This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Arvidson, C. G.
Right arrow Articles by So, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Arvidson, C. G.
Right arrow Articles by So, M.

 Previous Article  |  Next Article 

Journal of Bacteriology, February 1999, p. 731-739, Vol. 181, No. 3
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.

Neisseria gonorrhoeae PilA Is an FtsY Homolog

Cindy Grove Arvidson,1,* Ted Powers,2,3 Peter Walter,2,3 and Magdalene So1

Department of Molecular Microbiology and Immunology, Oregon Health Sciences University, L220, Portland, Oregon 97201-3098,1 and Howard Hughes Medical Institute2 and Department of Biochemistry and Biophysics,3 School of Medicine, University of California San Francisco, San Francisco, California 94143-0448

Received 7 October 1998/Accepted 16 November 1998


    ABSTRACT
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

The pilA gene of Neisseria gonorrhoeae was initially identified in a screen for transcriptional regulators of pilE, the expression locus for pilin, the major structural component of gonococcal pili. The predicted protein sequence for PilA has significant homology to two GTPases of the mammalian signal recognition particle (SRP), SRP54 and SRalpha . Homologs of SRP54 and SRalpha were subsequently identified in bacteria (Ffh and FtsY, respectively) and appear to form an SRP-like apparatus in prokaryotes. Of the two proteins, PilA is the most similar to FtsY (47% identical and 67% similar at the amino acid level). Like FtsY, PilA is essential for viability and hydrolyzes GTP. The similarities between PilA and the bacterial FtsY led us to ask whether PilA might function as the gonococcal FtsY. In this work, we show that overproduction of PilA in Escherichia coli leads to an accumulation of pre-beta -lactamase, similar to previous observations with other bacterial SRP components. Low-level expression of pilA in an ftsY conditional mutant can complement the ftsY mutation and restore normal growth to this strain under nonpermissive conditions. In addition, purified PilA can replace FtsY in an in vitro translocation assay using purified E. coli SRP components. A PilA mutant that is severely affected in its GTPase activity cannot replace FtsY in vivo or in vitro. However, overexpression of the GTPase mutant leads to the accumulation of pre-beta -lactamase, suggesting that the mutant protein may interact with the SRP apparatus to affect protein maturation. Taken together, these results show that the gonococcal PilA is an FtsY homolog and that the GTPase activity is necessary for its function.


    INTRODUCTION
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

Neisseria gonorrhoeae is a major sexually transmitted pathogen that infects only humans. This gram-negative diplococcus normally infects cells of the urogenital tract to cause urethritis and cervicitis. Pili are the primary virulence factor for the gonococcus, a fimbrial adhesin that is absolutely required for infection in human volunteers (9, 49). Pilin is the major protein component of pili and is expressed from the pilE gene in N. gonorrhoeae MS11A (29). Pilin undergoes both phase and antigenic variation, which are likely important for evasion of the host immune system (45). In an effort to identify transcriptional regulators of pilE in N. gonorrhoeae, Taha et al. (54) isolated the pilA and pilB genes. PilA and PilB were proposed to be members of the two-component family of prokaryotic proteins which transduce environmental signals to cytoplasmic regulators via phosphorylation (33). The amino-terminal portion of PilA was predicted to contain a DNA-binding motif, and it has been demonstrated that PilA binds DNA in a sequence-specific manner (3, 51).

The carboxy-terminal part of PilA was shown to have significant homology to the G (GTP-binding) domains of the 54-kDa subunit of the eukaryotic signal recognition particle (SRP54) and of the SRP docking protein, SRalpha (50). The homology between PilA and these proteins is most striking in the G domains, and purified PilA has significant GTPase activity (4). This activity has an absolute requirement for MgCl2 and a strict specificity for GTP.

The eukaryotic SRP is a ribonucleoprotein (RNP) complex of a 7S RNA and six different polypeptides of 9, 14, 19, 54, 68, and 72 kDa and is required for the targeting and insertion of the signal sequence of exported proteins into the endoplasmic reticulum membrane (reviewed in references 38 and 60). The SRP54 protein is associated with the 7S RNA in the complex and binds to the hydrophobic signal sequence of the nascent protein as it emerges from the ribosome. The complex is then targeted to the endoplasmic reticulum membrane, where it is bound by the docking protein. The SRP is next released from the nascent protein-ribosome-translocon complex in a GTP-dependent manner, and translation resumes concomitantly with translocation.

There is ample evidence for the existence and function of a bacterial SRP. The bacterial SRP54 and SRalpha homologs were initially identified by sequence homology and are called Ffh (or P48) and FtsY, respectively (5, 41). The bacterial SRP appears to be much simpler than the eukaryotic counterpart, consisting of Ffh, FtsY, and a 4.5S RNA (encoded by the ffs gene). The ffh, ftsY, and ffs genes are essential in Escherichia coli (10, 15, 34). Ffh interacts with 4.5S RNA (24, 30, 35, 40) and also with the hydrophobic signal sequences of presecretory proteins (6, 25). FtsY is the membrane-associated docking protein of the apparatus and has been shown to interact with the Ffh-4.5S RNA complex (30, 41).

Ffh and FtsY are both GTPases, and GTPase activity is required for the function of each in protein targeting (21, 36, 37, 42). Depletion or overexpression of any of the three components (Ffh, 4.5S RNA, or FtsY) leads to the accumulation of a number of preproteins (21, 24, 34, 35, 40, 47). Depletion of the 4.5S RNA or Ffh can also result in the induction of a heat shock response (7, 35). These observations suggest that the relative levels of each component of the SRP are critical for proper function of the apparatus.

The Ffh and SRP54 proteins have three domains: an M domain, which interacts with the signal peptide of nascent proteins as well as to the 7S RNA (4.5S in E. coli); a G domain, which has the GTPase activity required for the interaction of the complex with the docking protein and its subsequent release; and an N domain of highly conserved, yet unknown function (60). FtsY and SRalpha also have three domains: the G domain, which has the GTPase activity and is homologous to the G domain of SRP54 and Ffh; an N domain of unknown function that is homologous to the N domain of SRP54 and Ffh; and a unique amino-terminal domain (60). The amino-terminal domain of FtsY is postulated to be important for membrane localization of the protein (37, 62).

Using a screening approach that takes advantage of the fact that the relative levels of each of the components of the bacterial SRP system are critical for function and survival of the organism (17, 24), Ulbrandt et al. (56) identified a number of proteins that utilize the SRP for localization. Eight of those identified were shown to encode polytopic cytoplasmic membrane proteins. Consistent with this, de Gier et al. (12) also demonstrated that the depletion of either Ffh or 4.5S RNA reduces the efficiency of insertion of the cytoplasmic membrane protein leader peptidase (Lep) and another group, MacFarlane and Müller (26) demonstrated that the depletion of Ffh or 4.5S RNA prevents the functional membrane insertion of lactose permease (LacY). Thus, it is becoming clear that the bacterial SRP is important for the proper localization of inner membrane proteins.

