Previous Article | Next Article 
Journal of Bacteriology, February 1999, p. 1118-1125, Vol. 181, No. 4
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Cell Cycle Control of a Holdfast Attachment Gene in
Caulobacter crescentus
Raji S.
Janakiraman and
Yves V.
Brun*
Department of Biology, Indiana University,
Bloomington, Indiana 47405-6801
Received 3 June 1998/Accepted 10 December 1998
 |
ABSTRACT |
Attachment to surfaces by the prosthecate bacterium
Caulobacter crescentus is mediated by an adhesive
organelle, the holdfast, found at the tip of the stalk. Indirect
evidence suggested that the holdfast first appears at the swarmer pole
of the predivisional cell. We used fluorescently labeled lectin and
transmission electron microscopy to detect the holdfast in different
cell types. While the holdfast was readily detectable in stalked cells
and at the stalked poles of predivisional cells, we were unable to
detect the holdfast in swarmer cells or at the flagellated poles of
predivisional cells. This suggests that exposure of the holdfast to the
outside of the cell occurs during the differentiation of swarmer to
stalked cells. To investigate the timing of holdfast synthesis and
exposure to the outside of the cell, we have examined the regulation of a holdfast attachment gene, hfaA. The hfaA gene
is part of a cluster of four genes (hfaABDC), identified in
strain CB2A and involved in attachment of the holdfast to the polar
region of the cell. We have identified the hfaA gene in the
synchronizable C. crescentus strain CB15. The sequence of
the CB2A hfaA promoter suggested that it was regulated by
54. We show that the transcription of hfaA
from either strain is not dependent on
54. Using a
hfaA-lacZ fusion, we show that the transcription of hfaA is temporally regulated during the cell cycle, with
maximal expression in late-predivisional cells. This increase in
expression is largely due to the preferential transcription of
hfaA in the swarmer pole of the predivisional cell.
 |
INTRODUCTION |
Cell division of the gram-negative
bacterium Caulobacter crescentus gives rise to two distinct
progeny cells, a sessile cell (containing a stalk) and a motile cell
(containing a single polar flagellum) (5). Stalked cells are
often found attached to surfaces by means of an adhesive holdfast found
at the tip of the stalk. Staining properties and enzyme sensitivity
studies indicate that the holdfast is a complex polysaccharide
(20), with acidic components such as uronic acids
(33). It has been proposed that the appearance of the
holdfast is temporally regulated during the cell cycle and that the
holdfast first appears at the base of the flagellum in the swarmer pole
of the predivisional cell (26). The presence of the holdfast
at the tip of the stalk is thought to result from the growth of the
stalk at the site previously occupied by the flagellum during the
differentiation of swarmer to stalked cells. How the spatial and
temporal regulation of holdfast expression is achieved is unclear.
A cluster of four genes (hfaABDC) involved in the attachment
of the holdfast to the cell was previously identified by Tn5 insertion mutagenesis (16). The exact role of each of these genes is unknown. The C-terminal region of HfaA is similar to the C
termini of pilus tip proteins, such as the PapG adhesin from
Escherichia coli and the SmfG adhesin from Serratia
marcescens (16). These adhesins interact with host cell
polysaccharides and with a protein anchor in the pilus, thus mediating
the attachment of these bacteria to host cell surfaces. It is possible
that HfaA functions analogously in C. crescentus
(16). HfaB is similar to proteins that function in
transcriptional activation and may activate the transcription of
hfaC (16). The sequence of HfaD contains three
putative membrane-spanning regions, and it has been suggested that it
acts as the membrane-associated protein anchor between HfaA and the
cell (17). HfaC is similar to ATP-binding transport-related
proteins (17).
A sequence identical to the consensus for
54-dependent
promoters was found upstream of the hfaA transcription start
site, suggesting that its transcription may be subject to cell cycle
regulation like other known
54 promoters in C. crescentus (16).
54 is present in both
gram-negative and gram-positive members of the Eubacteria and is
required for the expression of a wide variety of genes, including those
involved in nitrogen fixation, pilus production, dicarboxylic acid
transport, and xylene catabolism in these bacteria (21). In
C. crescentus,
54 does not appear to be
required for general metabolic functions but is needed for the
biosynthesis of two polar organelles, the flagellum and the stalk
(6).
The hfaA gene was initially characterized in C. crescentus CB2A (16, 23). In this study, we extend this
work to investigate the transcriptional regulation of hfaA
in strain CB15. We show that hfaA is not transcribed by a
54 promoter. We find that the transcription of
hfaA is cell cycle regulated and that hfaA is
maximally expressed in the swarmer compartment of the predivisional
cell. The use of fluorescently labeled lectin to detect the holdfast on
live cells indicates that neither the flagellar poles of predivisional
cells nor swarmer cells possess a holdfast. However, the holdfast was
readily detectable at the tips of short stalks. This is consistent with
the hypothesis that the holdfast appears at the tips of nascent stalks
during the differentiation of swarmer to stalked cells.
 |
MATERIALS AND METHODS |
Materials, bacterial strains, and growth conditions.
