza-Ceron, M. A., Cabiscol, E., Tamarit, J., Ros, J., Membrillo-Hernandez, J., Lin, E. C. C.
(2002). DnaK dependence of mutant ethanol oxidoreductases evolved for aerobic function and protective role of the chaperone against protein oxidative damage in Escherichia coli. Proc. Natl. Acad. Sci. USA
99: 4626-4631
[Abstract]
[Full Text]
-
Thormann, K., Feustel, L., Lorenz, K., Nakotte, S., Durre, P.
(2002). Control of Butanol Formation in Clostridium acetobutylicum by Transcriptional Activation. J. Bacteriol.
184: 1966-1973
[Abstract]
[Full Text]
-
Fontaine, L., Meynial-Salles, I., Girbal, L., Yang, X., Croux, C., Soucaille, P.
(2002). Molecular Characterization and Transcriptional Analysis of adhE2, the Gene Encoding the NADH-Dependent Aldehyde/Alcohol Dehydrogenase Responsible for Butanol Production in Alcohologenic Cultures of Clostridium acetobutylicum ATCC 824. J. Bacteriol.
184: 821-830
[Abstract]
[Full Text]
-
Arnold, C. N., McElhanon, J., Lee, A., Leonhart, R., Siegele, D. A.
(2001). Global Analysis of Escherichia coli Gene Expression during the Acetate-Induced Acid Tolerance Response. J. Bacteriol.
183: 2178-2186
[Abstract]
[Full Text]
-
Membrillo-Hernandez, J., Echave, P., Cabiscol, E., Tamarit, J., Ros, J., Lin, E. C. C.
(2000). Evolution of the adhE Gene Product of Escherichia coli from a Functional Reductase to a Dehydrogenase. GENETIC AND BIOCHEMICAL STUDIES OF THE MUTANT PROTEINS. J. Biol. Chem.
275: 33869-33875
[Abstract]
[Full Text]
-
Echave, P., Esparza-Ceron, M. A., Cabiscol, E., Tamarit, J., Ros, J., Membrillo-Hernandez, J., Lin, E. C. C.
(2002). DnaK dependence of mutant ethanol oxidoreductases evolved for aerobic function and protective role of the chaperone against protein oxidative damage in Escherichia coli. Proc. Natl. Acad. Sci. USA
99: 4626-4631
[Abstract]
[Full Text]