The strong similarities between PilA and the bacterial FtsY proteins led us to reexamine the function of PilA as a transcriptional regulator and consider the possibility that PilA may play a role in protein maturation. In this report, we show that PilA does not regulate transcription of a pilE-lacZ fusion in E. coli, regardless of the conditions used. We present evidence to suggest that PilA plays a role in protein maturation. We show that overproduction of PilA in E. coli causes the accumulation of a presecretory protein and that this accumulation appears to be independent of SecY. We also demonstrate that pilA can complement an ftsY conditional mutation in E. coli and restore normal growth to this strain under nonpermissive conditions and that a PilA mutant defective in GTPase activity can no longer perform this function. Finally, we show that PilA can partially replace FtsY in an in vitro translocation assay. We conclude from these data that PilA is the gonococcal FtsY.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

DNA manipulations. E. coli recombinant DNA manipulations were performed as previously described (28). Cloning vectors used were pACYC184 (11), pWSK129 (61), pTacTerm (32), and the pBluescript series (Stratagene, La Jolla, Calif.). Restriction enzymes (New England Biolabs, Beverly, Mass.) and T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.) were used according to the manufacturers' recommendations. PCR was done using a Perkin-Elmer 9600 thermocycler (PE Applied Biosystems, Foster City, Calif.) and Taq DNA polymerase (Boehringer). DNA sequence determination was done by the Core Facility of the Department of Molecular Microbiology and Immunology at the Oregon Health Sciences University using an ABI 377 automated fluorescence DNA sequencer (PE Applied Biosystems).

Growth and construction of bacterial strains. The E. coli strains used were JM109, CJ236 (18), CA201 (3), and N4156::pAra14-FtsY (24). E. coli were routinely grown in Luria broth supplemented as necessary with carbenicillin (Cb) at 100 mg/liter (plasmids) or 40 mg/liter (chromosomal), kanamycin (Kn) at 60 mg/liter, chloramphenicol (Cm) at 25 mg/liter, spectinomycin (Sp) and streptomycin sulfate (St), each at 25 mg/liter, or erythromycin (Em) at 300 mg/liter. Minimal medium used was that of Vogel and Bonner (58) supplemented with 0.2% Casamino Acids.

N. gonorrhoeae strains used were derivatives of MS11A (P+Tr) (44) and were maintained in a humidified 5% CO2 atmosphere on GC agar (Difco) with supplements (19). Em was used at 3 mg/liter, and Kn was used at 100 mg/liter. N. gonorrhoeae transformation was performed as described previously (46). E. coli-N. gonorrhoeae shuttle plasmids, and their manipulations have been described previously (31).

Plasmid constructions. pNG4-26 contains the pilA and pilB genes under control of their native promoters and was constructed by ligating a 4.2-kb ClaI-SmaI fragment from pNG1711 (29) into ClaI-EcoRV-digested pACYC184. pTPA129 is a low-copy-number plasmid with the PolA-independent pSC101 origin of replication (11) and was constructed by inserting the EcoRI-HindIII fragment from pTPA5 containing Ptac-pilA-rrnBt into EcoRI-HindIII-digested pWSK129 (61).

In order to replace the wild-type copy of pilA in N. gonorrhoeae with the mutated pilA genes, derivatives of pNG1711 (29) were constructed. pNG1711 contains a 9.9-kb BclI fragment from N. gonorrhoeae MS11A in the BamHI site of pBR322 and contains the pilE1, opaE, pilA, and pilB genes, in that order. The pilA and pilB genes are divergently transcribed, and their 5' ends overlap such that the pilA promoter lies within the pilB open reading frame, and the putative pilB promoter overlaps the pilA start codon (54). A 2.2-kb fragment containing the opaE and pilE1 genes, which are located 3' of pilA on this plasmid, were replaced with a 1.2-kb Emr cassette (55) to facilitate the selection of transformants, to create pNG1711Erm. This leaves 2.5 kb of homology 3' to pilA on the gonococcal chromosome and 5.2 kb of flanking homology in the 5' direction.

To introduce pilA in multicopy into N. gonorrhoeae, a 4.4-kb HpaI-SmaI (pilA-Emr) fragment from pNG1711Erm was ligated into the SmaI site of the shuttle plasmid pMGC18.1 to create pGC400.

Site-directed mutagenesis of pilA. Site-directed mutagenesis was performed by the Kunkel method (20) using the Mutagene kit (Bio-Rad Laboratories, Richmond, Calif.). Briefly, an 804-bp NotI-SalI fragment from pTPA5 (3) containing the 3' end of the pilA gene was cloned into pBluescript II SK(-) to generate the mutagenesis template. Oligonucleotides corresponding to the plus strand introducing the nucleotide changes (indicated in bold) were used to prime synthesis of the second strand (G308A, 5' CCGCCGCCCGCCTGC 3'; K370A, 5' GCTTATCGTTACAGCGCTCGACGGC 3'). DNA from transformants was isolated and screened for the presence of the mutation by restriction analysis. The Gright-arrowC change to introduce the G308A mutation destroys the recognition site for EagI. Two additional nucleotides were changed in addition to the Tright-arrowG change to introduce the K370A mutation in order to create a recognition site for HaeII. The DNA sequence of the entire 804-bp insert was determined to rule out the possibility of second site mutations introduced by the mutagenesis procedure. NotI-SalI fragments containing the mutations were subcloned back into NotI-SalI-digested pTPA5 to create pTPA308 or pTPA370. To facilitate transfer of these mutations to the N. gonorrhoeae genome, the derivatives pNG1711ErmG308A and pNG1711ErmK370A were constructed as described above.

PCR screen of N. gonorrhoeae transformants. Emr transformants were passed to GCB (Em) plates, and the remainder of the colony was placed into 20 µl of 0.05 N NaOH-0.25% sodium dodecyl sulfate (SDS) and heated to 50°C for 10 min. This was diluted 10-fold with distilled H2O, and 1 µl was used as a template for PCR. Oligonucleotide primers homologous to the 5' and 3' ends of pilA were used to generate a 1,349-bp product. The product was ethanol precipitated, and a portion of it was digested with EagI or HaeII as necessary. Digested DNAs were separated by electrophoresis on 1.8% agarose gels in Tris-borate-EDTA buffer (28).

Protein preparation and analysis. Wild-type and mutant PilA proteins were purified as described previously (4). Protein concentrations were determined by the bicinchoninic acid method (Pierce, Rockford, Ill.) or by the Bradford method (Bio-Rad), depending on the presence of reducing agents and detergents in the samples. Proteins were separated by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) (22) and stained with Coomassie blue or transferred to nitrocellulose for immunoblots. Western blot analysis was done in phosphate-buffered saline with nonfat dry milk at 10% (wt/vol) for blocking and 2% for antibody incubations. Generation of antibodies to PilA has been described previously (3). Antibodies to beta -lactamase were purchased from 5 Primeright-arrow3 Prime, Inc. (Boulder, Colo.). Antibodies to SecY were provided by William Wickner. Secondary antibodies were goat anti-rabbit antibody conjugated to alkaline phosphatase or horseradish peroxidase and used according to the manufacturer's instructions (Pierce).

In vitro protein translocation assays. Coupled translation-translocation assays were conducted as described previously (37). Where indicated, reaction mixtures contained two equivalents of salt-washed canine pancreatic microsomal membranes (KRMs) or trypsin-treated KRMs (TKRMs); 50 nM canine SRP or E. coli Ffh-4.5S RNP; and 150 to 500 nM FtsY, PilA, or PilA G308A. At the end of the reaction, samples were trichloroacetic acid precipitated and analyzed by SDS-PAGE on 10 to 15% polyacrylamide gradient gels, followed by PhosphorImager analysis.

