Previous Article | Next Article ![]()
Journal of Bacteriology, February 1999, p. 726-730, Vol. 181, No. 3
Faculty of Pharmaceutical Sciences, Setsunan
University, Hirakata, Osaka 573-0101, Japan
Received 10 August 1998/Accepted 23 November 1998
The physiological function of a new gene, hereby designated
merG, located between merA and merB
on the broad-spectrum mer operon of Pseudomonas
strain K-62 plasmid pMR26 was investigated. The 654-bp merG
gene encodes a protein with a canonical leader sequence at its N
terminus. The processing of the signal peptide of this protein was
dose-dependently inhibited by sodium azide, a potent inhibitor of
protein export. These results suggest that the mature MerG protein (ca.
20 kDa) may be located in the periplasm. Deletion of the
merG gene from the broad-spectrum mer operon of pMR26 had no effect on the inorganic mercury resistance phenotype, but
rendered the bacterium more sensitive to phenylmercury than its
isogenic wild-type strain. Escherichia coli cells bearing pMU29, which carries a deletion of the merG gene, took up
significantly more phenylmercury than the bacteria with the intact
plasmid pMRA17. When the merG gene in a compatible plasmid
was transformed into the E. coli strain carrying pMU29, the
high uptake of and high sensitivity to phenylmercury were almost
completely restored to their original levels. These results demonstrate
that the merG gene is involved in phenylmercury
resistance, presumably by reducing in-cell permeability to phenylmercury.
Bacterial resistance to
organomercurials has mostly been shown to result from the cleavage of
the carbon-mercury linkage by the organomercurial lyase enzyme,
followed by the reduction of Hg2+ to Hg0 by the
mercuric reductase enzyme. The genetics and biochemistry of
organomercurial resistance have been extensively studied and reviewed
(1, 5, 14, 19, 26, 27). These studies focused predominantly
on mercury resistance (mer) operons. Most of the mer operons encoding a broad-spectrum resistance phenotype
have been shown to consist of a regulatory gene (merR), an
operator-promoter region, and at least four structural genes,
merT, merP, merA, and merB
(7, 8, 10, 11, 17, 21).
Pseudomonas strain K-62, a bacterial strain with
broad-spectrum mercury resistance isolated from phenylmercury-polluted
soil, has been shown to have a resistance to phenylmercury
approximately a thousand times higher than that of other bacteria, such
as Escherichia coli and Pseudomonas aeruginosa
(30). Two separate organomercurial lyase enzymes, designated
S-1 and S-2, each with somewhat different properties and substrate
specificities (28, 29), were previously believed to be the
elements contributing to Pseudomonas strain K-62's
resistance to phenylmercury. Genetic studies of resistance determinants, however, have shown that the mercury resistance of this
soil strain had to do with pMR26 and pMR68, two of the six plasmids
(8). Two mer operons in this soil strain were mapped on a 26-kb plasmid (pMR26), and one was cloned into the SacI site of the cloning vector, pBluescriptII
(8). The resultant plasmid, pMRA17, expressed a typical
broad-spectrum mercury resistance phenotype. DNA sequence analysis of a
6.6-kb SacI fragment, encompassing the whole region required
for the broad-spectrum mercury resistance, of pMRA17 revealed that it
comprised six open reading frames (ORFs), five of which were identified
as merR, merT, merP, merA,
and merB (10). The order and function of
mer genes concerned with the mercurial resistance on the
6.6-kb fragment of pMRA17 are basically the same as those of the
broad-spectrum mer operon of pDU1358, except that it has an
additional ORF located between merA and merB
genes (10).
The additional ORF, however, had no homology with the mer
genes known to date. Deletion of this ORF rendered the bacterium more
sensitive to phenylmercury than its isogenic wild-type strain, while
surprisingly retaining full resistance to Hg2+
(10). The purpose of this paper is to characterize and
define more precisely the roles of this ORF, hereby designated
merG, in phenylmercury resistance.
Bacterial strain, plasmids, and growth conditions.
The
bacterial strain and plasmids used in this study are listed in Table
1. The E. coli strain was
grown at 37°C in Luria-Bertani medium (22). When
necessary, the medium was supplemented with 100 µg of ampicillin or
25 µg of kanamycin per ml.
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
The merG Gene Product Is Involved in
Phenylmercury Resistance in Pseudomonas Strain
K-62
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References
TABLE 1.