Oligonucleotides hfaA Rev (5'GAACGAAGCCGAAAAGCTTGACATCGATTG3'),
hfaA+135 (5'CCATTTTTTCGCTGCAGTGGGGCTACC3'), and
hfaA+60 (5'GGGCTGGTCCCTGCAGTCTATCTAGGG3') were obtained from
either the Institute for Molecular and Cellular Biology at Indiana
University or Operon Technologies, Inc. Ludox was obtained from Dupont,
radionuclides were obtained from ICN Radiochemicals, and antibiotics
were obtained from Sigma or Amresco. The strains and plasmids used in
this study are described in Table 1. The
strain YB1371 (NA1000 hfaA::pAA2) used in the
analysis of the cell cycle expression of hfaA was
constructed as follows. Plasmid pAA2 is a transcriptional fusion
containing the CB15 hfaA promoter cloned upstream of the
promoterless lacZ gene in the plasmid pGSZ. This plasmid was
introduced into NA1000 by conjugation. As pAA2 does not replicate in
C. crescentus, selection for gentamicin-resistant colonies
selects for integrants that arise by homologous recombination.
E. coli strains were grown at 37°C in Luria-Bertani medium
with one or more of the following antibiotics: ampicillin (100
µg/ml), gentamicin (15 µg/ml), or tetracycline (12 µg/ml).
C. crescentus strains were routinely grown at 30°C in
peptone-yeast
extract (PYE) medium (
25) supplemented with
nalidixic acid (20
µg/ml) and either tetracycline (2 µg/ml) or
gentamicin (2.5 µg/ml).
M2 minimal glucose (M2G) medium
(
15) was used when cells were
synchronized by Ludox density
gradient
centrifugation.
General DNA manipulations, cloning, and sequencing.
General cloning procedures were done as described previously (3,
13). The hfaA gene from C. crescentus CB15
was identified by Southern blot hybridization as follows. A 400-bp
SacII fragment of CB2A hfaA from pBB31 was used
as a probe to screen a C. crescentus cosmid library, and a
cosmid containing hfaA (pRJ41) was isolated. A 3.0-kb
PstI-SmaI fragment from pRJ41 that hybridized to
the CB2A hfaA probe was subcloned (pRJ39). Several
overlapping subclones were generated from pRJ39 and used for sequencing
CB15 hfaA. DNA sequencing was done by the dideoxynucleotide
chain termination method (28) on double-stranded templates
isolated with Qiagen Mini-Prep kits. Reactions were done by a
modification of the Thermo Sequenase dye terminator cycle sequencing
protocol (Amersham). The following program was used: 1 min at 96°C,
followed by 25 cycles of 96°C for 30 s, 50°C for 15 s,
and 60°C for 4 min in the presence of either M13 forward or reverse
primers and labeled dideoxynucleoside triphosphates. Reactions were run
in the Institute for Molecular and Cellular Biology at Indiana
University on an ABI PRISM 377 DNA sequencer. The DNA sequence was
analyzed with the package of the Genetics Computer Group of the
University of Wisconsin (8) and Sequencher 3.0 (Gene Codes Corporation).
Detection of the holdfast with fluorescein-labeled lectin.
A
fluorescent lectin-binding assay was used to detect the holdfast
(20). A volume (2 µl) of fluorescein-conjugated wheat germ
agglutinin (FITC-WGA; Molecular Probes) (5 mg/ml of stock) was added to
200 µl of cells growing exponentially. The mixture was incubated at
room temperature for 20 min, diluted with 1 ml of water, and
centrifuged. The cell pellet was resuspended in 30 µl of Slowfade
antifading reagent (Molecular Probes), and 1 µl was examined by
fluorescence microscopy. Epifluorescence photomicroscopy was performed
on a Nikon Eclipse E800 light microscope equipped with a Nikon B-2E
fluorescein isothiocyanate (FITC) filter cube for FITC and a 100× Plan
Apo oil objective. Images were captured by a Princeton Instruments
cooled charge-coupled device camera (model 1317) and the Metamorph
imaging software package (v. 3.0).
Electron microscopy.
Cells were grown to mid-log phase in
PYE medium, washed by centrifugation at 5,000 rpm for 5 min in an
Eppendorf centrifuge, and resuspended in a one-fifth volume of
phosphate-buffered saline. Cells (5 µl) were spotted onto
carbon-coated grids and allowed to settle for 20 min. The grids were
blotted dry and washed once with water. The cells were stained with 1%
uranyl acetate for 30 s and washed four times with water. They
were examined in a Philips model 300 electron microscope at 60 kV.
Analysis of the promoter.
The hfaA promoter
and mutant versions of the hfaA promoter were cloned
upstream of the lacZ gene in pRKlac290 or pGSZ and analyzed
in wild-type and mutant backgrounds for promoter activity. Assays were
done in duplicate on a minimum of two independent cultures in each
case.
-Galactosidase activity conferred by these plasmids was
measured at 30°C as described previously (22), except that
cells were permeabilized with chloroform.