Enzyme assays. GTPase assays were done as described previously (4). [gamma -32P]GTP (6,000 Ci/mmol) was supplied by New England Nuclear. beta -Galactosidase assays were done as described previously (16).


    RESULTS
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

PilA does not regulate a pilE-lacZ transcriptional fusion. PilA was initially isolated as part of a putative two-component regulatory system based on its ability to control expression of a pilE-CAT (chloramphenicol acetyltransferase) fusion in E. coli (54). In an attempt to confirm this result, a pilE-lacZ transcriptional fusion was constructed. pNGP3-1 contains the pilE promoter and associated upstream regulatory regions on a 301-bp fragment inserted upstream of the promoterless lacZ gene (3). This fragment extends from -241 to +60 with respect to the pilE transcriptional start point (29) and contains the same pilE 5' sequences as the pilE-CAT fusion used by Taha et al. (54). The pilE-lacZ fusion was transferred to the bacteriophage lambda RS45 to create lambda NGP3-145, which was then used to lysogenize E. coli CA201, placing the pilE-lacZ fusion in single copy on the bacterial chromosome (48). CA201lambda NGP3-145 lysogens were transformed with the plasmid pACYC184 or with pNG4-26 (pilA+ pilB+). beta -Galactosidase assays of these strains were done, and the repression ratios (pilA pilB+/pilA+ pilB+) were 0.92 ± 0.07 (mid-log phase) and 0.89 ± 0.26 (stationary phase) (values are averages of three or more independent determinations ± standard errors). Taha et al. (54) showed that pilA and pilB together resulted in approximately fivefold repression of a pilE-CAT fusion (repression ratio of 5.0). In contrast, we observed essentially no repression of our pilE-lacZ fusion when cultures were assayed at either the mid-logarithmic or stationary phase of growth.

Since Taha et al. (54) also reported that the presence of pilA alone resulted in a fivefold increase in pilE-CAT expression, lambda NGP3-145 was used to lysogenize the PilA expression strain, CA201/pMS421/pTPA5 (3). pTPA5 contains pilA under control of a tac promoter, which is controlled by the Lac repressor expressed by the plasmid pMS421. Lysogens containing pTPA5 or the vector control, pTacTerm, were grown in minimal medium to mid-log phase and induced with 500 µM IPTG (isopropyl-beta -D-thiogalactopyranoside) for 2 h. beta -Galactosidase assays were done, and the activation ratio was 0.78 ± 0.05 (with lambda NGP3-145) (values are averages of three or more independent determinations ± standard errors). Again, no activation of pilE-lacZ expression was observed.

To determine if the small amount of repression observed was significant, a deletion derivative of lambda NGP3-145 was constructed. lambda NGP1-445 contains a pilE-lacZ fusion from which 175 bp of the 5' end of the pilE promoter fragment have been deleted. While PilA has been shown to bind to the pilE promoter fragment from lambda NGP3-145 in a gel retardation assay, the deletion derivative on lambda NGP1-445 was not bound by PilA in this same assay system (3). beta -Galactosidase activities of lambda NGP1-445 lysogens in the presence and absence of pilA were nearly identical, resulting in an activation ratio of 0.88 ± 0.13. Taken together, our results show no apparent regulation of a pilE-lacZ transcriptional fusion by pilA in the presence or absence of pilB in E. coli.

To address the effects of PilA on pilE expression in N. gonorrhoeae, we made use of a pilE-lacZ transcriptional fusion described by Boyle-Vavra and Seifert (8). This strain (MS11CmLac2) is a derivative of MS11A that contains a pilE-lacZ transcriptional fusion at the pilE2 expression locus, leaving the pilE1 expression locus intact. This strain is thus still pilated and therefore transformable. Since pilA is apparently essential for the gonococcus (54), it is not possible to compare expression of pilE in pilA+ and pilA strains. To circumvent this, we introduced a multicopy plasmid expressing pilA (pGC400) into the pilE-lacZ fusion strain and measured beta -galactosidase activity. Western blot analysis of the pGC400-containing strain with anti-PilA sera showed it to have at least fivefold more PilA in the cell than the wild-type strain (data not shown). pilE-lacZ expression in a strain containing excess PilA was not significantly different from that of a strain containing the vector only (pMGC18.1) (31). Specifically, expression levels in beta -galactosidase units (nanomoles of ONPG hydrolyzed per minute per milligram of protein) were 24,062 ± 3,014 for pMGC18.1 (pilA) and 26,996 ± 2,603 pGC400 (pilA+) (averages of three or more independent determinations ± standard errors). This suggests again, that PilA is not affecting pilE expression in the gonococcus.

Effect of PilA overproduction on protein maturation. Analysis of the predicted PilA protein sequence reveals that it has significant homology to the alpha  subunit of the mammalian SRP docking protein (SRalpha ) and its bacterial homolog, FtsY (54). The processing of some presecretory proteins has been shown to be inhibited upon overexpression of FtsY (21, 24, 47). To examine the effect of PilA overproduction on protein processing, E. coli strains containing pilA controlled by the tac promoter were grown and induced with various amounts of IPTG. Immunoblot analysis with antisera raised against purified PilA (3) showed that significant amounts of PilA are produced even in the absence of IPTG, indicating that repression of pilA is not complete in this system (Fig. 1). Increasing amounts of IPTG resulted in increasing amounts of PilA produced. The negative control, E. coli containing the expression vector pTacTerm, did not react with the PilA antisera. Immunoblot analysis with antibodies to beta -lactamase (encoded on pTacTerm) showed that increasing amounts of PilA result in the accumulation of increasing amounts of pre-beta -lactamase (Fig. 1). In contrast, no pre-beta -lactamase was observed in samples containing the vector grown with or without IPTG induction. This suggests that excess PilA is somehow affecting the processing of beta -lactamase into its mature form.


View larger version (20K):
[in this window]
[in a new window]
 
FIG. 1.   Immunoblot analysis of proteins from strains overproducing PilA. E. coli CA201/pMS421 harboring pTacTerm (pTT) or pTPA5 was grown in 5 ml of minimal medium at 30°C to mid-logarithmic phase and induced for 2 h with various concentrations of IPTG as indicated. Cells were pelleted and resuspended in equal amounts of SDS-PAGE loading buffer. A total of 5 µl of protein was loaded per lane of 12.5% polyacrylamide gels. Coomassie blue-stained gels of samples showed that roughly equal amounts of protein were present in each sample (not shown). Antibodies used are indicated to the left of the corresponding gel. M, mature beta -lactamase (signal sequence cleaved); P, pre-beta -lactamase.