Bacterial strain and plasmids used in this study
Plasmid construction. To construct a plasmid containing the broad-spectrum resistance mer operon of pMRA17, the plasmid pMRA17 was digested with BglII, and the resulting 5' overhang was filled with deoxynucleoside triphosphates (dNTPs) by DNA polymerase I (Klenow fragment). After digestion with EcoRV, the 4.7-kb fragment was inserted into the SmaI site of the cloning vector pBluescriptII SK+. The resultant plasmid was designated pMR96. Plasmid pMC89 was constructed by digesting pMR96 with AflII-NheI, and the resulting 5' overhang was filled with dNTPs by DNA polymerase I (Klenow fragment). The 7.2-kb fragment was religated with a DNA ligation kit.
pMEV89 containing the merG gene was constructed by cloning the 1.2-kb HindIII-BamHI fragment of pMC89 into the HindIII-BamHI site of a cloning vector, pSTV29. pMUE74 carrying the merG gene of pMRA17 was constructed as follows. A 697-bp fragment containing the merG gene was PCR amplified with primer 1 (5'3325GCTCTAGAGGGCACCAAAACAGGG3348 3') and primer 2 (5'3998GAAGATCTCTTTGTGCCTTGCCGG4021 3') containing restriction sites for XbaI and BglII, respectively. pMRA17 was used as the template. After digestion with XbaI and BglII, the fragment was cloned into the XbaI-BglII site of plasmid pTUE1122, which contains DNA sequence encoding six consecutive histidine residues immediately posterior to the BglII site (Table 1). The structures of the relevant genes and restriction sites in the constructed plasmid used in this study are schematically illustrated in Fig. 1.
|
DNA sequencing. The complete sequence of the 654-bp merG gene was determined from both strands by using the dideoxy chain-termination DNA sequencing method of Sanger et al. (24). Sequence analysis was also performed with a DNA autosequencer (model 373A; Applied Biosystems, Inc., Foster City, Calif.) with a Taq dye terminator cycle sequencing kit.
Maxicell analysis. Maxicells were used to specifically label plasmid-encoded polypeptides. The transformants of E. coli CSR603 carrying the plasmids of interest were incubated aerobically at 37°C in K medium (M9 medium supplemented with 1% Casamino Acids and 0.1 µg of thiamine per ml). After 50 s of UV irradiation (50 J/m2), the cells were treated with D-cycloserine (150 µg/ml), and the maxicell proteins were then labeled with [35S]methionine (1,000 Ci/mmol; New England Nuclear) according to the original protocol (23). For induction of the mer gene-encoded polypeptides, 1 µM HgCl2 was added to the cells during the 1-h period of labeling with [35S]methionine. Gel electrophoresis was performed by the method of Laemmli (12), and sodium salicylate was used for detection of the 35S-labeled polypeptide (3).
Protein purification and analysis.
An E. coli
XL1-Blue strain carrying pMUE74 was cultured in Luria-Bertani medium
supplemented with 100 µg of ampicillin per ml at 37°C for 2 h,
and 1 mM isopropyl-
-O-thiogalactopyranoside (IPTG) was
added for a further 30 min of cultivation. After incubation with IPTG,
the cells were incubated at 37°C in the absence or presence of
various concentrations of sodium azide, an inhibition of protein
transport (18). After 2 h, the cells were harvested by
centrifugation at 10,000 × g for 1 min and resuspended
in 1% sodium dodecyl sulfate (SDS) sonication buffer (1% SDS, 100 mM phosphate buffer [pH 7.8], 300 mM NaCl). The cells were disrupted by
boiling for 5 min, and the cell debris was removed by centrifugation at
10,000 × g for 5 min at 4°C. The resultant
supernatant was gently mixed with Ni-nitrilotriacetic acid (NTA) resin
(Qiagen) at room temperature for 16 h. The mixture was
centrifuged, and the pellet was washed three times with 1% SDS
sonication buffer. The pellet was then mixed with SDS-polyacrylamide
gel electrophoresis (PAGE) sample buffer (2% SDS, 60 mM Tris-HCl [pH
6.8], 5% mercaptoethanol, 5% sucrose, 0.002% bromophenol blue)
containing 100 mM EDTA. After incubation for 5 min at 100°C, the
supernatant obtained by centrifugation was resolved by SDS-PAGE (17.5%
polyacrylamide gel). Gel electrophoresis was performed by the method of
Laemmli (12), and Coomassie brilliant blue was used for
protein staining. After purification, the N-terminal amino acid
sequences of the 25- and 21-kDa proteins were determined, respectively,
with an HP G1005A protein sequencing system (Hewlett-Packard).
