Previous Article | Next Article ![]()
Journal of Bacteriology, February 1999, p. 731-739, Vol. 181, No. 3
Department of Molecular Microbiology and
Immunology, Oregon Health Sciences University, L220, Portland, Oregon
97201-3098,1 and
Howard Hughes Medical
Institute2 and
Department of
Biochemistry and Biophysics,3 School of
Medicine, University of California San Francisco, San Francisco,
California 94143-0448
Received 7 October 1998/Accepted 16 November 1998
The pilA gene of Neisseria gonorrhoeae was
initially identified in a screen for transcriptional regulators of
pilE, the expression locus for pilin, the major structural
component of gonococcal pili. The predicted protein sequence for PilA
has significant homology to two GTPases of the mammalian signal
recognition particle (SRP), SRP54 and SR Neisseria gonorrhoeae is
a major sexually transmitted pathogen that infects only humans. This
gram-negative diplococcus normally infects cells of the urogenital
tract to cause urethritis and cervicitis. Pili are the primary
virulence factor for the gonococcus, a fimbrial adhesin that is
absolutely required for infection in human volunteers (9,
49). Pilin is the major protein component of pili and is
expressed from the pilE gene in N. gonorrhoeae MS11A (29). Pilin undergoes both phase and antigenic
variation, which are likely important for evasion of the host immune
system (45). In an effort to identify transcriptional
regulators of pilE in N. gonorrhoeae, Taha et al.
(54) isolated the pilA and pilB genes.
PilA and PilB were proposed to be members of the two-component family
of prokaryotic proteins which transduce environmental signals to
cytoplasmic regulators via phosphorylation (33). The
amino-terminal portion of PilA was predicted to contain a DNA-binding
motif, and it has been demonstrated that PilA binds DNA in a
sequence-specific manner (3, 51).
The carboxy-terminal part of PilA was shown to have significant
homology to the G (GTP-binding) domains of the 54-kDa subunit of the
eukaryotic signal recognition particle (SRP54) and of the SRP docking
protein, SR The eukaryotic SRP is a ribonucleoprotein (RNP) complex of a 7S RNA and
six different polypeptides of 9, 14, 19, 54, 68, and 72 kDa and is
required for the targeting and insertion of the signal sequence of
exported proteins into the endoplasmic reticulum membrane (reviewed in
references 38 and 60). The SRP54
protein is associated with the 7S RNA in the complex and binds to the hydrophobic signal sequence of the nascent protein as it emerges from
the ribosome. The complex is then targeted to the endoplasmic reticulum
membrane, where it is bound by the docking protein. The SRP is next
released from the nascent protein-ribosome-translocon complex in a
GTP-dependent manner, and translation resumes concomitantly with translocation.
There is ample evidence for the existence and function of a bacterial
SRP. The bacterial SRP54 and SR Ffh and FtsY are both GTPases, and GTPase activity is required for the
function of each in protein targeting (21, 36, 37, 42).
Depletion or overexpression of any of the three components (Ffh, 4.5S
RNA, or FtsY) leads to the accumulation of a number of preproteins
(21, 24, 34, 35, 40, 47). Depletion of the 4.5S RNA or Ffh
can also result in the induction of a heat shock response (7,
35). These observations suggest that the relative levels of each
component of the SRP are critical for proper function of the apparatus.
The Ffh and SRP54 proteins have three domains: an M domain, which
interacts with the signal peptide of nascent proteins as well as to the
7S RNA (4.5S in E. coli); a G domain, which has the GTPase
activity required for the interaction of the complex with the docking
protein and its subsequent release; and an N domain of highly
conserved, yet unknown function (60). FtsY and SR Using a screening approach that takes advantage of the fact that the
relative levels of each of the components of the bacterial SRP system
are critical for function and survival of the organism (17,
24), Ulbrandt et al. (56) identified a number of
proteins that utilize the SRP for localization. Eight of those
identified were shown to encode polytopic cytoplasmic membrane
proteins. Consistent with this, de Gier et al. (12) also
demonstrated that the depletion of either Ffh or 4.5S RNA reduces the
efficiency of insertion of the cytoplasmic membrane protein leader
peptidase (Lep) and another group, MacFarlane and Müller
(26) demonstrated that the depletion of Ffh or 4.5S RNA
prevents the functional membrane insertion of lactose permease (LacY).
Thus, it is becoming clear that the bacterial SRP is important for the
proper localization of inner membrane proteins.
The strong similarities between PilA and the bacterial FtsY proteins
led us to reexamine the function of PilA as a transcriptional regulator
and consider the possibility that PilA may play a role in protein
maturation. In this report, we show that PilA does not regulate
transcription of a pilE-lacZ fusion in E. coli,
regardless of the conditions used. We present evidence to suggest that
PilA plays a role in protein maturation. We show that overproduction of
PilA in E. coli causes the accumulation of a presecretory
protein and that this accumulation appears to be independent of SecY. We also demonstrate that pilA can complement an
ftsY conditional mutation in E. coli and restore
normal growth to this strain under nonpermissive conditions and that a
PilA mutant defective in GTPase activity can no longer perform this
function. Finally, we show that PilA can partially replace FtsY in an
in vitro translocation assay. We conclude from these data that PilA is
the gonococcal FtsY.
DNA manipulations.
E. coli recombinant DNA
manipulations were performed as previously described (28).
Cloning vectors used were pACYC184 (11), pWSK129
(61), pTacTerm (32), and the pBluescript series
(Stratagene, La Jolla, Calif.). Restriction enzymes (New England
Biolabs, Beverly, Mass.) and T4 DNA ligase (Boehringer Mannheim,
Indianapolis, Ind.) were used according to the manufacturers'
recommendations. PCR was done using a Perkin-Elmer 9600 thermocycler
(PE Applied Biosystems, Foster City, Calif.) and Taq DNA
polymerase (Boehringer). DNA sequence determination was done by the
Core Facility of the Department of Molecular Microbiology and
Immunology at the Oregon Health Sciences University using an ABI 377 automated fluorescence DNA sequencer (PE Applied Biosystems).
Growth and construction of bacterial strains.
The E. coli strains used were JM109, CJ236 (18), CA201
(3), and N4156::pAra14-FtsY (24).
E. coli were routinely grown in Luria broth supplemented as
necessary with carbenicillin (Cb) at 100 mg/liter (plasmids) or 40 mg/liter (chromosomal), kanamycin (Kn) at 60 mg/liter, chloramphenicol
(Cm) at 25 mg/liter, spectinomycin (Sp) and streptomycin sulfate (St),
each at 25 mg/liter, or erythromycin (Em) at 300 mg/liter. Minimal
medium used was that of Vogel and Bonner (58) supplemented
with 0.2% Casamino Acids.