To assay the time of transcription of
hfaA, late log-phase
cultures grown in M2G medium containing tetracycline were synchronized
by the Ludox density centrifugation method (
10). Swarmer
cells
were collected and allowed to proceed through the cell cycle in
fresh M2G medium at 30°C. At 15-min intervals, 1-ml culture samples
were labeled with 15 µCi of [
35S]methionine
(Trans-Label) for 5 min, collected by centrifugation,
and frozen at

20°C. Cells were lysed in wash buffer (50 mM Tris,
pH 8.3-450 mM
NaCl-0.5% Triton X-100). A small volume of each
sample was
precipitated with 10% trichloroacetic acid, collected
on glass fiber
filters, and counted in a scintillation counter
cocktail. Equivalent
counts of radiolabeled protein were then
immunoprecipitated with an
antiflagellin antibody (an internal
control for the cell cycle) and an
anti-

-galactosidase antibody
(Boehringer Mannheim). The samples were
processed as described
previously (
14).
Pole-specific expression was measured as described previously
(
34). Synchronized swarmer cells were allowed to proceed to
the predivisional stage and were pulse-labeled for 10 min with
30 µCi
of [
35S]methionine. Unlabeled methionine (0.1 µM) was
used to chase
the label, and the cells were allowed to divide. The
progeny swarmer
and stalked cells were separated by Ludox density
gradient centrifugation,
and the transcription level from the
hfaA promoter was determined
as described
above.
Nucleotide sequence accession number.
The DNA sequence
of the hfaA gene was submitted to GenBank and has been given
the accession no. AF058792.
 |
RESULTS |
54 is not required for holdfast synthesis or
attachment.
Since the CB2A hfaA gene contains sequences
at nucleotides
24 and
12 (numbered in relation to the transcription
initiation site) that are identical to those recognized by the
54-RNA polymerase holoenzyme (16), we
expected a strain that lacks
54 (such as an
rpoN::Tn5 mutant) to display the
holdfast-shedding phenotype seen in the
hfaAB::Tn5 mutant. To determine if this was the case, we labeled the holdfast in an
rpoN::Tn5 mutant, SU213, with
FITC-lectin. The wheat germ agglutinin lectin binds specifically to the
holdfast, and its conjugation to FITC allows its visualization by
epifluorescence microscopy (20). We assayed for the presence
of the holdfast and quantitated this labeling in the wild-type strains
CB15 and CB2A. Wild-type CB15, which forms rosettes and contains a
normal holdfast, showed spots of FITC-lectin attached to the stalks in
stalked cells and predivisional cells (Fig. 1A and
B). No fluorescent labeling was seen in
NA1000, a strain that lacks a holdfast, indicating that the background level of fluorescence from this technique is very low (Fig. 1C). Figure
1D shows labeling of the holdfast material in CB2AG9, an hfaAB::Tn5 mutant, which synthesizes a
normal holdfast but sheds it into the medium (23). This shed
holdfast was labeled, as indicated by the FITC-conjugated lectin spots
which are not associated with cells. Only 10% of the predivisional
cells in CB2AG9 were labeled, indicating that most of the predivisional
cells had shed their holdfasts (Table 2).
In the rpoN::Tn5 mutant, 75% of the predivisional cells were labeled with fluorescent lectin (Fig. 1E;
Table 2). This is comparable to the percentages of predivisional cells
labeled by FITC-lectin in the C. crescentus wild-type
strains CB15 and CB2A (Table 2). In addition, shed holdfasts were not detected in the culture medium of the
rpoN::Tn5 mutant. This suggests that
54 is not required for hfaA expression. It is
also possible that two promoters drive the expression of
hfaA and only one of them is
54 dependent or
that CB15 hfaA is regulated differently than CB2A hfaA. Alternatively, shedding may not occur efficiently in
the stalkless rpoN mutant, because the holdfast is not
subject to the same shearing force as when it is at the tips of stalks
in wild-type cells.

View larger version (108K):
[in this window]
[in a new window]
|
FIG. 1.
Fluorescein-conjugated lectin labeling of the holdfast
in various strains of C. crescentus. Micrographs were taken
in combined fluorescence and phase-contrast modes of wild-type CB15 (A
and B), NA1000 (lacking a holdfast) (C), holdfast-shedding mutant
CB2AG9 (D), SU213 (rpoN::Tn5) (E), and
SC1117 (flgH::Tn5) (F). The arrows
indicate swarmer cells and the swarmer poles of predivisional cells.
|
|
Identification of hfaA from C. crescentus
CB15.
To determine whether hfaA from CB15 had
regulatory sequences similar to those of the CB2A hfaA gene,
we cloned hfaA from CB15 (see Materials and Methods).
Analysis of the nucleotide sequence of the CB15 hfaA gene
indicated that it was 98% identical to the CB2A hfaA gene,
while the predicted product of CB15 hfaA (GenBank accession
no. AF058792) is 95% identical to that of CB2A HfaA. Only 3 nucleotides differed between CB15 and CB2A in the 200 bp upstream of
the transcription start site (Fig. 2).
This is consistent with previous evidence which revealed that the
freshwater C. crescentus strains CB15 and CB2A are highly
similar (32). The high degree of identity between the CB15
and CB2A hfaA regulatory sequences makes it unlikely that
the CB15 and CB2A hfaA genes are regulated differently;
therefore, we studied the regulation of the CB2A hfaA
promoter in CB15.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 2.