Mercury resistance assay. Resistance of bacteria to HgCl2 and phenylmercuric acetate (PMA) was determined on petri dishes according to the method of Foster et al. (6). The zones of inhibition of growth around the disks were measured after incubation at 37°C for 16 h.
Mercury volatilization assay. A qualitative detection of nonradioactive mercury volatilization by the cells was done according to the X-ray film method described by Nakamura and Nakahara (15). Cells were grown, induced with 1 µM Hg2+, and harvested. Cells were resuspended in 0.15 ml of 70 mM phosphate buffer (pH 7.0) containing 0.5 mM EDTA, 0.2 mM magnesium acetate, 5 mM sodium thioglycolate, and 184 µM HgCl2 or 149 µM PMA in a microplate. The plate was covered with X-ray film in the darkroom. The foggy area on the film was the result of the reduction of Ag+ emulsion by the mercury vapor formed from HgCl2 and PMA.
Mercury uptake assay. Bacterial cells were grown in Luria-Bertani medium in the absence or presence of 0.5 µM HgCl2 or PMA. The late-log-phase cells were harvested and resuspended in Luria-Bertani medium containing 100 µg of chloramphenicol per ml, 100 µM EDTA, and 5 µM 203Hg2+ (136 mCi/mmol) or 50 µM 14C6H5Hg+ (30 mCi/mmol). After incubation at 37°C, aliquots (0.5 ml) were removed periodically and filtered on a Whatman GF/B glass microfiber filter (0.45-µm pore diameter). The filters were washed three times with 5 ml of Luria-Bertani medium, and the radioactivity on the filter was measured with a Beckman gamma scintillation counter (GAMMA-5500) or liquid scintillation spectrometer (Aloka LSC-3500). The standard deviations of measurement were less than 10%.
Nucleotide sequence accession number. The nucleotide sequence of merG has been deposited in the EMBL/GenBank/DDBJ Nucleotide Sequence Database under accession no. D83080.
| |
RESULTS |
|---|
|
|
|---|
Evidence that merG codes for phenylmercury resistance. Plasmid pMRA17 carries a 6.6-kb SacI-fragment of the Pseudomonas strain K-62 plasmid pMR26, which encodes a typical broad-spectrum mercurial resistance based on the degradation of organomercury and reduction of the resultant Hg2+ to Hg0 (10). A new gene, merG, which specified a protein with a deduced molecular mass of 20 kDa, was found in the broad-spectrum mer operon of pMR26.
To define the roles of merG, a series of deletion plasmids were constructed (Fig. 1 and Table 1). As shown in Fig. 2A, the 20-kDa protein was not detected in maxicells carrying merG-deleted plasmid pMU29. pMU29, however, still expressed its ability to volatilize mercury, not only from Hg2+, but also from C6H5Hg+ (Fig. 2B). Deletion mutation in the merG region did not impair Hg2+ resistance but significantly decreased phenylmercury resistance (Fig. 2C). These results suggest that merG may be involved in phenylmercury resistance.
|
DNA sequence and properties of merG. The nucleotide sequence of the 950-bp NcoI-NheI fragment of pMEV89 which contained the entire merG gene was carefully redetermined and is identical to that previously reported for the merG region (10). (Note that an error was made at position 277 of the merG gene region. There should have been a "c" at this position, but it was inadvertently omitted in the previous report [10].) There is a 654-bp merG gene, preceded by a potential ribosome binding site. From the DNA sequence data, the protein encoded by this gene has been predicted to have molecular mass of 23.8 kDa, which is about 4 kDa larger than that detected in maxicell analysis (Fig. 2A).