Since the accumulation of pre-beta -lactamase in the presence of PilA could be due to a general effect on protein translocation, we examined these extracts for the levels of SecY, one of the components of the SecYEG translocon that is utilized by both the general secretory pathway (GSP) and SRP secretion pathways in bacteria (57). Figure 1 shows no difference in the levels of SecY in our experiments. This indicates that the accumulation of pre-beta -lactamase is not due to a difference in the amount of SecY in the cell.

pilA complements an E. coli conditional ftsY mutant. As ftsY is essential for cell viability in E. coli (15), complementation analysis was performed on an ftsY conditional lethal mutant. N4156::pAra14-FtsY contains the ftsY gene under control of the tight araB promoter in place of the native ftsY on the chromosome (24). This strain requires arabinose for growth and does not grow in its absence. This strain is also polA, therefore, a PolA-independent pilA plasmid (pTPA129) was constructed (see Materials and Methods). N4156::pAra14-FtsY cells were transformed with pTPA129 or the vector control, pWSK129. Transformants were selected on Luria broth Cb40Kn60ara plates and then struck on minimal medium containing glucose alone or with 0.2% arabinose (Fig. 2). Strains containing pTPA129 and pWSK129 grew well in the presence of arabinose. However, only the pTPA129 (pilA+) transformant was able to grow in the absence of arabinose. Growth curves of these strains in liquid media of the same composition showed similar results (data not shown). These results demonstrate that pilA can complement ftsY in E. coli.


View larger version (84K):
[in this window]
[in a new window]
 
FIG. 2.   Complementation of E. coli ftsY with N. gonorrhoeae pilA. E. coli N4156::pAra14-FtsY was transformed with pWSK129 (vector), pTPA129 (pWSK129 + wild-type pilA), and pTPA129.308 (pWSK129 + pilA G308A) and plated on minimal glucose plates with (+) or without (-) arabinose. Plates were incubated overnight at 37°C and photographed using a Bio-Rad Gel Doc 1000 system with back lighting.

Since depletion of FtsY has been shown to result in the accumulation of pre-beta -lactamase (24, 47) we wished to determine if PilA could also complement this defect. As indicated above, N4156::pAra14-FtsY does not grow in the absence of arabinose. However, when cells grown in arabinose are washed to remove the arabinose and placed into arabinose-free liquid medium, they grow, albeit significantly more slowly than those grown in the presence of arabinose, and they eventually die off (24, 47). This suggests that the cells are utilizing the FtsY that remains in the cell from before the shift to nonpermissive conditions, which is eventually used up. N4156::pAra14-FtsY cells containing pWSK129 or pTPA129 were shifted to growth with or without arabinose for 6 h, and total proteins were subjected to SDS-PAGE. Figure 3 shows immunoblots of these gels obtained by using antisera to PilA and beta -lactamase. Immunoblot analysis with PilA antisera showed similar amounts of PilA produced in the presence or absence of arabinose, indicating that FtsY depletion does not affect PilA expression. Immunoblot analysis with beta -lactamase antisera shows an accumulation of pre-beta -lactamase in the pWSK129-containing strain under nonpermissive conditions (no arabinose). In contrast, there is no accumulation of pre-beta -lactamase in pTPA129-containing cells. Thus, PilA is also able to complement the protein maturation defect of FtsY-depleted cells.


View larger version (19K):
[in this window]
[in a new window]
 
FIG. 3.   Immunoblot analysis of proteins from N4156::pAra14-FtsY transformed with pWSK129 (vector), pTPA129 (pWSK129 + wild-type pilA), and pTPA129.308 (pWSK129 + pilA G308A) grown in minimal glucose medium with (+) or without (-) arabinose. Cultures grown overnight in minimal medium containing arabinose were washed twice with arabinose-free medium and used to inoculate duplicate tubes of media with or without arabinose. Cultures were grown at 37°C for 6 h. Cells were harvested, and proteins were resuspended in equal amounts of SDS-PAGE loading buffer. Equal amounts of protein were loaded in each lane of 12.5% polyacrylamide gels. Coomassie blue-stained gels of samples showed that roughly equal amounts of protein were present in each lane (not shown). Antibodies used are indicated to the left of the corresponding gel. M, mature beta -lactamase (signal sequence cleaved); P, pre-beta -lactamase.

PilA functions in an in vitro protein translocation assay. We next determined whether PilA could catalyze protein translocation in vitro. It has been demonstrated recently that the E. coli Ffh-4.5S RNP and FtsY can replace mammalian SRP and the alpha  subunit of the SRP receptor, respectively, in a heterologous protein translocation system (37). In this system, mammalian microsomal membranes are depleted of endogenous SRalpha by mild protease treatment, rendering them inactive in targeting and translocation. Activity can be restored, however, by addition of both E. coli SRP and SRP receptor (FtsY). We therefore tested whether PilA could substitute for FtsY in this system, monitoring signal sequence cleavage of a model secretory protein, preprolactin (pPL) (Fig. 4). Significant translocation activity was observed in the presence of trypsinized membranes (TKRMs), the Ffh-4.5S RNP and FtsY (~75% processing of pPL at 150 nM FtsY) (Fig. 4, lane 5) as reported previously (37). When PilA was added instead of FtsY, modest but reproducible translocation activity was observed (~20% processing at 150 nM PilA) (Fig. 4, lane 6). This level of activity represents a maximum, as no increase in processing was observed when more PilA was added (up to 500 nM; data not shown). This reduced level of activity is likely to result from the fact that the N-terminal domain of PilA is smaller and less negatively charged compared to FtsY, features which have been shown to be important in this assay. These results complement the in vivo observations above and support the conclusion that PilA is indeed an FtsY homolog.


View larger version (18K):
[in this window]
[in a new window]
 
FIG. 4.   Translocation of preprolactin (pPL) catalyzed by PilA. (A) (Upper) SDS-PAGE and PhosphorImager analysis of 35S-labeled nascent proteins, where pPL and PL indicate precursor and signal sequence-cleaved forms of prolactin, respectively. (Lower) Quantitation of the data, depicted as the percentages of the signal sequence cleaved. Preprolactin was synthesized in a wheat germ translation extract in the presence of the indicated components, as described in Materials and Methods. FtsY, PilA, and PilA G308A were each present at 150 nM final concentrations. (B) Quantitation of results from an independent experiment, where lane identities are identical to those in panel A.

Construction of a PilA GTPase mutant. PilA contains the four consensus GTPase elements of the GTPase superfamily (1), all of which are absolutely conserved. We have previously shown that, like E. coli FtsY (21), PilA has a GTPase activity that is GTP specific and requires Mg++ (4). The consensus sequence for box 3 is DXXG (14) and is DTAG in PilA. The glycine residue of this motif is thought to interact with the three glycine residues of box 1 to form the P loop which interacts with the phosphate group of GTP (43). Amino acid residue Gly308 of PilA (DTAG) was changed to Ala by site-directed mutagenesis to create pTPA308. PilA G308A was purified from CA201/pMS421/pTPA308 cells as described for the wild-type PilA (4) and analyzed for GTPase activity. The kinetic parameters for the PilA mutant were determined by assays in which the substrate (GTP) concentration was varied. The results showed that the Km of this mutant for GTP was 11.5 ± 0.8 µM, similar to that of the wild type (9.6 ± 0.4 µM), but the Vmax was 186 ± 53 pmol min-1 mg-1, 10-fold less than that of the wild-type enzyme (1,900 ± 276). Thus, PilA G308A is severely affected in its ability to hydrolyze GTP.