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Neisseria gonorrhoeae PilA Is an
FtsY Homolog
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References
. Homologs of SRP54 and
SR
were subsequently identified in bacteria (Ffh and FtsY,
respectively) and appear to form an SRP-like apparatus in prokaryotes.
Of the two proteins, PilA is the most similar to FtsY (47% identical
and 67% similar at the amino acid level). Like FtsY, PilA is essential
for viability and hydrolyzes GTP. The similarities between PilA and the
bacterial FtsY led us to ask whether PilA might function as the
gonococcal FtsY. In this work, we show that overproduction of PilA in
Escherichia coli leads to an accumulation of
pre-
-lactamase, similar to previous observations with other
bacterial SRP components. Low-level expression of pilA in
an ftsY conditional mutant can complement the
ftsY mutation and restore normal growth to this strain
under nonpermissive conditions. In addition, purified PilA can replace
FtsY in an in vitro translocation assay using purified E. coli SRP components. A PilA mutant that is severely affected in
its GTPase activity cannot replace FtsY in vivo or in vitro. However,
overexpression of the GTPase mutant leads to the accumulation of
pre-
-lactamase, suggesting that the mutant protein may interact with
the SRP apparatus to affect protein maturation. Taken together, these
results show that the gonococcal PilA is an FtsY homolog and that the
GTPase activity is necessary for its function.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References
(50). The homology between PilA and these
proteins is most striking in the G domains, and purified PilA has
significant GTPase activity (4). This activity has an
absolute requirement for MgCl2 and a strict specificity for GTP.
homologs were initially identified
by sequence homology and are called Ffh (or P48) and FtsY, respectively
(5, 41). The bacterial SRP appears to be much simpler than
the eukaryotic counterpart, consisting of Ffh, FtsY, and a 4.5S RNA
(encoded by the ffs gene). The ffh, ftsY, and ffs genes are essential in
Escherichia coli (10, 15, 34). Ffh interacts with
4.5S RNA (24, 30, 35, 40) and also with the hydrophobic
signal sequences of presecretory proteins (6, 25). FtsY is
the membrane-associated docking protein of the apparatus and has been
shown to interact with the Ffh-4.5S RNA complex (30, 41).
also
have three domains: the G domain, which has the GTPase activity and is
homologous to the G domain of SRP54 and Ffh; an N domain of unknown
function that is homologous to the N domain of SRP54 and Ffh; and a
unique amino-terminal domain (60). The amino-terminal domain
of FtsY is postulated to be important for membrane localization of the
protein (37, 62).
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References
Plasmid constructions. pNG4-26 contains the pilA and pilB genes under control of their native promoters and was constructed by ligating a 4.2-kb ClaI-SmaI fragment from pNG1711 (29) into ClaI-EcoRV-digested pACYC184. pTPA129 is a low-copy-number plasmid with the PolA-independent pSC101 origin of replication (11) and was constructed by inserting the EcoRI-HindIII fragment from pTPA5 containing Ptac-pilA-rrnBt into EcoRI-HindIII-digested pWSK129 (61).
In order to replace the wild-type copy of pilA in N. gonorrhoeae with the mutated pilA genes, derivatives of pNG1711 (29) were constructed. pNG1711 contains a 9.9-kb BclI fragment from N. gonorrhoeae MS11A in the BamHI site of pBR322 and contains the pilE1, opaE, pilA, and pilB genes, in that order. The pilA and pilB genes are divergently transcribed, and their 5' ends overlap such that the pilA promoter lies within the pilB open reading frame, and the putative pilB promoter overlaps the pilA start codon (54). A 2.2-kb fragment containing the opaE and pilE1 genes, which are located 3' of pilA on this plasmid, were replaced with a 1.2-kb Emr cassette (55) to facilitate the selection of transformants, to create pNG1711Erm. This leaves 2.5 kb of homology 3' to pilA on the gonococcal chromosome and 5.2 kb of flanking homology in the 5' direction. To introduce pilA in multicopy into N. gonorrhoeae, a 4.4-kb HpaI-SmaI (pilA-Emr) fragment from pNG1711Erm was ligated into the SmaI site of the shuttle plasmid pMGC18.1 to create pGC400.Site-directed mutagenesis of pilA.
Site-directed
mutagenesis was performed by the Kunkel method (20) using
the Mutagene kit (Bio-Rad Laboratories, Richmond, Calif.). Briefly, an
804-bp NotI-SalI fragment from pTPA5
(3) containing the 3' end of the pilA gene was
cloned into pBluescript II SK(
) to generate the mutagenesis template.
Oligonucleotides corresponding to the plus strand introducing the
nucleotide changes (indicated in bold) were used to prime synthesis of
the second strand (G308A, 5' CCGCCGCCCGCCTGC 3';
K370A, 5'
GCTTATCGTTACAGCGCTCGACGGC 3').
DNA from transformants was isolated and screened for the presence
of the mutation by restriction analysis. The G
C change to introduce
the G308A mutation destroys the recognition site for EagI.
Two additional nucleotides were changed in addition to the T
G change
to introduce the K370A mutation in order to create a recognition site
for HaeII. The DNA sequence of the entire 804-bp insert was
determined to rule out the possibility of second site mutations
introduced by the mutagenesis procedure.
NotI-SalI fragments containing the mutations were
subcloned back into NotI-SalI-digested pTPA5
to create pTPA308 or pTPA370. To facilitate transfer of these mutations
to the N. gonorrhoeae genome, the derivatives pNG1711ErmG308A and pNG1711ErmK370A were constructed as described above.
PCR screen of N. gonorrhoeae transformants. Emr transformants were passed to GCB (Em) plates, and the remainder of the colony was placed into 20 µl of 0.05 N NaOH-0.25% sodium dodecyl sulfate (SDS) and heated to 50°C for 10 min. This was diluted 10-fold with distilled H2O, and 1 µl was used as a template for PCR. Oligonucleotide primers homologous to the 5' and 3' ends of pilA were used to generate a 1,349-bp product. The product was ethanol precipitated, and a portion of it was digested with EagI or HaeII as necessary. Digested DNAs were separated by electrophoresis on 1.8% agarose gels in Tris-borate-EDTA buffer (28).
Protein preparation and analysis.
Wild-type and mutant PilA
proteins were purified as described previously (4). Protein
concentrations were determined by the bicinchoninic acid method
(Pierce, Rockford, Ill.) or by the Bradford method (Bio-Rad), depending
on the presence of reducing agents and detergents in the samples.