The fate of MerG protein fused on its C terminus of eight amino acid residues (RSHHHHHH; 1 kDa) in cells with pMUE74 was studied. As shown in Fig. 3, a protein with molecular mass of 21 kDa was predominantly detected in the cells with pMUE74. When the cells were treated with sodium azide, an inhibitor of protein export (18), an additional protein with a molecular mass of 25 kDa was detected in the cells. The appearance of the 25-kDa protein was dose-dependently increased by sodium azide, along with the decrease of the appearance of the 21-kDa protein (Fig. 3). The N-terminal amino acid sequences of the 25- and 21-kDa proteins overlapped completely with those predicted from translation of the DNA sequence at positions 1 to 5 (MFCDI) and 35 to 39 (AYDFS). These results suggest that the 21-kDa protein is the exported product of the 25-kDa protein encoded by pMUE74.
|
Role of merG in phenylmercury resistance. To study the function of merG in mercury resistance, uptake of radioactive mercury by the cells with the merG-deleted plasmid pMU29 was examined. No significant difference in the uptake of 203Hg2+ was found between the cells with pMU29 and pMRA17 (Fig. 4A). However, the cells with pMU29 took up appreciably more 14C6H5Hg+ than the cells with pMRA17 (Fig. 4B). Transformation of plasmid pMEV89 containing the merG gene into the pMU29-bearing cells had no effect on the uptake of 203Hg2+, but caused a significant reduction in the uptake of 14C6H5Hg+ (Fig. 4A and B).
|
|
| |
DISCUSSION |
|---|
|
|
|---|
From a Pseudomonas strain K-62 plasmid, pMR26, we had previously uncovered a new gene which had no homology with any published mer genes (10). The new gene was found to be located between the merA and merB genes on the broad-spectrum mer operon of pMR26. In this paper, we have further characterized and defined the physiology of this new gene. The new gene is hereby designated merG.
In agreement with our previous results (10), deletion of this new gene resulted in a decrease in phenylmercury resistance, but not in a total loss of the resistance or of volatilization activity (Fig. 2B and C). These results clearly demonstrate that merG plays a role in the expression of phenylmercury resistance.
An independent determination of the DNA sequence agreed with what was previously reported. There is, however, an error in the DNA sequence in the previous report (10). There should have been a "c" at position 3639, but it was inadvertently omitted. The merG gene is 654-bp long, encoding a 217-amino-acid polypeptide with a deduced molecular mass of 23.8 kDa; however, no 23.8-kDa protein was detected in the maxicell analysis (Fig. 2A). There is no doubt that the 20-kDa protein detected by maxicell analysis is encoded by merG, because this protein was no longer detected coincidentally along with the gene deleted from the mer operon (Fig. 2A). It was this discrepancy that prompted us to characterize the merG gene further.
The amino acid sequence of the gene product, predicted from the DNA sequence of merG, has a good leader sequence which contains a short positively charged region at the N terminus followed by a hydrophobic region and a signal peptide cleavage site (ALAA) at position 32 to 35. This characteristic N-terminal sequence is homologous to the "leader sequences" of known periplasmic proteins (13). The formation of the 21-kDa protein was significantly inhibited by sodium azide in a dose-dependent manner (Fig. 3). In addition, the 21-kDa protein was predominantly detected in the periplasmic fraction, suggesting that the MerG protein may be located in the periplasm.
It is interesting to note that deletion of the merG gene resulted in a significant decrease in the phenylmercury resistance, but not in a total loss of the resistance (Fig. 2C). Deletion of merG did not impair the enzymatic activities encoded by merA and merB, because the bacteria carrying pMRA17 and pMU29 still volatilized mercury from the C6H5Hg+ taken up by the cells (Fig. 2B), and no difference in the rate of 14C6H5Hg+ disappearance was found between the cells with pMRA17 and those with pMU29 (data not shown). In addition, the radioactivity in the culture medium was constant during the culture of bacteria carrying plasmid pMRD141 and pMEV89 in the presence of 14C6H5Hg+ (data not shown). These results suggest that the MerG protein-specified phenylmercury resistance seems to be due to the efflux mechanism rather than mercury biotransformation.
