INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

The reduction of acetyl-coenzyme A (CoA) to ethanol is essential for disposing of excess reducing equivalents by Escherichia coli when respiratory pathways fail to maintain redox balance. For instance, genetic blockage of the ethanol pathway prevents fermentative growth on glucose or mannitol as a sole carbon and energy source. The two-step reduction of acetyl-CoA to ethanol is catalyzed by a bifunctional enzyme encoded by the adhE gene (Fig. 1) located at 27.9 min (7, 10, 13, 16, 21, 24). In addition, this protein also functions as a deactivase of pyruvate-formate lyase (13, 14). Expression of adhE is about 10-fold higher during anaerobic than during aerobic growth, and this regulation is independent of ArcA and Fnr. The accumulation of reducing equivalents, possibly the NADH concentration or the NADH/NAD ratio, was suggested to be a signal for transcriptional regulation of adhE (5, 15). Three transcriptional proteins involved in the control of adhE expression have been identified, but none of them is directly responsible for redox regulation. The first protein, NarL (8), represses adhE expression, but this occurs only in the presence of nitrate (5, 15). The second protein, Cra (for catabolite repressor activator), represses adhE expression (19), but this transcriptional regulator is functional only when complexed with fructose-1-phosphate or fructose-1,6-bisphosphate as an effector (for a review, see reference 22). The third protein, Fis (for factor for inversion stimulation) (9, 28), is required for adhE transcription, but Fis is not known to require any effector for function and the expression of the fis gene itself is independent of the respiratory condition of growth (18).

View larger version (26K): [in this window] [in a new window]   FIG. 1.   Base sequence and locations of regulatory sites in the adhE promoter region. The distance between putative regulatory sequences and the 188 transcriptional start site is indicated at the bottom.

In addition to transcriptional controls, translation of the adhE mRNA depends on the activity of RNase III. It was suggested that intramolecular base pairing occludes the RBS (ribosomal binding site) and that cleavage of the obstructing secondary structure liberates the translation. The results of primer extension experiments indicated two putative adhE transcriptional start sites: one at position 292 and the other at position 188 from the translational start codon ATG (1). However, the mRNA starting at position 188 was not seriously considered for three reasons: (i) the primer extension might be prematurely terminated by a secondary structure of the full-length adhE mRNA, (ii) the short transcript starting at position 188 might be a breakdown product, and (iii) transcription from this site was not likely to require RNase III cleavage as predicted by the RBS occlusion model. The focus of the present study is to address the functionality of the downstream start site.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Strains, culture conditions, and reagents. The relevant characteristics and sources of the bacterial strains and plasmids used in this study are given in Table 1. Luria-Bertani (LB) medium (20) containing 0.1 M MOPS (morpholinepropanesulfonic acid) and 0.2% glucose was adjusted to pH 7.4 (LB-glucose medium). Minimal medium was prepared as previously described (19). Culture optical density at 600 nm (OD₆₀₀) was determined in a DU640 Beckman spectrophotometer. Aerobic cultures were grown at 37°C with shaking (200 rpm) in 250-ml Erlenmeyer flasks containing 10 ml of medium. Anaerobic cultures were grown at 37°C in 10-ml test tubes filled to the brim. When used, nitrate was added at 40 mM. The BBL (Cockeysville, Md.) Gas-Pack system was used for anaerobic growth on solid media. Antibiotics, purchased from Sigma, were added when appropriate at the following concentrations: ampicillin, 200 µg/ml; tetracycline, 15 µg/ml; and kanamycin, 100 µg/ml. Oligonucleotides were custom synthesized by Oligos Etc., Inc. All enzymes were purchased from New England Biolabs.

Genetic methods and DNA manipulations. Genetic crosses were performed by P1vir-mediated transduction (20). Standard methods were used for restriction endonuclease digestion and ligation of DNA (20, 23). Plasmid DNA was isolated by using the QIAPrep system from Qiagen, and the DNA fragments were isolated from agarose gels with the QIAquick kit (Qiagen). Transformation of bacteria with plasmid DNA was done by electroporation (23) with an E. coli Pulser (Bio-Rad). PCRs were carried out in a Minicycler (MJ Research), using Pfu DNA polymerase from Stratagene (La Jolla, Calif.).