Proteins were separated by SDS-polyacrylamide gel electrophoresis
(SDS-PAGE) (22) and stained with Coomassie blue or
transferred to nitrocellulose for immunoblots. Western blot analysis
was done in phosphate-buffered saline with nonfat dry milk at 10%
(wt/vol) for blocking and 2% for antibody incubations. Generation of
antibodies to PilA has been described previously (3).
Antibodies to
-lactamase were purchased from 5 Prime
3 Prime, Inc.
(Boulder, Colo.). Antibodies to SecY were provided by William Wickner.
Secondary antibodies were goat anti-rabbit antibody conjugated to
alkaline phosphatase or horseradish peroxidase and used according to
the manufacturer's instructions (Pierce).
In vitro protein translocation assays. Coupled translation-translocation assays were conducted as described previously (37). Where indicated, reaction mixtures contained two equivalents of salt-washed canine pancreatic microsomal membranes (KRMs) or trypsin-treated KRMs (TKRMs); 50 nM canine SRP or E. coli Ffh-4.5S RNP; and 150 to 500 nM FtsY, PilA, or PilA G308A. At the end of the reaction, samples were trichloroacetic acid precipitated and analyzed by SDS-PAGE on 10 to 15% polyacrylamide gradient gels, followed by PhosphorImager analysis.
Enzyme assays.
GTPase assays were done as described
previously (4). [
-32P]GTP (6,000 Ci/mmol)
was supplied by New England Nuclear.
-Galactosidase assays were done
as described previously (16).
| |
RESULTS |
|---|
|
|
|---|
PilA does not regulate a pilE-lacZ transcriptional
fusion.
PilA was initially isolated as part of a putative
two-component regulatory system based on its ability to control
expression of a pilE-CAT (chloramphenicol acetyltransferase)
fusion in E. coli (54). In an attempt to confirm
this result, a pilE-lacZ transcriptional fusion was
constructed. pNGP3-1 contains the pilE promoter and
associated upstream regulatory regions on a 301-bp fragment inserted
upstream of the promoterless lacZ gene (3). This
fragment extends from
241 to +60 with respect to the pilE transcriptional start point (29) and contains the same
pilE 5' sequences as the pilE-CAT fusion used by
Taha et al. (54). The pilE-lacZ fusion was
transferred to the bacteriophage
RS45 to create
NGP3-145, which
was then used to lysogenize E. coli CA201, placing the
pilE-lacZ fusion in single copy on the bacterial chromosome
(48). CA201
NGP3-145 lysogens were transformed with the
plasmid pACYC184 or with pNG4-26 (pilA+
pilB+).
-Galactosidase assays of these strains were
done, and the repression ratios (pilA
pilB+/pilA+ pilB+) were 0.92 ± 0.07 (mid-log phase) and 0.89 ± 0.26 (stationary phase) (values are
averages of three or more independent determinations ± standard
errors). Taha et al. (54) showed that pilA and
pilB together resulted in approximately fivefold repression
of a pilE-CAT fusion (repression ratio of 5.0). In contrast,
we observed essentially no repression of our pilE-lacZ
fusion when cultures were assayed at either the mid-logarithmic or
stationary phase of growth.
NGP3-145 was used to lysogenize the
PilA expression strain, CA201/pMS421/pTPA5 (3). pTPA5
contains pilA under control of a tac promoter,
which is controlled by the Lac repressor expressed by the plasmid
pMS421. Lysogens containing pTPA5 or the vector control, pTacTerm, were grown in minimal medium to mid-log phase and induced with 500 µM IPTG
(isopropyl-
-D-thiogalactopyranoside) for 2 h.
-Galactosidase assays were done, and the activation ratio was 0.78 ± 0.05 (with
NGP3-145) (values are averages of three or more
independent determinations ± standard errors). Again, no
activation of pilE-lacZ expression was observed.
To determine if the small amount of repression observed was
significant, a deletion derivative of
NGP3-145 was constructed.
NGP1-445 contains a pilE-lacZ fusion from which 175 bp of
the 5' end of the pilE promoter fragment have been deleted.
While PilA has been shown to bind to the pilE promoter
fragment from
NGP3-145 in a gel retardation assay, the deletion
derivative on
NGP1-445 was not bound by PilA in this same assay
system (3).
-Galactosidase activities of
NGP1-445
lysogens in the presence and absence of pilA were nearly
identical, resulting in an activation ratio of 0.88 ± 0.13. Taken
together, our results show no apparent regulation of a
pilE-lacZ transcriptional fusion by pilA in the presence or absence of pilB in E. coli.
To address the effects of PilA on pilE expression in
N. gonorrhoeae, we made use of a pilE-lacZ
transcriptional fusion described by Boyle-Vavra and Seifert
(8). This strain (MS11CmLac2) is a derivative of
MS11A that contains a pilE-lacZ transcriptional fusion
at the pilE2 expression locus, leaving the pilE1
expression locus intact. This strain is thus still pilated and
therefore transformable. Since pilA is apparently essential
for the gonococcus (54), it is not possible to compare
expression of pilE in pilA+ and
pilA strains. To circumvent this, we introduced a multicopy plasmid expressing pilA (pGC400) into the
pilE-lacZ fusion strain and measured
-galactosidase
activity. Western blot analysis of the pGC400-containing strain with
anti-PilA sera showed it to have at least fivefold more PilA in the
cell than the wild-type strain (data not shown). pilE-lacZ
expression in a strain containing excess PilA was not significantly
different from that of a strain containing the vector only (pMGC18.1)
(31). Specifically, expression levels in
-galactosidase
units (nanomoles of ONPG hydrolyzed per minute per milligram of
protein) were 24,062 ± 3,014 for pMGC18.1 (pilA) and
26,996 ± 2,603 pGC400 (pilA+) (averages of
three or more independent determinations ± standard errors). This
suggests again, that PilA is not affecting pilE expression
in the gonococcus.
Effect of PilA overproduction on protein maturation.
Analysis
of the predicted PilA protein sequence reveals that it has significant
homology to the
subunit of the mammalian SRP docking protein
(SR
) and its bacterial homolog, FtsY (54). The processing
of some presecretory proteins has been shown to be inhibited upon
overexpression of FtsY (21, 24, 47). To examine the effect
of PilA overproduction on protein processing, E. coli
strains containing pilA controlled by the tac
promoter were grown and induced with various amounts of IPTG.
Immunoblot analysis with antisera raised against purified PilA
(3) showed that significant amounts of PilA are produced
even in the absence of IPTG, indicating that repression of
pilA is not complete in this system (Fig.