Reduced uptake of mercury has been put forward as one of the mechanisms for bacterial resistance to mercurials (20). Several lines of evidence obtained in this study strongly suggest that merG is involved in the reduction of cellular permeability to C6H5Hg+. (i) Although deletion of the merG gene had no apparent effect on the accumulation of Hg2+, it caused an increase in the accumulation of 14C6H5Hg+ compared to the level in the strain with pMRA17 (Fig. 4A and B). (ii) The high accumulation of 14C6H5Hg+ was completely abolished when pMEV89 was introduced into the bacterial strain with pMU29 (Fig. 4B). (iii) Transformation of pMEV89 into the bacteria carrying pMRD141 caused a significant reduction in the uptake of 14C6H5Hg+, but not that of 203Hg2+ (Fig. 4C and D). And finally, (iv) the hypersensitivity to phenylmercury in the bacteria with pMRD141 was markedly reduced (Fig. 5). Tonomura et al. (30) previously reported that approximately 70% of the phenylmercury taken up by Pseudomonas strain K-62 was detected mainly on the cell surface, and they speculated that this soil strain might be less permeable to mercurials than other mercurial-sensitive bacteria. Our results confirmed their speculation.
In conclusion, the merG gene is involved in the bacterial expression of phenylmercury resistance. It is plausible that the resistance is the result of a reduction in the cellular permeability to phenylmercury.
| |
ACKNOWLEDGMENTS |
|---|
We are grateful to K. Watabe and H. Takamatsu of Setsunan University for the gift of plasmid pTUE1122. We also thank Y. Uno and M. Nakayama for technical assistance and C. Lee for critical reading of the manuscript.
This work was supported in part by a Grant-in-Aid for Encouragement of Young Scientists (no. 09780512) to M.K. and a Grant-in-Aid for Scientific Research (C) (no. 10680555) to H.P.-H. from the Ministry of Education, Science and Culture, Japan, and a grant from Sumitomo Foundation to H.P.-H.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Faculty of Pharmaceutical Sciences, Setsunan University, 45-1 Nagaotoge-cho, Hirakata, Osaka 573-0101, Japan. Phone: (81-720) 66-3158. Fax: (81-720) 50-7020. E-mail: houhide{at}pharm.setsunan.ac.jp.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Brown, N. L.
1985.
Bacterial resistance to mercury reductio ad absurdum?
Trends Biochem. Sci.
10:400-403.
|
| 2. |
Bullock, W. O.,
J. M. Fernandez, and J. M. Short.
1987.
XL1-Blue: a high efficiency plasmid transforming recA Escherichia coli strain with -galactosidase selection.
BioTechniques
5:376-379.
|
| 3. | Chamberlain, J. P. 1979. Fluorographic detection of radioactivity in polyacrylamide gels with the water-soluble fluor, sodium salicylate. Anal. Biochem. 98:132-135[Medline]. |
| 4. |
Chang, A. C. Y., and S. N. Cohen.
1978.
Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid.
J. Bacteriol.
134:1141-1156 |
| 5. | Foster, T. J. 1987. The genetics and biochemistry of mercury resistance. Crit. Rev. Microbiol. 15:117-140[Medline]. |
| 6. |
Foster, T. J.,
H. Nakahara,
A. A. Weiss, and S. Silver.
1979.
Transposon A-generated mutations in the mercuric resistance genes of plasmid R100-1.
J. Bacteriol.
140:167-181 |
| 7. |
Griffin, H. G.,
T. J. Foster,
S. Silver, and T. K. Misra.
1987.
Cloning and DNA sequence of the mercuric- and organomercurial-resistance determinants of plasmid pDU1358.
Proc. Natl. Acad. Sci. USA
84:3112-3116 |
| 8. | Kiyono, M., T. Omura, H. Fujimori, and H. Pan-Hou. 1995. Organomercurial resistance determinants in Pseudomonas K-62 are present on two plasmids. Arch. Microbiol. 163:242-247[Medline]. |
| 9. | Kiyono, M., T. Omura, H. Fujimori, and H. Pan-Hou. 1995. Lack of involvement of merT and merP in methylmercury transport in mercury resistant Pseudomonas K-62. FEMS Microbiol. Lett. 128:301-306[Medline]. |
| 10. | Kiyono, M., T. Omura, M. Inuzuka, H. Fujimori, and H. Pan-Hou. 1997. Nucleotide sequence and expression of the organomercurial-resistance determinants from a Pseudomonas K-62 plasmid, pMR26. Gene 189:151-157[Medline]. |
| 11. |
Laddaga, R. A.,
L. Chu,
T. K. Misra, and S. Silver.
1987.
Nucleotide sequence and expression of the mercurial-resistance operon from Staphylococcus aureus plasmid pI258.