Construction of adhE operon and protein fusions. Different protein and operon fusions of adhE to lacZ, (adhE-lacZ), were constructed on a plasmid and then transferred to  phage by recombination in vivo (25). To construct ADHop656 (operon fusion) and ADHpr656 (protein fusion), a 1.1-kb DNA fragment was excised from pADH8 by BglII and BstYI. The product was ligated into the BamHI site of the plasmid pRS415 (for an operon fusion) and pRS414 (for a protein fusion). The recombinant plasmids were used to transform strain MC4100 (lac). Each of these fusions comprises 656 bp upstream of the translational start site of adhE. To construct ADHop291 (operon fusion) and ADHpr291 (protein fusion), primers 291-5 (5'-CAATGAATTCACTGTTAGCTATAATGGCG-3') and 291-3 (5'-GCCGGATCCAGATCTTTCGGAGC-3') were used to amplify a 0.8-kb DNA fragment comprising 291 bp upstream of the adhE translational start site. The fragment was gel purified, digested with EcoRI and BamHI, and cloned into pRS415 (operon fusion) and pRS414 (protein fusion). To construct ADHop2656 (operon fusion), primers 2656-5 (5'-AGCGAGATCCACAAGATAATGGCC-3') and 2656-3 (5'-AGCTGGATCCGTAAGCAAGATTACTCACTTCTGGG-3') were used to amplify a 0.3-kb DNA fragment comprising a segment from position 656 to position 190 from the adhE translational start site. To construct ADHop3656 (operon fusion), primers 3656-5 (5'-AGCGGATCCACAAGATAATGGCC-3') and 3656-3 (5'-CGCTGGATCCCATTATAGCTAACAGTTAATAAATTGTAGTATG-3') were used to amplify a 0.4-kb DNA fragment comprising a segment from position 656 to position 267 from the adhE translational start site. For ADH656TATA, primers 3656-5 and 291-3 were used, but the plasmid pJMADH3 (see below) was used as a template. The fragments were gel purified, digested with BamHI and EcoRI, and cloned into pRS415. The sequence of the inserts was confirmed by automated sequencing (Core Facility at Harvard Medical School). The appropriate fusions in the plasmids were recombined onto RS45 to yield their correspondent ADH (Fig. 2). Each fusion was inserted into the chromosome of MC4100, and several transductants were isolated for assays of the activity level of -galactosidase and Ter tests (25). A single-copy lysogen bearing each fusion was isolated for further study.

View larger version (25K): [in this window] [in a new window]   FIG. 2.   Schematic representations of (adhE-lacZ) operon and (adhE-lacZ) protein fusions in  cassettes (identified on right). The numbers indicate base pair positions from the translational start site. Transcriptional start sites are denoted by bent arrows.

-Galactosidase assays. Exponential- (OD₆₀₀, 0.4) or stationary-phase (OD₆₀₀, 2.5) LB cultures (10 ml) of the desired strains were treated with chloramphenicol (final concentration, 40 µg/ml) and incubated for an additional 5 min at 37°C. The cultures were then pelleted, suspended in 2.5 ml of Z buffer (20), and kept on ice. Specific -galactosidase activity in cells permeabilized with chloroform and sodium dodecyl sulfate was assayed at 28°C and is expressed in Miller units (OD₄₂₀ per minute per OD₆₀₀ unit) (20). Each culture was assayed at least in triplicate; typically, these values gave a coefficient of variation (mean divided by the standard deviation) of <5%. At least three independent experiments were carried out under each set of growth conditions.

Ethanol oxidoreductase assays. Cells were disrupted by sonication, and the extracts were assayed at 25°C, essentially as previously described (17). The assay mixture (1 ml) consisted of 1.6 M ethanol, 0.3 M potassium carbonate buffer (pH 10), and 0.66 mM NAD.