1). Increasing amounts of IPTG resulted
in increasing amounts of PilA produced. The negative control, E. coli containing the expression vector pTacTerm, did not react with
the PilA antisera. Immunoblot analysis with antibodies to
-lactamase
(encoded on pTacTerm) showed that increasing amounts of PilA result in
the accumulation of increasing amounts of pre-
-lactamase (Fig. 1). In contrast, no pre-
-lactamase was observed in samples containing the vector grown with or without IPTG induction. This suggests that
excess PilA is somehow affecting the processing of
-lactamase into
its mature form.
|
-lactamase in the presence of PilA
could be due to a general effect on protein translocation, we examined
these extracts for the levels of SecY, one of the components of the
SecYEG translocon that is utilized by both the general secretory
pathway (GSP) and SRP secretion pathways in bacteria (57).
Figure 1 shows no difference in the levels of SecY in our experiments.
This indicates that the accumulation of pre-
-lactamase is not due to
a difference in the amount of SecY in the cell.
pilA complements an E. coli conditional ftsY mutant. As ftsY is essential for cell viability in E. coli (15), complementation analysis was performed on an ftsY conditional lethal mutant. N4156::pAra14-FtsY contains the ftsY gene under control of the tight araB promoter in place of the native ftsY on the chromosome (24). This strain requires arabinose for growth and does not grow in its absence. This strain is also polA, therefore, a PolA-independent pilA plasmid (pTPA129) was constructed (see Materials and Methods). N4156::pAra14-FtsY cells were transformed with pTPA129 or the vector control, pWSK129. Transformants were selected on Luria broth Cb40Kn60ara plates and then struck on minimal medium containing glucose alone or with 0.2% arabinose (Fig. 2). Strains containing pTPA129 and pWSK129 grew well in the presence of arabinose. However, only the pTPA129 (pilA+) transformant was able to grow in the absence of arabinose. Growth curves of these strains in liquid media of the same composition showed similar results (data not shown). These results demonstrate that pilA can complement ftsY in E. coli.
|
-lactamase (24, 47) we wished to determine if PilA
could also complement this defect. As indicated above, N4156::pAra14-FtsY does not grow in the absence of arabinose. However, when cells grown in arabinose are washed to remove the arabinose and placed into arabinose-free liquid medium, they grow, albeit significantly more slowly than those grown in the presence of
arabinose, and they eventually die off (24, 47). This
suggests that the cells are utilizing the FtsY that remains in the cell from before the shift to nonpermissive conditions, which is eventually used up. N4156::pAra14-FtsY cells containing pWSK129 or
pTPA129 were shifted to growth with or without arabinose for 6 h,
and total proteins were subjected to SDS-PAGE. Figure
3 shows immunoblots of these gels
obtained by using antisera to PilA and
-lactamase. Immunoblot
analysis with PilA antisera showed similar amounts of PilA produced in
the presence or absence of arabinose, indicating that FtsY depletion
does not affect PilA expression. Immunoblot analysis with
-lactamase
antisera shows an accumulation of pre-
-lactamase in the
pWSK129-containing strain under nonpermissive conditions (no
arabinose). In contrast, there is no accumulation of pre-
-lactamase in pTPA129-containing cells. Thus, PilA is also able to complement the
protein maturation defect of FtsY-depleted cells.
|
PilA functions in an in vitro protein translocation assay.
We
next determined whether PilA could catalyze protein translocation in
vitro. It has been demonstrated recently that the E. coli
Ffh-4.5S RNP and FtsY can replace mammalian SRP and the
subunit of
the SRP receptor, respectively, in a heterologous protein translocation
system (37). In this system, mammalian microsomal membranes
are depleted of endogenous SR
by mild protease treatment, rendering
them inactive in targeting and translocation. Activity can be restored,
however, by addition of both E. coli SRP and SRP receptor
(FtsY). We therefore tested whether PilA could substitute for FtsY in
this system, monitoring signal sequence cleavage of a model secretory
protein, preprolactin (pPL) (Fig. 4).
Significant translocation activity was observed in the presence of
trypsinized membranes (TKRMs), the Ffh-4.5S RNP and FtsY (~75% processing of pPL at 150 nM FtsY) (Fig. 4, lane 5) as reported previously (37). When PilA was added instead of FtsY, modest but reproducible translocation activity was observed (~20%
processing at 150 nM PilA) (Fig. 4, lane 6). This level of activity
represents a maximum, as no increase in processing was observed when
more PilA was added (up to 500 nM; data not shown). This reduced level of activity is likely to result from the fact that the N-terminal domain of PilA is smaller and less negatively charged compared to FtsY,
features which have been shown to be important in this assay. These
results complement the in vivo observations above and support the
conclusion that PilA is indeed an FtsY homolog.
|
Construction of a PilA GTPase mutant.
PilA contains the four
consensus GTPase elements of the GTPase superfamily (1), all
of which are absolutely conserved. We have previously shown that, like
E. coli FtsY (21), PilA has a GTPase activity
that is GTP specific and requires Mg++ (4). The
consensus sequence for box 3 is DXXG (14) and is DTAG in
PilA. The glycine residue of this motif is thought to interact with the
three glycine residues of box 1 to form the P loop which interacts with
the phosphate group of GTP (43). Amino acid residue Gly308
of PilA (DTAG) was changed to Ala by site-directed
mutagenesis to create pTPA308. PilA G308A was purified from
CA201/pMS421/pTPA308 cells as described for the wild-type PilA
(4) and analyzed for GTPase activity. The kinetic parameters
for the PilA mutant were determined by assays in which the substrate
(GTP) concentration was varied. The results showed that the
Km of this mutant for GTP was 11.5 ± 0.8 µM, similar to that of the wild type (9.6 ± 0.4 µM), but the
Vmax was 186 ± 53 pmol min
1
mg
1, 10-fold less than that of the wild-type enzyme
(1,900 ± 276). Thus, PilA G308A is severely affected in its
ability to hydrolyze GTP.
Effects of the PilA G308A mutation on protein maturation.
CA201/pMS421/pTPA308 cells were induced with various amounts of IPTG,
and total proteins were subjected to SDS-PAGE and Western blot analysis
using antibodies to
-lactamase. An accumulation of pre-
-lactamase
was observed with increasing levels of PilA G308A (data not shown), as
was observed for the wild-type PilA (Fig. 1). This suggests that, like
wild-type PilA or FtsY, the PilA G308A mutant may be able to interact
with the SRP and disrupt protein maturation (21, 24, 47).
-lactamase
antisera showed an accumulation of pre-
-lactamase under
nonpermissive conditions, although not as great as that observed for
the vector control under nonpermissive conditions. This indicates that
the mutant may be slightly able to alleviate the protein maturation
defect, although not nearly as well as the wild-type PilA.