Sequence of the hfaA promoter region in CB2A
and CB15. Positions where the CB15 hfaA promoter sequence
differs are shown above the sequence. Inverted repeat sequences are
shown by inverted horizontal arrows. The 5' endpoints of plasmids pRJ52
and pRJ54, used for deletion analysis, are indicated. The transcription
initiation site (+1), as mapped previously (16), is
indicated by the bent arrow; the translation initiation codon is boxed,
and the nucleotides are numbered relative to the transcription start
site. The putative Shine-Dalgarno sequence is underlined.
|
|
The hfaA gene is not transcribed by a
54
promoter.
The presence of a promoter proximal to hfaA
was previously suggested by complementation and S1 mapping studies
(16). To confirm the presence of a promoter for
hfaA in this region, a 325-bp fragment containing the
putative CB2A hfaA promoter and the first 30 codons of
hfaA was cloned upstream of a promoterless lacZ
gene to generate a transcriptional fusion. This fusion (pRJ38 [Table
3]) yielded approximately 2,500 Miller
units of
-galactosidase activity in both CB15 (wild type) and NA1000
(a synchronizable derivative of CB15). Deleting sequences upstream of
nucleotide
117 (pRJ52) reduced transcriptional activity to 1,090 Miller units. Removing bases upstream of nucleotide
52 (pRJ54)
completely abolished transcription (Table
4). Thus, essential promoter elements are
present upstream of nucleotide
52, and sequences sufficient for
promoter activity are present downstream of nucleotide
117.
To determine if the transcription of the
hfaA gene is
controlled by a
54 promoter, we studied its expression
in an
rpoN null mutant. When
the pRJ38
hfaA-lacZ
fusion was introduced into SU213, a strain
that lacks
54, it produced 3,400 Miller units of

-galactosidase
activity (Table
3). Similarly, transcription of the pRJ52 fusion was
approximately
1.5-fold higher in the
rpoN mutant. These
results demonstrate
that
54 is not required for promoter
activity in the 325-bp fragment
of
hfaA. The increase in

-galactosidase activity of the
hfaA-lacZ fusion in the
rpoN::Tn
5 mutant suggests that
54 or a
54-dependent gene has a negative
effect on
hfaA transcription. The
same effect of an
rpoN mutation on
hfaA transcription was observed
with an
hfaA-lacZ transcriptional fusion integrated at the
hfaA locus. The structure of the integrations is shown in
Fig.
3A.
The chromosomal
hfaA-lacZ fusion produced 1,230 Miller units of

-galactosidase activity in CB15 (YB1369 [Table
3]) and 2,350
Miller units in the
rpoN::Tn
5 mutant
(YB1370 [Table
3]).

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 3.
Cell cycle expression of the hfaA promoter.
(A) The construct pRJ38, containing the hfaA promoter fused
to a promoterless lacZ gene, is shown, and the relevant
restriction sites are indicated (P, PstI; C,
ClaI). The bent arrow indicates the position of the
promoter. A diagram of the integrated hfaA-lacZ
transcriptional fusion in YB1371 is also shown. The hatched box
represents hfaA, and the black box represents
lacZ. The plasmid sequences are represented by dashed lines,
while the bent arrow indicates the location of the promoter driving
hfaA. Integration of the fusion plasmid restores a wild-type
hfaA gene downstream of the promoter. (B) Graph of the cell
cycle expression of plasmid-borne hfaA ( ) and the 25-kDa
flagellin protein ( ), compared to the temporal transcription of
chromosomal hfaA ( ). The gel corresponding to the
autoradiographs shown in panel C was quantitated by phosphorimaging,
and the intensities of the bands were plotted as the percentages of the
maximal intensity for the band corresponding to each protein. The time
of division was 150 min, which is represented as 1 cell division unit.
Each synchrony experiment was repeated twice with similar results. (C)
Immunoprecipitation of -galactosidase and flagellins from the strain
containing pRJ38 throughout the cell cycle. The progression through the
cell cycle is shown above the autoradiograph.
|
|
We determined that the effect of the
rpoN::Tn
5 mutation on
hfaA
transcription was not due to polar effects on downstream genes.
The
transcription of the
hfaA-lacZ fusion was assayed in ORF208,
ORF203, and ORF159 mutants (
14). In both the ORF208 and
ORF203
mutant backgrounds, the expression of
hfaA was
comparable to that
in wild-type cells, whereas in the ORF159 mutant,
hfaA expression
decreased by 30% (Table
3). This result is
similar to what is
observed with the expression of the
54-dependent flagellar gene
fljK in these
mutant backgrounds (
14).
Since the expression of
hfaA is not increased in any of these
mutant backgrounds,
the open reading frames downstream of
rpoN do not play a
role in the
54-mediated repression of the
hfaA promoter. These results indicate
that
rpoN
acts genetically like a negative regulator of
hfaA transcription.
Cell cycle and compartment-specific expression of hfaA.