Primer extension. Total RNA was isolated with the RNAeasy kit (Qiagen) from cells of strain ECL4010 growing anaerobically. Ten nanograms of 5'-end-labeled (23) oligonucleotide JM-1 (5'-CGCCAGGGTTTTCCCAGTCACGACG-3') corresponding to positions +46 to +28 relative to the ATG of the lacZ gene was mixed with 1 µg of total mRNA in 10 µl of the primer extension buffer (50 mM Tris-HCl [pH 8.3], 50 mM KCL, 10 mM MgCl₂, 10 mM dithiothreitol, 1 mM [each] deoxynucleoside triphosphate, 0.5 mM spermidine), heated at 75°C for 3 min, and cooled to room temperature for 10 min. Ten microliters of a prewarmed reverse transcriptase extension mixture (1 U of avian myeloblastosis virus reverse transcriptase [New England Biolabs] in primer extension buffer containing 5.6 mM sodium pyrophosphate) was added to the annealed primer-RNA complex, incubated at 42°C for 30 min, and ethanol precipitated. Nucleic acids were resuspended in formamide loading dye and separated on a 6% denaturing polyacrylamide gel. The size of the primer-extended product was calculated by running a known sequence ladder (M13mp18 DNA).

Construction of adhE plasmids and site-directed mutagenesis. Plasmids pBR322 bearing adhE alleles were constructed by inserting a PCR fragment containing the entire adhE coding region and the desired length of the regulatory region. The insert of plasmid pJMADH1 was made by using primer 3656-5 (5'-AGCGGGATCCACAAGATAATGGCC-3') and primer JMADH13 (5'- AGCTGGATTCATTGCCCAGAAGGGGCCGTTTATGTTGCCAGACAG CGC-3'). The insert for plasmid pJMADH2 was made by using primer 291-5Bam (5'-CAATGGATCCACTGTTAGCTATAATGGCG-3') and primer JMADH13. The inserts were gel purified with the QIAquick kit and cloned into pBR322 predigested with BamHI. Site-directed mutagenesis of the Pribnow TACAAT box was carried out with the QuickChange kit (Stratagene) with plasmid pJMADH1 as a template. The primers TATA5 (5'-GTAGCCACCAAATCATACCGGGCCTTATTAACTGTTAGC-3') and TATA3' (5'-GCTAACAGTTAATAAGGCCCGGTATGATTTGGTGGCTAC-3') were used for site-directed mutagenesis. The new plasmid was designated pJMADH3. Confirmation of the sequences of all the inserts was performed by automated DNA sequencing (Core Facility at Harvard Medical School).

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Expression and redox regulation of (adhE-lacZ)291 operon and protein fusions bearing only the 188 transcriptional start site. To test whether the downstream transcriptional start site was functional, we constructed two pairs of adhE-lacZ fusions differing in the lengths of their promoter regions: (i) a (adhE-lacZ)656 operon fusion and a (adhE'-'lacZ)656 protein fusion extending to position 656 from the translational start site (Fig. 2A and F) and (ii) a (adhE-lacZ)291 operon fusion and a (adhE'-'lacZ)291 protein fusion extending to position 291 from the translational start site (Fig. 2B and G). The pair of long fusions contained both the 292 and 188 transcriptional start sites, whereas the pair of short fusions contained only the 188 transcriptional start site. Each of the four fusions was then inserted into the att site of strain MC4100 (adhE⁺ lac) to give strains ECL4013 [(adhE-lacZ)656], ECL4012 [(adhE'-'lacZ)656], ECL4011 [(adhE-lacZ)291], and ECL4010 [(adhE'-'lacZ)291]. The adhE⁺ (adhE-lacZ) merodiploid reporter strains were grown aerobically or anaerobically in LB-glucose, and their -galactosidase activity levels were determined.

View this table: [in this window] [in a new window]   TABLE 2.   -Galactosidase activities of exponentially growing cells (OD600, 0.4) bearing different (adhE-lacZ) operon fusions in LB-glucose medium

View larger version (31K): [in this window] [in a new window]   FIG. 3.   Primer extension analysis of the (adhE'-'lacZ)291 protein fusion. Primer JM-1, complementary to positions +46 to +28 of the lacZ gene, was annealed with total RNA of strain ECL4010 and extended with avian myeloblastosis virus reverse transcriptase. A known DNA ladder (lanes G, A, T, and C) was used to calculate the length of the transcript. The only transcript observed (at 227 nucleotides [nt]) corresponds to the 188 transcriptional start site of the adhE gene (lane 1).