Proc. Natl. Acad. Sci. USA
84:5106-5110 |
| 12. | Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (London) 227:680-685[Medline]. |
| 13. | Michaelis, S., and J. Beckwith. 1982. Mechanism of incorporation of cell envelope proteins in Escherichia coli. Annu. Rev. Microbiol. 36:435-465[Medline]. |
| 14. | Misra, T. K. 1992. Bacterial resistance to inorganic mercury salts and organomercurials. Plasmid 27:4-16[Medline]. |
| 15. |
Nakamura, K., and H. Nakamura.
1988.
Simplified X-ray film method for detection of bacterial volatilization of mercury chloride by Escherichia coli.
Appl. Environ. Microbiol.
54:2871-2873 |
| 16. | Nakane, A., H. Takamatsu, A. Oguro, Y. Sadaie, K. Nakamura, and K. Yamane. 1995. Acquisition of azide-resistance by elevated SecA ATPase activity confers azide-resistance upon cell growth and protein translocation in Bacillus subtilis. Microbiology 141:113-121[Abstract]. |
| 17. |
Nucifora, G.,
L. Chu,
S. Silver, and T. K. Misra.
1989.
Mercury operon regulation by the merR gene of the organomercurial resistance system of plasmid pDU1358.
J. Bacteriol.
171:4241-4247 |
| 18. |
Oliver, D. B.,
R. J. Cabelli,
K. M. Dolan, and G. P. Jarosik.
1990.
Azide-resistant mutants of Escherichia coli alter the SecA protein, an azide-sensitive component of the protein export machinery.
Proc. Natl. Acad. Sci. USA
87:8227-8231 |
| 19. | Osborn, A. M., K. D. Bruce, P. Strike, and D. A. Ritchie. 1997. Distribution, diversity and evolution of the bacterial mercury resistance (mer) operon. FEMS Microbiol. Rev. 19:239-262[Medline]. |
| 20. | Pan-Hou, H., M. Nishimoto, and N. Imura. 1981. Possible role of membrane proteins in mercury resistance of Enterobacter aerogenes. Arch. Microbiol. 130:93-95[Medline]. |
| 21. | Reniero, D., E. Galli, and P. Barbieri. 1995. Cloning and comparison of mercury- and organomercurial-resistance determinants from Pseudomonas stutzeri plasmid. Gene 166:77-82[Medline]. |
| 22. | Sambrook, J., E. F. Fritsch, and T. Maniatis. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 23. |
Sancer, A.,
A. M. Hack, and W. D. Rupp.
1979.
Simple method for identification of plasmid-coded proteins.
J. Bacteriol.
137:692-693 |
| 24. |
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467 |
| 25. | Selzer, G., T. Som, T. Itoh, and J. Tomizawa. 1983. The origin of replication of plasmid p15A and comparative studies on the nucleotide sequences around the origin of related plasmids. Cell 32:119-129[Medline]. |
| 26. | Silver, S., and L. T. Phung. 1996. Bacterial heavy metal resistance. Annu. Rev. Microbiol. 50:753-789[Medline]. |
| 27. | Summers, A. O. 1986. Organisation, expression and evolution of genes for mercury resistance. Annu. Rev. Microbiol. 40:607-634[Medline]. |
| 28. |
Tezuka, T., and K. Tonomura.
1976.
Purification and properties of an enzyme catalyzing the splitting of carbon-mercury linkages from mercury-resistant Pseudomonas K-62 strain.
J. Biochem.
80:79-87 |
| 29. |
Tezuka, T., and K. Tonomura.
1978.
Purification and properties of a second enzyme catalyzing the splitting of carbon-mercury linkages from mercury-resistant Pseudomonas K-62.
J. Bacteriol.
135:138-143 |
| 30. | Tonomura, K., K. Maeda, F. Futai, T. Nakagami, and M. Yamada. 1968. Stimulative vaporization of phenylmercuric acetate by mercury-resistant bacteria. Nature 217:644-646. |
| 31. | Uno, Y., M. Kiyono, T. Tezuka, and H. Pan-Hou. 1997. Phenylmercury transport mediated by merT-merP genes of Pseudomonas K-62 plasmid pMR26. Biol. Pharm. Bull. 20:107-109[Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Appl. Environ. Microbiol. | Infect. Immun. | Eukaryot. Cell |
|---|---|---|
| Mol. Cell. Biol. | J. Virol. | Microbiol. Mol. Biol. Rev. |
| ALL ASM JOURNALS |