We used a transcriptional fusion of the hfaA promoter to
lacZ to analyze the cell cycle transcription of
hfaA (Fig. 3). Swarmer cells were isolated by Ludox density
gradient centrifugation from a mixed culture of NA1000 cells harboring
pRJ38. These swarmer cells were allowed to proceed synchronously
through the cell cycle. At 15-min intervals, samples of the culture
were pulse-labeled with [35S]methionine and cell extracts
were immunoprecipitated with antiflagellin and anti-
-galactosidase
antibodies. Figure 3C shows the results of this immunoprecipitation
after the samples had been subjected to sodium dodecyl
sulfate-polyacrylamide gel electrophoresis and autoradiography. The
synthesis of
-galactosidase was at a low level for the first half of
the cell cycle, after which it increased approximately 10-fold (Fig.
3B). The peak level of expression from the hfaA promoter
occurred at the predivisional cell stage coincident with the increase
in flagellin expression. The expression from this promoter then
decreased as the cells divided. This demonstrates that the
transcription of hfaA is temporally controlled in C. crescentus, with the maximal level of expression occurring in the
predivisional cells.
We also analyzed the temporal control of
hfaA transcription
in the NA1000::
hfaA-lacZ integration strain,
YB1371. In this strain,
the
lacZ gene is transcribed from
the
hfaA promoter in the 325-bp
fragment and any upstream
promoter(s) (Fig.
3A). The transcription
of
hfaA was assayed
in synchronized cells as described above.
As indicated in Fig.
3B, the
cell cycle expression of
hfaA is
similar whether it is
measured by using a plasmid-borne or a chromosomal
fusion.
The swarmer and stalked compartments of the predivisional cell differ
not only in morphology but also in their programs of
gene expression.
Because a holdfast is already present at the
stalked pole,
hfaA expression may not be required in the stalked
compartment of the predivisional cell. To determine in which pole
of
the predivisional cell
hfaA is transcribed, NA1000 cells
containing
the
hfaA-lacZ fusion were synchronized, and the
swarmer cells
were allowed to proceed to the late-predivisional cell
stage.
At this stage, proteins were pulse- labeled for 10 min with
[
35S]methionine and then chased with an excess of
nonradioactive
methionine (Fig.
4). The
cells were allowed to divide, and progeny
cells were isolated. Cell
extracts were immunoprecipitated with
antiflagellin and
anti-

-galactosidase antibodies and subjected
to sodium dodecyl
sulfate-polyacrylamide gel electrophoresis and
autoradiography. In this
experiment, the amounts of labeled

-galactosidase
in the swarmer and
stalked cell fractions reflect the rate of
transcription of
hfaA from its promoter in the swarmer or stalked
compartment
of the predivisional cell (
11). As seen in Fig.
4, the
transcription of
hfaA occurred preferentially in the swarmer
pole of the predivisional cell.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 4.
Cell type-specific expression of hfaA. The
transcriptional fusion containing the hfaA promoter region
(pRJ38) is shown in Fig. 3A. Cells containing pRJ38 were synchronized,
and the swarmer cells were allowed to proceed to the late-predivisional
stage (135 min). Proteins were labeled with
[35S]methionine for 10 min and then chased with unlabeled
methionine as shown. After division, the stalked (St) and swarmer (Sw)
cells were separated by density gradient centrifugation and then
processed as shown in Fig. 3. The autoradiograph of immunoprecipitated
-galactosidase and flagellin proteins is shown. This experiment was
repeated twice with reproducible results.
|
|
The holdfast is not detectable in swarmer cells.
The ability
of the swarmer poles of predivisional cells to attach to surfaces
has suggested that the holdfast first appears at the base of the
flagellum at the swarmer pole of the predivisional cell (25,
26). To determine if the holdfast is present at the swarmer pole,
we used FITC-lectin to label the holdfast in various strains.
Approximately 80% of the predivisional cells were labeled in the
C. crescentus strains CB15 (Fig. 1A and B) and CB2A (data
not shown), with labeling always occurring at the stalked pole (Table
2). Thus, lectin binds very efficiently to the stalked pole of the
predivisional cell. In hundreds of predivisional cells examined in many
cell cultures, we never observed FITC-lectin labeling at the swarmer
pole of the predivisional cell (Fig. 1). In addition, we never observed
FITC-lectin labeling of swarmer cells (Fig. 1) but readily observed
labeling at the tips of stalked cells possessing short stalks. To
eliminate the possibility that the fluorescein-conjugated lectin could
not bind a putative holdfast at the flagellated pole of a predivisional
cell because of the flagellum, we labeled the holdfast in a flagellar
mutant (flgH::Tn5 [Table 2 and Fig.
1F]). A total of 79% of the predivisional cells were labeled in the
flgH::Tn5 strain, and the
FITC-conjugated lectin spots were always associated with the stalked
poles of these predivisional cells. No labeling was observed in swarmer cells or at the flagellated poles of predivisional cells (Fig. 1), but
labeling was readily observed at the tips of short stalks. All these
observations are consistent with electron micrographs, in which the
holdfast is clearly visible as an amorphous material at the tips of
stalks but not at the base of the flagellum in predivisional or swarmer
cells (Fig. 5). This suggests that the holdfast appears at the tips of stalks at the time of or shortly after
the initiation of stalk synthesis.

View larger version (126K):
[in this window]
[in a new window]
|
FIG. 5.