We next asked whether the PilA G308A mutant could replace the wild-type
PilA in our in vitro protein translocation assay. As seen in Fig.
4 (lane 7), no stimulation of
translocation activity in the presence of PilA G308A was observed.
Indeed, only background levels of processing were observed, even with
500 nM PilA G308A (data not shown). These results demonstrate that this
mutant protein is completely inactive in this assay. Taken together,
they show that the GTPase activity of PilA is required for its function in vivo as well as in vitro.
The GTPase activity of PilA is also important in the gonococcus. We next attempted to replace the wild-type copy of pilA in N. gonorrhoeae with mutated pilA genes. Plasmid DNA from pNG1711Erm (encodes wild-type PilA), pNG1711ErmG308A (PilA G308A), or pNG1711ErmK370A (PilA K370A, a mutant only slightly affected for GTPase activity [2a]) was linearized and used to transform N. gonorrhoeae strain MS11A as previously described (46). A 1,349-bp fragment containing the pilA gene was PCR amplified from Emr transformants. These products were screened for the presence of the mutation by restriction analysis (see Materials and Methods). In the 5.2-kb region of sequence homology where a crossover event must occur to yield Emr transformants with pNG1711ErmG308A, there is a 0.4-kb region where a crossover event would result in the transformant having a wild-type pilA gene. A crossover event in the remaining 4.8 kb would result in the introduction of the G308A mutation. If all sequences in this region are equal for homologous recombination, one would expect 7.8% of Emr transformants to have the wild-type genotype and 92.2% to have the mutant genotype. However, of 74 Emr transformants screened (from three independent transformations), all contained the wild-type pilA gene. In contrast, in the 5.2-kb region of sequence homology where a crossover event must occur to yield Emr transformants with pNG1711ErmK370A, there is a 0.2-kb region where a crossover event would result in the transformant having a wild-type pilA gene. A crossover event in the remaining 5.0 kb would result in the introduction of the K370A mutation. This predicts a frequency of 3.8% wild-type and 96.2% mutant transformants. Of 47 Emr transformants screened (from three independent transformations), 37 contained the wild-type pilA gene and 10 contained the K370A mutation. This corresponds to a frequency of 79% wild-type transformants and 21% mutant transformants. The fact that we were able to replace the wild-type pilA with a gene encoding the K370A mutation, albeit at a lower frequency than expected, but not the G308A mutation indicates that the GTPase activity of PilA is important in the gonococcus.
| |
DISCUSSION |
|---|
|
|
|---|
We recently compared the pilA sequence with sequences in the nearly completed genome sequence of N. gonorrhoeae FA1090 (13) using the BLAST program (2). This search yielded only two genes with significant homology. Comparison of these sequences with those of the E. coli ftsY and ffh genes suggests that they are the gonococcal SRP homologs. The homology between ffh and pilA is located exclusively in the G domains, while the homology between ftsY and pilA occurs throughout the entire protein, suggesting that pilA and ftsY are true homologs. The striking homology between PilA and the G domains of the SRP proteins initially led us to examine PilA for GTPase activity (4). These experiments showed that, like FtsY (21), PilA is GTPase.
To examine the relationship between the GTPase and purported regulatory activities of PilA, we attempted to confirm the transcriptional regulation experiments using a pilE-lacZ fusion. Regardless of the conditions used, we were unable to demonstrate any significant effect of PilA on pilE-lacZ expression. The pilE-lacZ fusion used in this study contained a fragment with the same endpoints of the pilE upstream region used by Taha et al. (54). Thus, the only difference between our systems was the reporter system used. The reason for this discrepancy in results is not clear, although it is worth noting that Taha et al. (52) have also reported PilA control of pilC in N. meningitidis with a lacZ reporter system, which implies that both the lacZ and CAT systems give similar results in their hands.
Our inability to demonstrate transcriptional regulation by PilA and the
striking similarities between PilA and FtsY led us to hypothesize that
PilA might actually be the gonococcal FtsY homolog. We first examined
the effect of overexpression of PilA on maturation of the secreted
protein,
-lactamase. Maturation of this protein has been shown to be
inhibited upon overexpression of components of the bacterial SRP
(21, 24, 47, 56). E. coli strains containing
pilA under the control of the tac promoter were
grown and induced with various amounts of IPTG. Immunoblot analysis of
total proteins from these strains showed an accumulation of
pre-
-lactamase with increasing concentrations of PilA (Fig. 1).
Immunoblot analysis of duplicate samples showed no difference in SecY
levels in these samples. SecY, a major component of the membrane-bound
translocation apparatus, is thought to be utilized for both the GSP and
SRP secretion systems (57). Thus, the accumulation of
pre-
-lactamase in these samples is likely due to a defect prior to
the translocation step. This is consistent with the interpretation that
excess PilA perturbs the SRP system by titrating out other components
of the apparatus. Others have shown that the relative levels of each of
the components of the E. coli SRP are critical for optimal
function (17, 24, 34, 47). Using a slightly different
system, Taha et al. (53) looked at the effect of PilA on
-lactamase processing in E. coli and also observed an
accumulation of the preprotein in the presence of excess PilA. They
concluded that the effect was nonspecific and likely a secondary effect of transcriptional regulation of cell growth rate by PilA.
Studies of the role of the bacterial SRP indicate that it is important
for the proper localization of inner membrane proteins (12, 26,
56). Interestingly, one of the proteins believed to be dependent
upon the SRP is leader peptidase (Lep), which cleaves the hydrophobic
signal sequences from secreted proteins following their translocation
across the inner membrane. Thus, a perturbation of the bacterial SRP
caused by depletion or overexpression of one of its components may
affect the function of Lep, which may in turn affect the proper
processing of secreted proteins. This may explain the accumulation of
pre-
-lactamase observed by us and others (24, 47) upon
overexpression of FtsY in E. coli.
We next demonstrated that PilA could substitute for FtsY in E. coli by complementation of a conditional ftsY mutant (N4156::pAra14-FtsY) (24). Figure 2 shows that strains expressing pilA can grow under conditions in which ftsY is not expressed (media lacking arabinose), indicating that PilA can replace FtsY in E. coli. Further evidence to support this is seen in Fig. 4. Using an in vitro translocation assay with purified E. coli Ffh-4.5S RNA, we observed that PilA could partially replace FtsY in this assay system. Under conditions where FtsY can effect processing of 75% of the substrate, PilA was able to direct the processing of nearly 20% of the same substrate. While this activity is low, it is reproducible and is significantly above background levels, indicating that the translocation observed is PilA mediated. The reduced level of activity observed in this assay may be due to the fact that the N-terminal domain of PilA is smaller and less negatively charged compared to FtsY, which has been shown to be important in this assay (37).