Effect of Fnr on the anaerobic expression of (adhE-lacZ)291 operon and protein fusions. A putative Fnr site has been previously noted (11, 13), but in retrospect its location at position 769 seems too far from the putative adhE transcriptional start sites. Moreover, in two previous independent studies, no effect of an fnr null mutation on (adhE-lacZ) and adhE⁺ expressions was observed in the merodiploids (5, 15). However, we noticed that, centered at 42.5 bp from the 188 transcriptional start site, there is a 9/10 Fnr consensus sequence (TTGAT-N₄-ATCAA) (Fig. 1). The location of this box is typical of that found in target promoters positively regulated by Fnr (27).

Effect of Cra on the anaerobic expression of (adhE-lacZ)291 operon and protein fusions. From positions 265 to 251 lies the previously identified Cra box (Fig. 1) (19). To determine whether the (adhE-lacZ)291 fusion can be regulated, the cra::kan allele was transduced from strain LJ2805 into strain ECL4011, yielding strain ECL4024 [(adhE-lacZ)291 cra::kan]. Strains ECL4011 and ECL4024 were then grown aerobically or anaerobically in LB-glucose medium, and their -galactosidase activity levels were compared. No significant effect of Cra was found. A set of experiments with the protein fusions also showed no Cra effect (data not shown).

Effect of NarL on the anaerobic expression of (adhE-lacZ)291 operon and protein fusions. The NarL box comprises two heptamer inverted repeats (TACYYMT, where Y is C or T and M is A or C) separated by 2 bases (8). Sequence scanning revealed a putative site, TACCCAG-N₂-GTGAGTA, located between positions 199 and 213 from the translational start site, differing from the consensus in only 1 base in each heptamer (Fig. 1). In agreement with previous reports (5, 15), the expression of (adhE-lacZ)656 was strongly repressed both aerobically and anaerobically by nitrate in strain ECL4013 (narL⁺) but not in its isogenic derivative ECL4034 (narL::Tn10) (data not shown). Similarly, the expression of (adhE-lacZ)291 was nitrate repressible both aerobically and anaerobically in strain ECL4011 but not in strain ECL4033 (narL::Tn10) (Table 3). The results were supported by the responses of the two corresponding protein fusions (data not shown).

View this table: [in this window] [in a new window]   TABLE 3.   Aerobic and anaerobic -galactosidase activity of (adhE-lacZ)291 in the presence of 40 mM nitrate and a narL mutationa

Effect of Fis on the anaerobic expression of (adhE-lacZ)291 operon and protein fusions. To test for a role of Fis, strain ECL4011 [(adhE-lacZ)291] and the isogenic strain ECL4027 [(adhE-lacZ)291 fis::kan] were grown aerobically or anaerobically in LB-glucose medium and assayed for -galactosidase activity levels. As shown in Table 2, the lack of Fis did not affect the ninefold anaerobic increase in expression of (adhE-lacZ)291. As expected from our previous finding (18), a null mutation in fis greatly diminished the anaerobic expression of the (adhE-lacZ)656 with the full-length promoter region. Concordant results were obtained from the corresponding protein fusions (data not shown). Thus, Fis is required only for transcriptional initiation from the upstream start site at 292.