The holdfast is visible after the initiation of stalk
synthesis in this transmission electron micrograph of wild-type
C. crescentus (CB15) grown in PYE medium. The holdfast
material is indicated by arrows and is visible as amorphous material at
the tips of stalks.
|
|
 |
DISCUSSION |
The holdfast is important for the attachment of C. crescentus cells to surfaces; however, little is known about the
regulation of holdfast synthesis and holdfast attachment genes during
the cell cycle. Furthermore, the time of holdfast appearance at the pole of the cell is not known. In this paper, we investigate two aspects of holdfast synthesis: the transcription of a holdfast attachment gene, hfaA, and the appearance of the holdfast at
the pole of the cell. We demonstrate that hfaA transcription
is temporally controlled during the cell cycle, with maximal
transcription in the swarmer pole of the predivisional cell. We show
that the holdfast is not present in swarmer cells or at the swarmer
poles of predivisional cells. Our results suggest that the holdfast
appears during the differentiation of swarmer to stalked cells.
The hfaA gene possesses a
54 promoter
sequence at the requisite distance from the transcription start site
(16). However, our results indicate that hfaA is
not transcribed by a
54-dependent promoter.
hfaA is still transcribed in a
54 null
mutant, and lectin labeling of the holdfast in an
rpoN::Tn5 mutant demonstrates that
54 is not required for holdfast attachment. It is
possible that hfaA is transcribed by the
54-RNA polymerase holoenzyme under certain conditions
that are as yet unknown. Surprisingly, our data indicates that
54 or a
54-dependent event has a negative
effect on the transcription of hfaA. The ability of
54 to bind to certain promoters in the absence of core
polymerase (7) raises the possibility that
54
itself could bind to the sequences at nucleotides
24 and
12 of the
hfaA promoter and repress the transcription of
hfaA. A similar case that has recently been found is the
Bradyrhizobium japonicum fixRnifA promoter that contains two
overlapping promoters: one that is
54 dependent and one
that is dependent on a second unidentified form of RNA polymerase
(4). Alternatively, the increase in hfaA
transcription in the rpoN mutant could be an indirect
consequence of the pleiotropic phenotype of rpoN mutants.
The fact that some of the rpoN mutant cells have a holdfast
at both poles suggests that rpoN mutants have an increased
level of holdfast synthesis (Fig. 1E).
Using an hfaA-lacZ fusion integrated at the hfaA
locus, we were able to show that the transcription of hfaA
is temporally regulated during the cell cycle, with maximal levels of
transcription occurring in predivisional cells. Because the holdfast
does not seem to appear until the differentiation of the swarmer cell
during the next cell cycle (see below), the reason for the preferential transcription of hfaA in the swarmer compartment of the
predivisional cell is unclear. This burst in hfaA
transcription may serve to load hfaA mRNA or HfaA itself in
the swarmer compartment prior to the beginning of the next cell cycle.
This would ensure that the holdfast attachment protein is present in
the swarmer cell, ready to be used when the swarmer cell differentiates
into a stalked cell.
Previous observations that the swarmer poles of predivisional cells can
attach to surfaces suggested that the holdfast first appears at the
flagellated poles of predivisional cells (25, 26). Electron
micrographs fail to reveal the presence of a holdfast at the base of
the flagellum, whereas it is clearly visible at the tips of short
stalks. In our studies, we were unable to detect any binding of
fluorescent lectin to swarmer cells or to the flagellated poles of
predivisional cells, whereas the binding of lectin to stalked cells and
to the stalked poles of predivisional cells was very efficient. Our
failure to detect any binding of fluorescent lectin at the swarmer pole
is not due to the presence of the flagellum, because we could not
detect any binding to the swarmer pole in a flagellar mutant. These
results suggest that the exposure of the holdfast to the outside of the
cell occurs during the differentiation of swarmer to stalked cells. In
addition to a single flagellum, the swarmer pole contains pili
(30). Pili are involved in mediating attachment to surfaces
in many bacteria (13) and have also been implicated in
promoting the primary adhesion event in Hyphomonas, another
prosthecate bacterium (27). Thus, perhaps the attachment of
the swarmer pole of C. crescentus to surfaces is mediated by the pilus and not the holdfast. This is consistent with the observation that swarmer cells collide and stick more frequently to glass surfaces
than nonmotile stalked and dividing cells (24). Based on our
findings, we suggest that the holdfast is either not present or not
accessible at the swarmer poles of predivisional cells and that other
adhesive components of that pole, perhaps pili, facilitate its
attachment to surfaces.
 |
ACKNOWLEDGMENTS |
We are particularly grateful to John Smit for generously
providing many clones and strains and for helpful discussions. We thank
Anahita Amiri for constructing pAA2 and members of the Brun lab for
helpful suggestions on the manuscript.
This work was supported by National Institutes of Health predoctoral
fellowship GM07757 (to R.S.J.) and National Institutes of Health grant
GM51986 (to Y.V.B.).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biology, JH142, Indiana University, Bloomington, IN 47405-6801. Phone: (812) 855-8860. Fax: (812) 855-6705. E-mail:
ybrun{at}bio.indiana.edu.
 |
REFERENCES |
| 1.
|
Alley, M. R. K.,
S. L. Gomes,
W. Alexander, and L. Shapiro.
1991.