Effects of the PilA G308A mutation on protein maturation. CA201/pMS421/pTPA308 cells were induced with various amounts of IPTG, and total proteins were subjected to SDS-PAGE and Western blot analysis using antibodies to beta -lactamase. An accumulation of pre-beta -lactamase was observed with increasing levels of PilA G308A (data not shown), as was observed for the wild-type PilA (Fig. 1). This suggests that, like wild-type PilA or FtsY, the PilA G308A mutant may be able to interact with the SRP and disrupt protein maturation (21, 24, 47).

To determine if the PilA G308A mutant could complement the ftsY mutation in E. coli, a pWSK129 derivative expressing the PilA G308A mutation (pTPA129.308) was transformed into N4156::pAra14-FtsY. Resulting transformants were struck on minimal medium containing glucose alone or glucose with arabinose. Figure 2 shows that unlike the wild-type PilA, PilA G308A cannot replace the E. coli FtsY. N4156::pAra14-FtsY cells containing pTPA129.308 were grown in liquid medium in the presence or absence of arabinose and the proteins were separated by SDS-PAGE. Immunoblots using PilA antisera showed that, similar to the wild-type PilA, significant amounts of the mutant G308A were made even in the absence of IPTG, and the levels were similar when grown in the presence or absence of arabinose (Fig. 3). Immunoblots with beta -lactamase antisera showed an accumulation of pre-beta -lactamase under nonpermissive conditions, although not as great as that observed for the vector control under nonpermissive conditions. This indicates that the mutant may be slightly able to alleviate the protein maturation defect, although not nearly as well as the wild-type PilA.

We next asked whether the PilA G308A mutant could replace the wild-type PilA in our in vitro protein translocation assay. As seen in Fig. 4 (lane 7), no stimulation of translocation activity in the presence of PilA G308A was observed. Indeed, only background levels of processing were observed, even with 500 nM PilA G308A (data not shown). These results demonstrate that this mutant protein is completely inactive in this assay. Taken together, they show that the GTPase activity of PilA is required for its function in vivo as well as in vitro.

The GTPase activity of PilA is also important in the gonococcus. We next attempted to replace the wild-type copy of pilA in N. gonorrhoeae with mutated pilA genes. Plasmid DNA from pNG1711Erm (encodes wild-type PilA), pNG1711ErmG308A (PilA G308A), or pNG1711ErmK370A (PilA K370A, a mutant only slightly affected for GTPase activity [2a]) was linearized and used to transform N. gonorrhoeae strain MS11A as previously described (46). A 1,349-bp fragment containing the pilA gene was PCR amplified from Emr transformants. These products were screened for the presence of the mutation by restriction analysis (see Materials and Methods). In the 5.2-kb region of sequence homology where a crossover event must occur to yield Emr transformants with pNG1711ErmG308A, there is a 0.4-kb region where a crossover event would result in the transformant having a wild-type pilA gene. A crossover event in the remaining 4.8 kb would result in the introduction of the G308A mutation. If all sequences in this region are equal for homologous recombination, one would expect 7.8% of Emr transformants to have the wild-type genotype and 92.2% to have the mutant genotype. However, of 74 Emr transformants screened (from three independent transformations), all contained the wild-type pilA gene. In contrast, in the 5.2-kb region of sequence homology where a crossover event must occur to yield Emr transformants with pNG1711ErmK370A, there is a 0.2-kb region where a crossover event would result in the transformant having a wild-type pilA gene. A crossover event in the remaining 5.0 kb would result in the introduction of the K370A mutation. This predicts a frequency of 3.8% wild-type and 96.2% mutant transformants. Of 47 Emr transformants screened (from three independent transformations), 37 contained the wild-type pilA gene and 10 contained the K370A mutation. This corresponds to a frequency of 79% wild-type transformants and 21% mutant transformants. The fact that we were able to replace the wild-type pilA with a gene encoding the K370A mutation, albeit at a lower frequency than expected, but not the G308A mutation indicates that the GTPase activity of PilA is important in the gonococcus.


    DISCUSSION
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

We recently compared the pilA sequence with sequences in the nearly completed genome sequence of N. gonorrhoeae FA1090 (13) using the BLAST program (2). This search yielded only two genes with significant homology. Comparison of these sequences with those of the E. coli ftsY and ffh genes suggests that they are the gonococcal SRP homologs. The homology between ffh and pilA is located exclusively in the G domains, while the homology between ftsY and pilA occurs throughout the entire protein, suggesting that pilA and ftsY are true homologs. The striking homology between PilA and the G domains of the SRP proteins initially led us to examine PilA for GTPase activity (4). These experiments showed that, like FtsY (21), PilA is GTPase.

To examine the relationship between the GTPase and purported regulatory activities of PilA, we attempted to confirm the transcriptional regulation experiments using a pilE-lacZ fusion. Regardless of the conditions used, we were unable to demonstrate any significant effect of PilA on pilE-lacZ expression. The pilE-lacZ fusion used in this study contained a fragment with the same endpoints of the pilE upstream region used by Taha et al. (54). Thus, the only difference between our systems was the reporter system used. The reason for this discrepancy in results is not clear, although it is worth noting that Taha et al. (52) have also reported PilA control of pilC in N. meningitidis with a lacZ reporter system, which implies that both the lacZ and CAT systems give similar results in their hands.

Our inability to demonstrate transcriptional regulation by PilA and the striking similarities between PilA and FtsY led us to hypothesize that PilA might actually be the gonococcal FtsY homolog. We first examined the effect of overexpression of PilA on maturation of the secreted protein, beta -lactamase. Maturation of this protein has been shown to be inhibited upon overexpression of components of the bacterial SRP (21, 24, 47, 56). E. coli strains containing pilA under the control of the tac promoter were grown and induced with various amounts of IPTG. Immunoblot analysis of total proteins from these strains showed an accumulation of pre-beta -lactamase with increasing concentrations of PilA (Fig. 1). Immunoblot analysis of duplicate samples showed no difference in SecY levels in these samples. SecY, a major component of the membrane-bound translocation apparatus, is thought to be utilized for both the GSP and SRP secretion systems (57). Thus, the accumulation of pre-beta -lactamase in these samples is likely due to a defect prior to the translocation step. This is consistent with the interpretation that excess PilA perturbs the SRP system by titrating out other components of the apparatus. Others have shown that the relative levels of each of the components of the E. coli SRP are critical for optimal function (17, 24, 34, 47). Using a slightly different system, Taha et al. (53) looked at the effect of PilA on beta -lactamase processing in E. coli and also observed an accumulation of the preprotein in the presence of excess PilA. They concluded that the effect was nonspecific and likely a secondary effect of transcriptional regulation of cell growth rate by PilA.

Studies of the role of the bacterial SRP indicate that it is important for the proper localization of inner membrane proteins (12, 26, 56). Interestingly, one of the proteins believed to be dependent upon the SRP is leader peptidase (Lep), which cleaves the hydrophobic signal sequences from secreted proteins following their translocation across the inner membrane. Thus, a perturbation of the bacterial SRP caused by depletion or overexpression of one of its components may affect the function of Lep, which may in turn affect the proper processing of secreted proteins. This may explain the accumulation of pre-beta -lactamase observed by us and others (24, 47) upon overexpression of FtsY in E. coli.