Effect of RpoS on the expression of (adhE-lacZ)291 operon fusion. During the course of this study, we were struck by an observation that the level of -galactosidase activity of an aerobic culture of strain ECL4011 [(adhE-lacZ)291] was severalfold higher in stationary- than in exponential-phase cells. Although this phenomenon could be explained by oxygen limitation in the culture, a growth phase regulation could not be excluded. We therefore monitored the -galactosidase activity levels in strain ECL4011 [(adhE-lacZ)291] and its fnr::Tn10 and/or rpoS::kan derivatives during the growth cycle. We found that, in the wild-type background, the increase in activity level occurred abruptly at the onset of stationary phase (Fig. 4, top left panel). In the fnr::Tn10 rpoS⁺ background, there was a sixfold increase in activity at the onset of stationary phase (OD₆₀₀, 2.0), but the levels reproducibly dropped 50% afterwards, possibly resulting from specific protein degradation in the absence of Fnr-promoted synthesis (Fig. 4, top right panel). By contrast, in the fnr⁺ rpoS::kan background, there was no increase in the activity level until the culture was 5 h into the stationary phase, eventually reaching five times that found in the exponential-phase cells (Fig. 4, bottom left panel). It appears that the relatively early increase in the enzyme activity level in the fnr::Tn10 rpoS⁺ cells reflected RpoS transcriptional activation following the onset of stationary phase, whereas the relatively late increase in the enzyme activity level in the fnr⁺ rpoS::kan cells reflected Fnr transcriptional activation in gradual response to anoxia. This interpretation is consistent with the finding of a low level of -galactosidase activity throughout the growth cycle in the fnr::Tn10 rpoS::kan double mutant (Fig. 4, bottom right panel).

View larger version (26K): [in this window] [in a new window]   FIG. 4.   Effect of mutations in rpoS and/or fnr on the -galactosidase activity of the (adhE-lacZ)291 operon fusion throughout the growth cycle. The open squares represent the OD600, and the solid circles represent -galactosidase activity in Miller units.

-Galactosidase synthesis specified by the (adhE-lacZ)291 protein fusion is exempt from RNase III requirement. The availability of the fusion without the 292 transcriptional start offered an opportunity to test genetically the proposed model of RBS occlusion by the secondary structure of the 5' region (1). Since the abbreviated mRNA is no longer expected to form the elaborate 5' stem-loop complex (Fig. 5), translation of the open reading frame may no longer require the intervention of RNase III. As shown in Table 4, the -galactosidase activity level specified by the (adhE-lacZ)291 protein fusion is independent of RNase III (compare strain ECL4010 with strain ECL4018). In further support of the RBS occlusion model, we found that when the lacZ open reading frame possessing its own RBS was placed sufficiently downstream of the adhE RBS, as in the case of the (adhE-lacZ)656 operon fusion (Fig. 2A), the synthesis of -galactosidase also became RNase III independent (compare strain ECL4013 with strain ECL4017). As expected, the -galactosidase activity level specified by the (adhE-lacZ)656 protein fusion (in which the translation of lacZ depended on the adhE RBS [Fig. 2F]) remained RNase III dependent (compare strain ECL4012 with strain ECL4016).

View larger version (16K): [in this window] [in a new window]   FIG. 5.   Probable structures of the 5' untranslated regions of two different adhE transcripts. The MFold program (29) was used to model the thermodynamically most favorable secondary structure of the 5' segment of adhE transcript starting at position 292 (A) or 188 (B).

View this table: [in this window] [in a new window]   TABLE 4.   RNase III dependence of -galactosidase activity specified by different (adhE-lacZ) fusion constructsa

Qualitative evidence for the silencing of the downstream start site by the upstream start region. One phenotype of the adhE::kan mutant strain (ECL3999) is its inability to grow anaerobically on glucose minimal medium (15, 16). To test the abilities of various adhE constructs to complement an adhE null mutation, we used three different pBR322-based plasmids: (i) pJMADH1, containing the adhE structural gene plus its regulatory region up to position 656 from the translational start site; (ii) pJMADH2, similar to pJMADH1 but lacking the region upstream of position 291; and (iii) pJMADH3, similar to pJMADH1 but with the putative Pribnow TACAAT box of the 292 site changed to CGGGCC. As shown in Table 5, the first and second, but not the third, plasmid restored the ability of strain ECL3999 (adhE::kan) to grow anaerobically on minimal glucose medium. It should be mentioned that pJMADH1 transformants appeared as visible colonies after 18 h of incubation but pJMADH2 transformants appeared only after 48 h. Transformants of pJMADH3, however, gave rise to two colonies (probably suppressor mutants) after 72 h of incubation. These results lend support to the notion that the upstream regulatory region silences transcription initiated at position 188, at least under the experimental conditions employed.