Genetic analysis of a temporally transcribed chemotaxis gene cluster in Caulobacter crescentus.
Genetics
129:333-342[Abstract].
|
| 2.
|
Altin-Mees, M. A., and J. M. Short.
1989.
pBluescript II: gene mapping vectors.
Nucleic Acids Res.
17:9494[Free Full Text].
|
| 3.
|
Ausubel, F. M.,
R. Brent,
R. E. Kingston,
D. D. Moore,
J. G. Seidman,
J. A. Smith, and K. Struhl.
1989.
Current protocols in molecular biology.
John Wiley/Greene, New York, N.Y.
|
| 4.
|
Barrios, H.,
R. Grande,
L. Olvera, and E. Morett.
1998.
In vivo footprinting analysis reveals that the complex Bradyrhizobium japonicum fixRnifA promoter region is differently occupied by two distinct RNA polymerase holoenzymes.
Proc. Natl. Acad. Sci. USA
95:1014-1019[Abstract/Free Full Text].
|
| 5.
|
Brun, Y.,
G. Marczynski, and L. Shapiro.
1994.
The expression of asymmetry during cell differentiation.
Annu. Rev. Biochem.
63:419-450[Medline].
|
| 6.
|
Brun, Y. V., and L. Shapiro.
1992.
A temporally controlled sigma factor is required for cell-cycle dependent polar morphogenesis in Caulobacter.
Genes Dev.
6:2395-2408[Abstract/Free Full Text].
|
| 7.
|
Buck, M., and W. Cannon.
1992.
Specific binding of the transcription factor sigma-54 to promoter DNA.
Nature
358:422-424[Medline].
|
| 8.
|
Devereux, D.,
P. Haeberli, and O. Smithies.
1984.
A comprehensive set of sequence analysis programs for the VAX.
Nucleic Acids Res.
12:387-395.
|
| 9.
|
Ely, B., and T. W. Ely.
1989.
Use of pulsed field gel electrophoresis and transposon mutagenesis to estimate the minimal number of genes required for motility in Caulobacter crescentus.
Genetics
123:649-654[Abstract/Free Full Text].
|
| 10.
|
Evinger, M., and N. Agabian.
1977.
Envelope-associated nucleoid from Caulobacter crescentus stalked and swarmer cells.
J. Bacteriol.
132:294-301[Abstract/Free Full Text].
|
| 11.
|
Gober, J. W.,
R. Champer,
S. Reuter, and L. Shapiro.
1991.
Expression of positional information during cell differentiation in Caulobacter.
Cell
64:381-391[Medline].
|
| 12.
|
Gober, J. W., and L. Shapiro.
1992.
A developmentally regulated Caulobacter flagellar promoter is activated by 3' enhancer and IHF binding elements.
Mol. Biol. Cell
3:913-926[Abstract].
|
| 13.
|
Hultgren, S. J.,
S. Abraham,
M. Caparon,
P. Falk,
J. St. Geme III, and S. Normark.
1993.
Pilus and nonpilus bacterial adhesins: assembly and function in cell recognition.
Cell
73:887-901[Medline].
|
| 14.
|
Janakiraman, R. S., and Y. V. Brun.
1997.
Transcriptional and mutational analyses of the rpoN operon in Caulobacter crescentus.
J. Bacteriol.
179:5138-5147[Abstract/Free Full Text].
|
| 15.
|
Johnson, R. C., and B. Ely.
1977.
Isolation of spontaneously derived mutants of Caulobacter crescentus.
Genetics
86:25-32[Abstract/Free Full Text].
|
| 16.
|
Kurtz, H. D., Jr., and J. Smit.
1992.
Analysis of a Caulobacter crescentus gene cluster involved in attachment of the holdfast to the cell.
J. Bacteriol.
174:687-694[Abstract/Free Full Text].
|
| 17.
|
Kurtz, H. D., Jr., and J. Smit.
1994.
The Caulobacter crescentus holdfast: identification of holdfast attachment complex genes.
FEMS Microbiol. Lett.
116:175-182[Medline].
|
| 18.
|
Liss, L. R.
1987.
New M13 host: DH5 F' competent cells.
Focus
9:3-13.
|
| 19.
|
Marsh, J. L.,
M. Erfle, and E. J. Wykes.
1984.
The pIC plasmid and phage vectors with versatile cloning sites for recombinant selection by insertional inactivation.
Gene
32:481-485[Medline].
|
| 20.
|
Merker, R. I., and J. Smit.
1988.
Characterization of the adhesive holdfast of marine and freshwater caulobacters.
Appl. Environ. Microbiol.
54:2078-2085[Abstract/Free Full Text].
|
| 21.
|
Merrick, M. J.
1993.
In a class of its own the RNA polymerase sigma factor sigma 54 (sigma N).
Mol. Microbiol.
10:903-909[Medline].
|
| 22.
|
Miller, J. H.
1972.
Experiments in molecular genetics, p. 352-355.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 23.
|
Mitchell, D., and J. Smit.
1990.
Identification of genes affecting production of the adhesion organelle of Caulobacter crescentus CB2.
J. Bacteriol.
172:5425-5431[Abstract/Free Full Text].
|
| 24.
|
Newton, A.