We next demonstrated that PilA could substitute for FtsY in E. coli by complementation of a conditional ftsY mutant (N4156::pAra14-FtsY) (24). Figure 2 shows that strains expressing pilA can grow under conditions in which ftsY is not expressed (media lacking arabinose), indicating that PilA can replace FtsY in E. coli. Further evidence to support this is seen in Fig. 4. Using an in vitro translocation assay with purified E. coli Ffh-4.5S RNA, we observed that PilA could partially replace FtsY in this assay system. Under conditions where FtsY can effect processing of 75% of the substrate, PilA was able to direct the processing of nearly 20% of the same substrate. While this activity is low, it is reproducible and is significantly above background levels, indicating that the translocation observed is PilA mediated. The reduced level of activity observed in this assay may be due to the fact that the N-terminal domain of PilA is smaller and less negatively charged compared to FtsY, which has been shown to be important in this assay (37).

To determine whether the GTPase activity of PilA is required for its function, a mutation was introduced into box 3 of the conserved GTP-binding site of PilA. This mutant (PilA G308A) is 10-fold reduced in GTPase activity compared to the wild-type protein. In vivo, PilA G308A cannot replace FtsY in E. coli (Fig. 2) nor can it replace the wild-type PilA in N. gonorrhoeae. Additionally, PilA G308A cannot replace FtsY in an in vitro system (Fig. 4). However, overexpression of this mutant results in the accumulation of pre-beta -lactamase, similar to that observed for the wild-type PilA (data not shown). This suggests that while PilA G308A cannot function as the docking protein for the SRP, it may be able to interact with other components of the SRP such that they can no longer function correctly in protein maturation. The corresponding mutation in box 3 of the E. coli FtsY (G385A) also results in a strong dominant lethal phenotype and affects translocation of some proteins as well (56).

The fact that our results indicate that PilA is part of a gonococcal SRP apparatus and not a transcriptional regulator raises a number of questions. First, why was PilA identified in a screen for transcriptional regulators of pilE in E. coli? We have been unable to repeat the transcriptional regulation results using a reporter system (lacZ) different from that used in the original screen (CAT). Both reporter enzymes are cytoplasmic, so it is unlikely that enzyme activities were directly affected by the SRP apparatus, although it is possible that the uptake of chloramphenicol by the transformants may have affected their survival on plates in the original screen (54). However, this does not explain the results where CAT activity was measured in cell lysates. Thus, the answer to this question remains a mystery.

Second, why does PilA bind DNA in vitro? We showed that purified PilA binds to pilE promoter DNA in a sequence-specific manner using a gel retardation assay (3). Taha and Giorgini (51) obtained a similar result using crude preparations of PilA in a similar assay. Our results indicated that the binding was complex and required sequences at both ends of the promoter fragment. We concluded from this study that DNA looping may be involved in this interaction, and we hypothesize that PilA does not recognize a specific sequence per se but rather recognizes a secondary or tertiary structure formed by a particular DNA sequence. Indeed, the DNA sequences from -100 to +1 of the pilE promoter is 73% AT rich, which is consistent with bent DNA (3). We have screened a promoter library from N. gonorrhoeae MS11A for binding by PilA and identified 12 DNA fragments that compete with pilE DNA for PilA binding. These fragments are also directly bound by PilA in a gel mobility shift assay (2a). An alignment of these sequences with each other and the pilE promoter reveals no obvious consensus binding sequence (data not shown). It is possible that these fragments fold into a similar structure that results in an electrophoretic mobility shift in the presence of PilA.

FtsY physically interacts with the Ffh-4.5S RNA complex (30, 35) and may therefore come in contact with RNA, either the 4.5S RNA or the mRNA of the translation complex. DNA and RNA are structurally different from each other, although there are proteins which bind both RNA and DNA (23, 39). It is possible that secondary or tertiary structure is important for this binding. It is conceivable, although unlikely, that PilA actually binds RNA in vivo, and the in vitro DNA binding is an artifact of this activity.

A more attractive possibility is that PilA/FtsY somehow interacts with the chromosome. ftsY was initially identified as part of an operon containing genes which are temperature sensitive for filamentation (15), although no such mutations have ever been mapped to ftsY. FtsY-depleted cells are filamentous and are apparently defective in completion of septation during cell division (24). The same phenotype has been observed for cells depleted for Ffh or cells expressing a mutated in ffh gene (34, 42). Thus, the bacterial SRP may play a role in cell division and septation which may involve interactions between the components of the SRP and the chromosome.

What subset of gonococcal proteins might depend on PilA and the gonococcal SRP for maturation? Taha et al. (53) examined N. gonorrhoeae heterodiploids producing wild-type and truncated forms of PilA for the accumulation of Opa, a gonococcal outer membrane protein that is involved in epithelial cell invasion by gonococci (27, 59). They reported that these heterodiploids did not affect Opa signal sequence processing, although they did observe an induction of heat shock proteins in these strains. Thus, Opa likely does not utilize the gonococcal SRP. It will be interesting to determine which proteins of N. gonorrhoeae depend on the SRP system for proper localization.


    ACKNOWLEDGMENTS

This work was supported by National Institutes of Health grant RO1 AI34560 to M.S.

We thank W. Wickner for providing antibodies to SecY and J. Luirink for providing the conditional FtsY strain. The sequence of the N. gonorrhoeae FA1090 genome was provided by the Gonococcal Genome Sequencing Project, courtesy of B. A. Roe, S. P. Lin, L. Song, X. Yuan, S. Clifton, and D. W. Dyer.


    FOOTNOTES

* Corresponding author. Mailing address: Department of Molecular Microbiology and Immunology, Oregon Health Sciences University, L220, 3181 SW Sam Jackson Park Rd., Portland, OR 97201-3098. Phone: (503) 494-6840. Fax: (503) 494-6862. E-mail: arvidson{at}ohsu.edu.