To determine whether the GTPase activity of PilA is required for its
function, a mutation was introduced into box 3 of the conserved
GTP-binding site of PilA. This mutant (PilA G308A) is 10-fold reduced
in GTPase activity compared to the wild-type protein. In vivo, PilA
G308A cannot replace FtsY in E. coli (Fig. 2) nor can it
replace the wild-type PilA in N. gonorrhoeae. Additionally, PilA G308A cannot replace FtsY in an in vitro system (Fig. 4). However,
overexpression of this mutant results in the accumulation of
pre-
-lactamase, similar to that observed for the wild-type PilA
(data not shown). This suggests that while PilA G308A cannot function
as the docking protein for the SRP, it may be able to interact with
other components of the SRP such that they can no longer function
correctly in protein maturation. The corresponding mutation in box 3 of
the E. coli FtsY (G385A) also results in a strong dominant
lethal phenotype and affects translocation of some proteins as well
(56).
The fact that our results indicate that PilA is part of a gonococcal SRP apparatus and not a transcriptional regulator raises a number of questions. First, why was PilA identified in a screen for transcriptional regulators of pilE in E. coli? We have been unable to repeat the transcriptional regulation results using a reporter system (lacZ) different from that used in the original screen (CAT). Both reporter enzymes are cytoplasmic, so it is unlikely that enzyme activities were directly affected by the SRP apparatus, although it is possible that the uptake of chloramphenicol by the transformants may have affected their survival on plates in the original screen (54). However, this does not explain the results where CAT activity was measured in cell lysates. Thus, the answer to this question remains a mystery.
Second, why does PilA bind DNA in vitro? We showed that purified PilA
binds to pilE promoter DNA in a sequence-specific manner using a gel retardation assay (3). Taha and Giorgini
(51) obtained a similar result using crude preparations of
PilA in a similar assay. Our results indicated that the binding was
complex and required sequences at both ends of the promoter fragment. We concluded from this study that DNA looping may be involved in this
interaction, and we hypothesize that PilA does not recognize a specific
sequence per se but rather recognizes a secondary or tertiary structure
formed by a particular DNA sequence. Indeed, the DNA sequences from
100 to +1 of the pilE promoter is 73% AT rich, which is
consistent with bent DNA (3). We have screened a promoter
library from N. gonorrhoeae MS11A for binding by PilA and
identified 12 DNA fragments that compete with pilE DNA for PilA binding. These fragments are also directly bound by PilA in a gel
mobility shift assay (2a). An alignment of these sequences with each other and the pilE promoter reveals no obvious
consensus binding sequence (data not shown). It is possible that these
fragments fold into a similar structure that results in an
electrophoretic mobility shift in the presence of PilA.
FtsY physically interacts with the Ffh-4.5S RNA complex (30, 35) and may therefore come in contact with RNA, either the 4.5S RNA or the mRNA of the translation complex. DNA and RNA are structurally different from each other, although there are proteins which bind both RNA and DNA (23, 39). It is possible that secondary or tertiary structure is important for this binding. It is conceivable, although unlikely, that PilA actually binds RNA in vivo, and the in vitro DNA binding is an artifact of this activity.
A more attractive possibility is that PilA/FtsY somehow interacts with the chromosome. ftsY was initially identified as part of an operon containing genes which are temperature sensitive for filamentation (15), although no such mutations have ever been mapped to ftsY. FtsY-depleted cells are filamentous and are apparently defective in completion of septation during cell division (24). The same phenotype has been observed for cells depleted for Ffh or cells expressing a mutated in ffh gene (34, 42). Thus, the bacterial SRP may play a role in cell division and septation which may involve interactions between the components of the SRP and the chromosome.
What subset of gonococcal proteins might depend on PilA and the gonococcal SRP for maturation? Taha et al. (53) examined N. gonorrhoeae heterodiploids producing wild-type and truncated forms of PilA for the accumulation of Opa, a gonococcal outer membrane protein that is involved in epithelial cell invasion by gonococci (27, 59). They reported that these heterodiploids did not affect Opa signal sequence processing, although they did observe an induction of heat shock proteins in these strains. Thus, Opa likely does not utilize the gonococcal SRP. It will be interesting to determine which proteins of N. gonorrhoeae depend on the SRP system for proper localization.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by National Institutes of Health grant RO1 AI34560 to M.S.
We thank W. Wickner for providing antibodies to SecY and J. Luirink for providing the conditional FtsY strain. The sequence of the N. gonorrhoeae FA1090 genome was provided by the Gonococcal Genome Sequencing Project, courtesy of B. A. Roe, S. P. Lin, L. Song, X. Yuan, S. Clifton, and D. W. Dyer.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Molecular Microbiology and Immunology, Oregon Health Sciences University, L220, 3181 SW Sam Jackson Park Rd., Portland, OR 97201-3098. Phone: (503) 494-6840. Fax: (503) 494-6862. E-mail: arvidson{at}ohsu.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Althoff, S.,
D. Selinger, and J. A. Wise.
1994.
Molecular evolution of SRP cycle components: functional implications.
Nucleic Acids Res.
22:1933-1947 |
| 2. | Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403-410[Medline]. |
| 2a. | Arvidson, C. G. Unpublished data. |
| 3. |
Arvidson, C. Grove, and M. So.
1995.
Interaction of the Neisseria gonorrhoeae PilA protein with the pilE promoter involves multiple sites on the DNA.
J. Bacteriol.
177:2497-2504 |
| 4. |
Arvidson, C. Grove, and M. So.
1995.
The Neisseria transcriptional regulator PilA has a GTPase activity.
J. Biol. Chem.
270:26045-26048 |
| 5. | Bernstein, H. D., M. A. Poritz, K. Strub, P. J. Hoben, S. Brenner, and P. Walter. 1989. Model for signal sequence recognition from amino-acid sequence of 54K subunit of signal recognition particle. Nature 340:482-486[Medline]. |
| 6. |
Bernstein, H. D.,
D. Zopf,
D. M. Freymann, and P. Walter.
1993.
Functional substitution of the signal recognition particle 54-kDa subunit by its Escherichia coli homolog.
Proc. Natl. Acad. Sci. USA
90:5229-5233 |
| 7. |
Bourgaize, D. B.,
T. A. Phillips,
R. A. VanBogelen,
P. G. Jones,
F. C. Neidhart, and M. J. Fournier.
1990.
Loss of 4.5S RNA induces the heat shock response and lambda prophage in Escherichia coli.