Quantitative evidence for the silencing of the downstream start site by the upstream start region. Two approaches were designed to test the hypothesis that the upstream promoter region (up to position 656) acts as a silencer of downstream transcription. First, if the downstream promoter is ordinarily not contributing to the net transcription of adhE, then a (adhE-lacZ) fusion containing the 292, but not the 188, transcriptional start site should express lacZ at an undiminished level. Accordingly, we constructed two operon fusions with abbreviated promoters: (i) (adhE-lacZ)2656, comprising an adhE segment from bp 656 to 290 joined to a lacZ sequence that includes its own RBS, and (ii) (adhE-lacZ)3656, comprising an adhE segment from bp 656 to 267 joined to a lacZ sequence that includes its own RBS (Fig. 2C and D, respectively). Strains bearing a single copy of either fusion exhibited a -galactosidase activity level that was indistinguishable from that of the (adhE-lacZ)656-bearing strain, when grown aerobically or anaerobically (data not shown).

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

The emergence of AdhE from a fusion of an alcohol oxidoreductase with an aldehyde oxidoreductase (13) might be an important turning point in the evolution of ethanol fermentation by E. coli. The fused protein not only would facilitate an intramolecular interconversion of acetyl-CoA to ethanol but also would provide additional domain surfaces to acquire the deactivase activity for pyruvate formate-lyase (14). There may well be other acquired biochemical functions yet to be discovered. For instance, we do not yet know the biological significance of spirosome structures arising from the AdhE molecules (13, 14).

The acquisition of multiple functions by the AdhE protein can be expected to have advanced hand in hand with the elaboration of increasingly complex control of gene expression. The embellishment and enlargement of the promoter, associated with the recruitment of different regulatory proteins, should be a part of this process. The direct roles of Cra (19) and Fis (18, 28) have been established, although the functional significance of Fis control remains a puzzle. The physiological role of Fnr is still in question, and the nature and significance of the RpoS effect on adhE expression require exploration.

In the meantime, the regulatory element responsible for redox control continues to elude identification. Only a few genes, including adhE, are expressed at significantly increased levels anaerobically without intervention by Fnr (11). In some cases, the increased expression is dependent on DNA supercoiling. Examples include tppB, torA, pepN, and tonB (12). In other cases, such as hya and cyx (2-4), the increased expression is dependent on the anaerobic transcriptional factor AppY. We found that the anaerobic expression of adhE is independent of AppY but is influenced by DNA topology (data not shown).

At the posttranslational level, the AdhE protein is rapidly and irreversibly inactivated during aerobic metabolism. The Fe²⁺ bound to the alcohol oxidoreductase domain of the protein is responsible for this inactivation by catalyzing the oxidative destruction of certain amino acid residues via the Fenton reaction (26). Enzyme inactivation upon the shift from anaerobic to aerobic metabolism accelerates the diversion of the inefficient fermentative mode of energy generation by covalent dismutation to the highly efficient mode of energy generation by respiration.

The key enigma, highlighted by this study, is the presence of two transcriptional start sites in the adhE promoter. The actual existence of the transcript starting at position 188 in cell extracts (1) and the ability of Fnr to activate the anaerobic expression of the 5'-truncated (adhE-lacZ)291 fusion suggest that under certain conditions the silencer effect of the upstream promoter region can be lifted to allow significant transcription at the 188 site. How can such conditions be discovered? A possible approach would be to characterize the suppressor mutation(s) that allowed the anaerobic expression of adhE from the 188 start site (in plasmid pJMADH3 [Table 5]). A successful result might even reveal the teleonomic basis for two adhE transcriptional start sites and the significance of the RNase III requirement for the translation of the long transcript.

Alternatively, the 188 site could be a vestige in the adhE promoter that is evolving away from Fnr control. However, such a hypothesis is not only difficult to test but is also unattractive in view of the parsimonious use of DNA in prokaryotes, which should include the prompt deletion of superfluous DNA. Moreover, Fnr sites in adhE are found in the genomes of other bacterial species, including Actinobacillus pleuropneumoniae, Clostridium acetobutylicum, Lactococcus lactis, and Salmonella typhimurium.