    REFERENCES
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References

1. Althoff, S., D. Selinger, and J. A. Wise. 1994. Molecular evolution of SRP cycle components: functional implications. Nucleic Acids Res. 22:1933-1947[Abstract/Free Full Text].
2. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403-410[Medline].
2a. Arvidson, C. G. Unpublished data.
3. Arvidson, C. Grove, and M. So. 1995. Interaction of the Neisseria gonorrhoeae PilA protein with the pilE promoter involves multiple sites on the DNA. J. Bacteriol. 177:2497-2504[Abstract/Free Full Text].
4. Arvidson, C. Grove, and M. So. 1995. The Neisseria transcriptional regulator PilA has a GTPase activity. J. Biol. Chem. 270:26045-26048[Abstract/Free Full Text].
5. Bernstein, H. D., M. A. Poritz, K. Strub, P. J. Hoben, S. Brenner, and P. Walter. 1989. Model for signal sequence recognition from amino-acid sequence of 54K subunit of signal recognition particle. Nature 340:482-486[Medline].
6. Bernstein, H. D., D. Zopf, D. M. Freymann, and P. Walter. 1993. Functional substitution of the signal recognition particle 54-kDa subunit by its Escherichia coli homolog. Proc. Natl. Acad. Sci. USA 90:5229-5233[Abstract/Free Full Text].
7. Bourgaize, D. B., T. A. Phillips, R. A. VanBogelen, P. G. Jones, F. C. Neidhart, and M. J. Fournier. 1990. Loss of 4.5S RNA induces the heat shock response and lambda prophage in Escherichia coli. J. Bacteriol. 172:1151-1154[Abstract/Free Full Text].
8. Boyle-Vavra, S., and H. S. Seifert. 1993. Shuttle mutagenesis: two mini-transposons for gene mapping and for lacZ transcriptional fusions in Neisseria gonorrhoeae. Gene 129:51-57[Medline].
9. Brinton, C. C., et al. 1978. Uses of pili in gonorrhea control: role of bacterial pili in disease, purification and properties of gonococcal pili, and progress in the development of a gonococcal pilus vaccine for gonorrhea, p. 155-178. In G. F. Brooks, E. C. Gotschlich, K. K. Holmes, W. D. Sawyer, and F. E. Young (ed.), Immunobiology of Neisseria gonorrhoeae. American Society for Microbiology, Washington, D.C.
10. Brown, S., and M. J. Fournier. 1984. The 4.5S RNA gene of Escherichia coli is essential for cell growth. J. Mol. Biol. 178:533-550[Medline].
11. Chang, A. C. Y., and S. N. Cohen. 1978. Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid. J. Bacteriol. 134:1141-1156[Abstract/Free Full Text].
12. de Gier, J.-W. L., P. Mansournia, Q. A. Valent, G. J. Phillips, J. Luirink, and G. von Heijne. 1996. Assembly of a cytoplasmic membrane protein in Escherichia coli is dependent on the signal recognition particle. FEBS Lett. 399:307-309[Medline].
13. Dempsey, J. F., W. Litaker, A. Madhure, T. L. Snodgrass, and J. G. Cannon. 1991. Physical map of the chromosome of Neisseria gonorrhoeae FA1090 with locations of genetic markers, including opa and pil genes. J. Bacteriol. 173:5476-5486[Abstract/Free Full Text].
14. Dever, T. E., M. J. Glynias, and W. C. Merrick. 1987. GTP-binding domain: three consensus sequence elements with distinct spacing. Proc. Natl. Acad. Sci. USA 84:1814-1818[Abstract/Free Full Text].
15. Gill, D. R., and G. P. C. Salmond. 1990. The identification of the Escherichia coli ftsY gene product: an unusual protein. Mol. Microbiol. 4:575-583[Medline].
16. Grove, C. L., and R. P. Gunsalus. 1987. Regulation of the aroH operon of Escherichia coli by the tryptophan repressor. J. Bacteriol. 169:2158-2164[Abstract/Free Full Text].
17. Jensen, C. G., and S. Pedersen. 1994. Concentrations of 4.5S RNA and Ffh protein in Escherichia coli: the stability of Ffh protein is dependent on the concentration of 4.5S RNA. J. Bacteriol. 176:7148-7154[Abstract/Free Full Text].
18. Joyce, C. M., and N. D. Grindley. 1984. Method for determining whether a gene of Escherichia coli is essential: application to the polA gene. J. Bacteriol. 158:636-643[Abstract/Free Full Text].
19. Kellogg, D. S., W. L. Peacock, W. E. Deacron, L. Brown, and C. I. Pirkle. 1963. Neisseria gonorrhoeae. I. Virulence genetically linked to clonal variation. J. Bacteriol. 85:1274-1279[Abstract/Free Full Text].
20. Kunkel, T. A., J. D. Roberts, and R. A. Zakour. 1987. Rapid and efficient site-specific mutagenesis without phenotypic selection. Methods Enzymol. 154:367-382[Medline].
21. Kusters, R., G. Lentzen, E. Eppens, A. van Geel, C. C. van der Weijden, W. Wintermeyer, and J. Luirink. 1995. The functioning of the SRP receptor FtsY in protein-targeting in E. coli is correlated with its ability to bind and hydrolyze GTP. FEBS Lett. 372:253-258[Medline].
22. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685[Medline].
23. Liao, D., R. Lurz, B. Dobrinski, and P. P. Dennis. 1996. A NusG-like protein from Thermotoga maritima binds to DNA and RNA. J. Bacteriol. 178:4089-4098[Abstract/Free Full Text].
24. Luirink, J., C. M. ten Hagen-Jongman, C. C. van der Weijden, B. Oudega, S. High, B. Dobberstein, and R. Kusters. 1994. An alternative protein targeting pathway in Escherichia coli: studies on the role of FtsY. EMBO J. 13:2289-2296[Medline].
25. Luirink, J., S. High, H. Wood, A. Giner, D. Tollervey, and B. Dobberstein. 1992. Signal-sequence recognition by an Escherichia coli ribonucleoprotein complex. Nature 359:741-743[Medline].
26. MacFarlane, J., and M. Müller. 1995. The functional integration of a polytopic membrane protein of Escherichia coli is dependent on the bacterial signal-recognition particle. Eur. J. Biochem. 233:766-771[Medline].
27. Makino, S., J. P. M. van Putten, and T. F. Meyer. 1991. Phase variation of the opacity outer membrane protein controls invasion of Neisseria gonorrhoeae into human epithelial cells. EMBO J. 10:1307-1315[Medline].
28. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
29. Meyer, T. F., E. Billyard, R. Haas, S. Storzbach, and M. So. 1984. Pilus sequences of Neisseria gonorrhoeae: chromosomal organization and DNA sequence. Proc. Natl. Acad. Sci. USA 81:6110-6114[Abstract/Free Full Text].
30. Miller, J. D., H. D. Bernstein, and P. Walter. 1994. Interaction of E. coli Ffh/4.5S ribonucleoprotein and FtsY mimics that of mammalian signal recognition particle and its receptor. Nature 367:657-659[Medline].
31. Nassif, X., D. Puaoi, and M. So. 1991. Transposition of Tn1545-Delta 3 in the pathogenic neisseriae: a genetic tool for mutagenesis. J. Bacteriol. 173:2147-2154[Abstract/Free Full Text].
32. Paluh, J. L., and C. Yanofsky. 1986. High level production and rapid purification of the E. coli trp repressor. Nucleic Acids Res. 14:7851-7860[Abstract/Free Full Text].
33. Parkinson, J. S., and E. C. Kofoid. 1992. Communication modules in bacterial signalling proteins. Annu. Rev. Genet. 26:71-112[Medline].
34. Phillips, G. J., and T. J. Silhavy. 1992. The E. coli ffh gene is necessary for viability and efficient protein transport. Nature 359:744-746[Medline].
35. Poritz, M. A., H. D. Bernstein, K. Strub, D. Zopf, H. Wilhelm, and P. Walter. 1990. An E. coli ribonucleoprotein containing 4.5S RNA resembles mammalian signal recognition particle. Science 250:1111-1117[Abstract/Free Full Text].
36. Powers, T., and P. Walter. 1995. Reciprocal stimulation of GTP hydrolysis by two directly interacting GTPases. Science 269:1422-1424[Abstract/Free Full Text].
37. Powers, T., and P. Walter. 1997. Co-translational protein targeting catalyzed by the Escherichia coli signal recognition particle and its receptor. EMBO J. 16:4880-4886[Medline].
38. Rapoport, T. A., B. Jungnickel, and U. Kutat. 1996. Protein transport across the endoplasmic reticulum and bacterial inner membranes. Annu. Rev. Biochem. 65:271-303[Medline].
39. Retallack, D. M., and D. I. Friedman. 1995. A role for a small stable RNA in modulating the activity of DNA-binding proteins. Cell 83:227-235[Medline].
40. Ribes, V., K. Römisch, A. Giner, B. Dobberstein, and D. Tollervey. 1990. E. coli 4.5S RNA is part of a ribonucleoprotein particle that has properties related to signal recognition particle. Cell 63:591-600[Medline].
41. Römisch, K., J. Webb, J. Herz, S. Prehn, R. Frank, M. Vingron, and B. Dobberstein. 1989. Homology of the 54K protein of signal recognition particle, docking protein, and two E. coli proteins with putative GTP-binding domains. Nature 340:478-482[Medline].
42. Samuelsson, T., M. Olsson, P. M. Wikström, and B. R. Johansson. 1995. The GTPase activity of the Escherichia coli Ffh protein is important for normal growth. Biochim. Biophys. Acta 1267:83-91[Medline].
43. Saraste, M., P. R. Sibbald, and A. Wittinghofer. 1990. The P-loop: a common motif in ATP- and GTP-binding proteins. Trends Biochem. Sci. 15:430-434[Medline].
44. Segal, E., E. Billyard, M. So, S. Storzbach, and T. F. Meyer. 1985. Role of chromosomal rearrangement in N. gonorrhoeae pilus phase variation. Cell 40:293-300[Medline].
45. Seifert, H. S. 1996. Questions about gonococcal pilus phase and antigenic variation. Mol. Microbiol. 21:433-440[Medline].
46. Seifert, H. S., R. S. Ajioka, D. Paruchuri, F. Heffron, and M. So. 1990. Shuttle mutagenesis of Neisseria gonorrhoeae: pilin null mutations lower DNA transformation competence. J. Bacteriol. 172:40-46[Abstract/Free Full Text].
47. Seluanov, A., and E. Bibi. 1997. FtsY, the prokaryotic signal recognition particle receptor homologue, is essential for biogenesis of membrane proteins. J. Biol. Chem. 272:2053-2055[Abstract/Free Full Text].
48. Simons, R. W., F. Houman, and N. Kleckner. 1987. Improved single- and multicopy lac-based cloning vectors for protein and operon fusions. Gene 53:85-96[Medline].
49. Swanson, J., K. Robbins, O. Barrera, D. Corwin, J. Boslego, J. Ciak, M. Blake, and M. Koomey. 1987. Gonococcal pilin variants in experimental gonorrhea. J. Exp. Med. 165:1344-1357[Abstract/Free Full Text].
50. Taha, M. K., B. Dupuy, W. Saurin, M. So, and C. Marchal. 1991. Control of pilus expression in Neisseria gonorrhoeae: an original system in the family of two-component regulators. Mol. Microbiol. 5:137-148[Medline].
51. Taha, M. K., and D. Giorgini. 1995. Phosphorylation and functional analysis of PilA, a protein involved in the transcriptional regulation of the pilin gene in Neisseria gonorrhoeae. Mol. Microbiol. 15:667-677[Medline].
52. Taha, M. K., D. Giorgini, and X. Nassif. 1996. The pilA regulatory gene modulates the pilus-mediated adhesion of Neisseria meningitidis by controlling the transcription of pilC1. Mol. Microbiol. 19:1073-1084[Medline].
53. Taha, M. K., M. Larribe, B. Dupuy, D. Giorgini, and C. Marchal. 1992. Role of pilA, an essential regulatory gene of Neisseria gonorrhoeae in the stress response. J. Bacteriol. 174:5978-5981[Abstract/Free Full Text].
54. Taha, M. K., M. So, H. S. Seifert, E. Billyard, and C. Marchal. 1988. Pilin expression in Neisseria gonorrhoeae is under both positive and negative control. EMBO J. 7:4367-4378[Medline].
55. Trieu-Cout, P., C. Poyart-Salmeron, C. Carlier, and P. Courvalin. 1990. Nucleotide sequence of the erythromycin resistance gene of the conjugative transposon Tn1545. Nucleic Acids Res. 18:3660[Free Full Text].
56. Ulbrandt, N. D., J. A. Newitt, and H. Bernstein. 1997. The E. coli signal recognition particle is required for the insertion of a subset of inner membrane proteins. Cell 88:187-196[Medline].
57. Valent, Q. A., P. A. Scotti, S. High, J.-W. L. de Gier, G. von Heijne, G. Lentzen, W. Wintermeyer, B. Oudega, and J. Luirink. 1998. The Escherichia coli SRP and SecB targeting pathways converge at the translocon. EMBO J. 17:2504-2512[Medline].
58. Vogel, H. J., and D. M. Bonner. 1956. Acetylornithinease of E. coli: partial purification and some properties. J. Biol. Chem. 218:97-106[Free Full Text].
59. Waldbeser, L. S., R. S. Ajioka, A. J. Merz, D. Puaoi, L. Lin, M. Thomas, and M. So. 1994. The opaH locus of Neisseria gonorrhoeae MS11A is involved in epithelial cell invasion. Mol. Microbiol. 13:919-928[Medline].
60. Walter, P., and A. E. Johnson. 1994. Signal sequence recognition and protein targeting to the endoplasmic reticulum membrane. Annu. Rev. Cell. Biol. 10:87-119.
61. Wang, R. F., and S. R. Kushner. 1991. Construction of versatile low-copy-number vectors for cloning, sequencing and gene expression in Escherichia coli. Gene 100:195-199[Medline].
62. Zelazny, A., A. Seluanov, A. Cooper, and E. Bibi. 1997. The NG domain of the prokaryotic signal recognition particle receptor, FtsY, is fully functional when fused to an unrelated integral membrane polypeptide. Proc. Natl. Acad. Sci. USA 94:6025-6029[Abstract/Free Full Text].