J. Bacteriol.
172:1151-1154 |
| 8. | Boyle-Vavra, S., and H. S. Seifert. 1993. Shuttle mutagenesis: two mini-transposons for gene mapping and for lacZ transcriptional fusions in Neisseria gonorrhoeae. Gene 129:51-57[Medline]. |
| 9. | Brinton, C. C., et al. 1978. Uses of pili in gonorrhea control: role of bacterial pili in disease, purification and properties of gonococcal pili, and progress in the development of a gonococcal pilus vaccine for gonorrhea, p. 155-178. In G. F. Brooks, E. C. Gotschlich, K. K. Holmes, W. D. Sawyer, and F. E. Young (ed.), Immunobiology of Neisseria gonorrhoeae. American Society for Microbiology, Washington, D.C. |
| 10. | Brown, S., and M. J. Fournier. 1984. The 4.5S RNA gene of Escherichia coli is essential for cell growth. J. Mol. Biol. 178:533-550[Medline]. |
| 11. |
Chang, A. C. Y., and S. N. Cohen.
1978.
Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid.
J. Bacteriol.
134:1141-1156 |
| 12. | de Gier, J.-W. L., P. Mansournia, Q. A. Valent, G. J. Phillips, J. Luirink, and G. von Heijne. 1996. Assembly of a cytoplasmic membrane protein in Escherichia coli is dependent on the signal recognition particle. FEBS Lett. 399:307-309[Medline]. |
| 13. |
Dempsey, J. F.,
W. Litaker,
A. Madhure,
T. L. Snodgrass, and J. G. Cannon.
1991.
Physical map of the chromosome of Neisseria gonorrhoeae FA1090 with locations of genetic markers, including opa and pil genes.
J. Bacteriol.
173:5476-5486 |
| 14. |
Dever, T. E.,
M. J. Glynias, and W. C. Merrick.
1987.
GTP-binding domain: three consensus sequence elements with distinct spacing.
Proc. Natl. Acad. Sci. USA
84:1814-1818 |
| 15. | Gill, D. R., and G. P. C. Salmond. 1990. The identification of the Escherichia coli ftsY gene product: an unusual protein. Mol. Microbiol. 4:575-583[Medline]. |
| 16. |
Grove, C. L., and R. P. Gunsalus.
1987.
Regulation of the aroH operon of Escherichia coli by the tryptophan repressor.
J. Bacteriol.
169:2158-2164 |
| 17. |
Jensen, C. G., and S. Pedersen.
1994.
Concentrations of 4.5S RNA and Ffh protein in Escherichia coli: the stability of Ffh protein is dependent on the concentration of 4.5S RNA.
J. Bacteriol.
176:7148-7154 |
| 18. |
Joyce, C. M., and N. D. Grindley.
1984.
Method for determining whether a gene of Escherichia coli is essential: application to the polA gene.
J. Bacteriol.
158:636-643 |
| 19. |
Kellogg, D. S.,
W. L. Peacock,
W. E. Deacron,
L. Brown, and C. I. Pirkle.
1963.
Neisseria gonorrhoeae. I. Virulence genetically linked to clonal variation.
J. Bacteriol.
85:1274-1279 |
| 20. | Kunkel, T. A., J. D. Roberts, and R. A. Zakour. 1987. Rapid and efficient site-specific mutagenesis without phenotypic selection. Methods Enzymol. 154:367-382[Medline]. |
| 21. | Kusters, R., G. Lentzen, E. Eppens, A. van Geel, C. C. van der Weijden, W. Wintermeyer, and J. Luirink. 1995. The functioning of the SRP receptor FtsY in protein-targeting in E. coli is correlated with its ability to bind and hydrolyze GTP. FEBS Lett. 372:253-258[Medline]. |
| 22. | Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685[Medline]. |
| 23. |
Liao, D.,
R. Lurz,
B. Dobrinski, and P. P. Dennis.
1996.
A NusG-like protein from Thermotoga maritima binds to DNA and RNA.
J. Bacteriol.
178:4089-4098 |
| 24. | Luirink, J., C. M. ten Hagen-Jongman, C. C. van der Weijden, B. Oudega, S. High, B. Dobberstein, and R. Kusters. 1994. An alternative protein targeting pathway in Escherichia coli: studies on the role of FtsY. EMBO J. 13:2289-2296[Medline]. |
| 25. | Luirink, J., S. High, H. Wood, A. Giner, D. Tollervey, and B. Dobberstein. 1992. Signal-sequence recognition by an Escherichia coli ribonucleoprotein complex. Nature 359:741-743[Medline]. |
| 26. | MacFarlane, J., and M. Müller. 1995. The functional integration of a polytopic membrane protein of Escherichia coli is dependent on the bacterial signal-recognition particle. Eur. J. Biochem. 233:766-771[Medline]. |
| 27. | Makino, S., J. P. M. van Putten, and T. F. Meyer. 1991. Phase variation of the opacity outer membrane protein controls invasion of Neisseria gonorrhoeae into human epithelial cells. EMBO J. 10:1307-1315[Medline]. |
| 28. | Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 29. |
Meyer, T. F.,
E. Billyard,
R. Haas,
S. Storzbach, and M. So.
1984.
Pilus sequences of Neisseria gonorrhoeae: chromosomal organization and DNA sequence.
Proc. Natl. Acad. Sci. USA
81:6110-6114 |
| 30. | Miller, J. D., H. D. Bernstein, and P. Walter. 1994. Interaction of E. coli Ffh/4.5S ribonucleoprotein and FtsY mimics that of mammalian signal recognition particle and its receptor. Nature 367:657-659[Medline]. |
| 31. |
Nassif, X.,
D. Puaoi, and M. So.
1991.
Transposition of Tn1545- 3 in the pathogenic neisseriae: a genetic tool for mutagenesis.
J. Bacteriol.
173:2147-2154 |
| 32. |
Paluh, J. L., and C. Yanofsky.
1986.
High level production and rapid purification of the E. coli trp repressor.
Nucleic Acids Res.
14:7851-7860 |
| 33. | Parkinson, J. S., and E. C. Kofoid. 1992. Communication modules in bacterial signalling proteins. Annu. Rev. Genet. 26:71-112[Medline]. |
| 34. | Phillips, G. J., and T. J. Silhavy. 1992. The E. coli ffh gene is necessary for viability and efficient protein transport. Nature 359:744-746[Medline]. |
| 35. |
Poritz, M. A.,
H. D. Bernstein,
K. Strub,
D. Zopf,
H. Wilhelm, and P. Walter.
1990.
An E. coli ribonucleoprotein containing 4.5S RNA resembles mammalian signal recognition particle.