1972.
Role of transcription in the temporal control of development in Caulobacter crescentus.
Proc. Natl. Acad. Sci. USA
69:447-451[Abstract/Free Full Text].
|
| 25.
|
Poindexter, J. S.
1964.
Biological properties and classification of the Caulobacter group.
Bacteriol. Rev.
28:231-295[Free Full Text].
|
| 26.
|
Poindexter, J. S.
1981.
The caulobacters: ubiquitous unusual bacteria.
Microbiol. Rev.
45:123-179[Free Full Text].
|
| 27.
|
Quintero, E. J.,
K. Busch, and R. M. Weiner.
1998.
Spatial and temporal deposition of adhesive extracellular polysaccharide capsule and fimbriae by Hyphomonas strain MHS-3.
Appl. Environ. Microbiol.
64:1246-1255[Abstract/Free Full Text].
|
| 28.
|
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467[Abstract/Free Full Text].
|
| 29.
|
Simon, R.,
U. Prieffer, and A. Puhler.
1983.
A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in gram negative bacteria.
Biotechnology
1:784-790.
|
| 30.
|
Smit, J.
1987.
Localizing the subunit pool for the temporally regulated polar pili of Caulobacter crescentus.
J. Cell Biol.
105:1821-1828[Abstract/Free Full Text].
|
| 31.
|
Smit, J., and N. Agabian.
1984.
Cloning of the major protein of the Caulobacter crescentus periodic surface layer: detection and characterization of the cloned peptide by protein expression assays.
J. Bacteriol.
160:1137-1145[Abstract/Free Full Text].
|
| 32.
|
Stahl, D. A.,
R. Key,
B. Flesher, and J. Smit.
1992.
The phylogeny of marine and freshwater caulobacters reflects their habitat.
J. Bacteriol.
174:2193-2198[Abstract/Free Full Text].
|
| 33.
|
Umbreit, T. H., and J. L. Pate.
1978.
Characterization of the holdfast region of wild-type cells and holdfast mutants of Asticcacaulis biprosthecum.
Arch. Microbiol.
118:157-168.
|
| 34.
|
Wingrove, J. A.,
E. K. Mangan, and J. W. Gober.
1993.
Spatial and temporal phosphorylation of a transcriptional activator regulates pole-specific gene expression in Caulobacter.
Genes Dev.
7:1979-1992[Abstract/Free Full Text].
|
| 35.
|
Yanisch-Perron, C.,
J. Vieira, and J. Messing.
1985.
Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors.
Gene
33:103-119[Medline].
|
Journal of Bacteriology, February 1999, p. 1118-1125, Vol. 181, No. 4
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Karatan, E., Watnick, P.
(2009). Signals, Regulatory Networks, and Materials That Build and Break Bacterial Biofilms. Microbiol. Mol. Biol. Rev.
73: 310-347
[Abstract]
[Full Text]
-
Toh, E., Kurtz, H. D. Jr., Brun, Y. V.
(2008). Characterization of the Caulobacter crescentus Holdfast Polysaccharide Biosynthesis Pathway Reveals Significant Redundancy in the Initiating Glycosyltransferase and Polymerase Steps. J. Bacteriol.
190: 7219-7231
[Abstract]
[Full Text]
-
Levi, A., Jenal, U.
(2006). Holdfast Formation in Motile Swarmer Cells Optimizes Surface Attachment during Caulobacter crescentus Development.. J. Bacteriol.
188: 5315-5318
[Abstract]
[Full Text]
-
Pierce, D. L., O'Donnol, D. S., Allen, R. C., Javens, J. W., Quardokus, E. M., Brun, Y. V.
(2006). Mutations in DivL and CckA Rescue a divJ Null Mutant of Caulobacter crescentus by Reducing the Activity of CtrA.. J. Bacteriol.
188: 2473-2482
[Abstract]
[Full Text]
-
Li, G., Smith, C. S., Brun, Y. V., Tang, J. X.
(2005). The Elastic Properties of the Caulobacter crescentus Adhesive Holdfast Are Dependent on Oligomers of N-Acetylglucosamine. J. Bacteriol.
187: 257-265
[Abstract]
[Full Text]
-
Entcheva-Dimitrov, P., Spormann, A. M.
(2004). Dynamics and Control of Biofilms of the Oligotrophic Bacterium Caulobacter crescentus. J. Bacteriol.
186: 8254-8266
[Abstract]
[Full Text]
-
Bodenmiller, D., Toh, E., Brun, Y. V.
(2004). Development of Surface Adhesion in Caulobacter crescentus. J. Bacteriol.
186: 1438-1447
[Abstract]
[Full Text]
-
Smith, C. S., Hinz, A., Bodenmiller, D., Larson, D. E., Brun, Y. V.
(2003). Identification of Genes Required for Synthesis of the Adhesive Holdfast in Caulobacter crescentus. J. Bacteriol.
185: 1432-1442
[Abstract]
[Full Text]
-
Viollier, P. H., Sternheim, N., Shapiro, L.
(2002). Identification of a localization factor for the polar positioning of bacterial structural and regulatory proteins. Proc. Natl. Acad. Sci. USA
99: 13831-13836
[Abstract]
[Full Text]