Journal of Bacteriology, February 1999, p. 731-739, Vol. 181, No. 3
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Kline, K. A., Criss, A. K., Wallace, A., Seifert, H. S. (2007). Transposon Mutagenesis Identifies Sites Upstream of the Neisseria gonorrhoeae pilE Gene That Modulate Pilin Antigenic Variation. J. Bacteriol. 189: 3462-3470 [Abstract] [Full Text]  
  • Du, Y., Arvidson, C. G. (2003). Identification of ZipA, a Signal Recognition Particle-Dependent Protein from Neisseria gonorrhoeae. J. Bacteriol. 185: 2122-2130 [Abstract] [Full Text]  
  • Frasz, C., Arvidson, C. G. (2003). Role for both DNA and RNA in GTP Hydrolysis by the Neisseria gonorrhoeae Signal Recognition Particle Receptor. J. Bacteriol. 185: 801-808 [Abstract] [Full Text]  
  • Skaar, E. P., Tobiason, D. M., Quick, J., Judd, R. C., Weissbach, H., Etienne, F., Brot, N., Seifert, H. S. (2002). The outer membrane localization of the Neisseria gonorrhoeae MsrA/B is involved in survival against reactive oxygen species. Proc. Natl. Acad. Sci. USA 99: 10108-10113 [Abstract] [Full Text]  
  • Millman, J. S., Andrews, D. W. (1999). A Site-specific, Membrane-dependent Cleavage Event Defines the Membrane Binding Domain of FtsY. J. Biol. Chem. 274: 33227-33234 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Arvidson, C. G.
Right arrow Articles by So, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Arvidson, C. G.
Right arrow Articles by So, M.