Science
250:1111-1117 |
| 36. |
Powers, T., and P. Walter.
1995.
Reciprocal stimulation of GTP hydrolysis by two directly interacting GTPases.
Science
269:1422-1424 |
| 37. | Powers, T., and P. Walter. 1997. Co-translational protein targeting catalyzed by the Escherichia coli signal recognition particle and its receptor. EMBO J. 16:4880-4886[Medline]. |
| 38. | Rapoport, T. A., B. Jungnickel, and U. Kutat. 1996. Protein transport across the endoplasmic reticulum and bacterial inner membranes. Annu. Rev. Biochem. 65:271-303[Medline]. |
| 39. | Retallack, D. M., and D. I. Friedman. 1995. A role for a small stable RNA in modulating the activity of DNA-binding proteins. Cell 83:227-235[Medline]. |
| 40. | Ribes, V., K. Römisch, A. Giner, B. Dobberstein, and D. Tollervey. 1990. E. coli 4.5S RNA is part of a ribonucleoprotein particle that has properties related to signal recognition particle. Cell 63:591-600[Medline]. |
| 41. | Römisch, K., J. Webb, J. Herz, S. Prehn, R. Frank, M. Vingron, and B. Dobberstein. 1989. Homology of the 54K protein of signal recognition particle, docking protein, and two E. coli proteins with putative GTP-binding domains. Nature 340:478-482[Medline]. |
| 42. | Samuelsson, T., M. Olsson, P. M. Wikström, and B. R. Johansson. 1995. The GTPase activity of the Escherichia coli Ffh protein is important for normal growth. Biochim. Biophys. Acta 1267:83-91[Medline]. |
| 43. | Saraste, M., P. R. Sibbald, and A. Wittinghofer. 1990. The P-loop: a common motif in ATP- and GTP-binding proteins. Trends Biochem. Sci. 15:430-434[Medline]. |
| 44. | Segal, E., E. Billyard, M. So, S. Storzbach, and T. F. Meyer. 1985. Role of chromosomal rearrangement in N. gonorrhoeae pilus phase variation. Cell 40:293-300[Medline]. |
| 45. | Seifert, H. S. 1996. Questions about gonococcal pilus phase and antigenic variation. Mol. Microbiol. 21:433-440[Medline]. |
| 46. |
Seifert, H. S.,
R. S. Ajioka,
D. Paruchuri,
F. Heffron, and M. So.
1990.
Shuttle mutagenesis of Neisseria gonorrhoeae: pilin null mutations lower DNA transformation competence.
J. Bacteriol.
172:40-46 |
| 47. |
Seluanov, A., and E. Bibi.
1997.
FtsY, the prokaryotic signal recognition particle receptor homologue, is essential for biogenesis of membrane proteins.
J. Biol. Chem.
272:2053-2055 |
| 48. | Simons, R. W., F. Houman, and N. Kleckner. 1987. Improved single- and multicopy lac-based cloning vectors for protein and operon fusions. Gene 53:85-96[Medline]. |
| 49. |
Swanson, J.,
K. Robbins,
O. Barrera,
D. Corwin,
J. Boslego,
J. Ciak,
M. Blake, and M. Koomey.
1987.
Gonococcal pilin variants in experimental gonorrhea.
J. Exp. Med.
165:1344-1357 |
| 50. | Taha, M. K., B. Dupuy, W. Saurin, M. So, and C. Marchal. 1991. Control of pilus expression in Neisseria gonorrhoeae: an original system in the family of two-component regulators. Mol. Microbiol. 5:137-148[Medline]. |
| 51. | Taha, M. K., and D. Giorgini. 1995. Phosphorylation and functional analysis of PilA, a protein involved in the transcriptional regulation of the pilin gene in Neisseria gonorrhoeae. Mol. Microbiol. 15:667-677[Medline]. |
| 52. | Taha, M. K., D. Giorgini, and X. Nassif. 1996. The pilA regulatory gene modulates the pilus-mediated adhesion of Neisseria meningitidis by controlling the transcription of pilC1. Mol. Microbiol. 19:1073-1084[Medline]. |
| 53. |
Taha, M. K.,
M. Larribe,
B. Dupuy,
D. Giorgini, and C. Marchal.
1992.
Role of pilA, an essential regulatory gene of Neisseria gonorrhoeae in the stress response.
J. Bacteriol.
174:5978-5981 |
| 54. | Taha, M. K., M. So, H. S. Seifert, E. Billyard, and C. Marchal. 1988. Pilin expression in Neisseria gonorrhoeae is under both positive and negative control. EMBO J. 7:4367-4378[Medline]. |
| 55. |
Trieu-Cout, P.,
C. Poyart-Salmeron,
C. Carlier, and P. Courvalin.
1990.
Nucleotide sequence of the erythromycin resistance gene of the conjugative transposon Tn1545.
Nucleic Acids Res.
18:3660 |
| 56. | Ulbrandt, N. D., J. A. Newitt, and H. Bernstein. 1997. The E. coli signal recognition particle is required for the insertion of a subset of inner membrane proteins. Cell 88:187-196[Medline]. |
| 57. | Valent, Q. A., P. A. Scotti, S. High, J.-W. L. de Gier, G. von Heijne, G. Lentzen, W. Wintermeyer, B. Oudega, and J. Luirink. 1998. The Escherichia coli SRP and SecB targeting pathways converge at the translocon. EMBO J. 17:2504-2512[Medline]. |
| 58. |
Vogel, H. J., and D. M. Bonner.
1956.
Acetylornithinease of E. coli: partial purification and some properties.
J. Biol. Chem.
218:97-106 |
| 59. | Waldbeser, L. S., R. S. Ajioka, A. J. Merz, D. Puaoi, L. Lin, M. Thomas, and M. So. 1994. The opaH locus of Neisseria gonorrhoeae MS11A is involved in epithelial cell invasion. Mol. Microbiol. 13:919-928[Medline]. |
| 60. | Walter, P., and A. E. Johnson. 1994. Signal sequence recognition and protein targeting to the endoplasmic reticulum membrane. Annu. Rev. Cell. Biol. 10:87-119. |
| 61. | Wang, R. F., and S. R. Kushner. 1991. Construction of versatile low-copy-number vectors for cloning, sequencing and gene expression in Escherichia coli. Gene 100:195-199[Medline]. |
| 62. |
Zelazny, A.,
A. Seluanov,
A. Cooper, and E. Bibi.
1997.
The NG domain of the prokaryotic signal recognition particle receptor, FtsY, is fully functional when fused to an unrelated integral membrane polypeptide.
Proc. Natl. Acad. Sci. USA
94:6025-6029 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»