Previous Article | Next Article 
Journal of Bacteriology, February 1999, p. 1141-1148, Vol. 181, No. 4
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Expression and Study of Recombinant ExoM, a
1-4
Glucosyltransferase Involved in Succinoglycan Biosynthesis in
Sinorhizobium meliloti
Annemarie C.
Lellouch* and
Roberto A.
Geremia
Centre de Recherches sur les
Macromolécules Végétales, CNRS, and Joseph Fourier
University, F38041 Grenoble, France
Received 22 September 1998/Accepted 11 December 1998
 |
ABSTRACT |
Here we report on the overexpression and in vitro characterization
of a recombinant form of ExoM, a putative
1-4 glucosyltransferase involved in the assembly of the octasaccharide repeating subunit of
succinoglycan from Sinorhizobium meliloti. The open reading frame exoM was isolated by PCR and subcloned into the
expression vector pET29b, allowing inducible expression under the
control of the T7 promoter. Escherichia coli
BL21(DE3)/pLysS containing exoM expressed a novel 38-kDa
protein corresponding to ExoM in N-terminal fusion with the S-tag
peptide. Cell fractionation studies showed that the protein is
expressed in E. coli as a membrane-bound protein in
agreement with the presence of a predicted C-terminal transmembrane
region. E. coli membrane preparations containing ExoM were
shown to be capable of transferring glucose from UDP-glucose to
glycolipid extracts from an S. meliloti mutant strain which accumulates the ExoM substrate
(Glc
1-4Glc
1-3Gal-pyrophosphate-polyprenol). Thin-layer
chromatography of the glycosidic portion of the ExoM product showed
that the oligosaccharide formed comigrates with an authentic standard.
The oligosaccharide produced by the recombinant ExoM, but not the
starting substrate, was sensitive to cleavage with a specific
cellobiohydrolase, consistent with the formation of a
1-4 glucosidic
linkage. No evidence for the transfer of multiple glucose residues to
the glycolipid substrate was observed. It was also found that ExoM does
not transfer glucose to an acceptor substrate that has been hydrolyzed
from the polyprenol anchor. Furthermore, neither glucose, cellobiose,
nor the trisaccharide Glc
1-4Glc
1-3Glc inhibited the transferase
activity, suggesting that some feature of the lipid anchor is necessary
for activity.
 |
INTRODUCTION |
Rhizobial succinoglycan or
exopolysaccharide I has been shown to play an important role in the
symbiotic relationship between the nitrogen-fixing bacterium
Sinorhizobium meliloti (formerly known as Rhizobium
meliloti) and its plant host, alfalfa (Medicago sativa)
(17, 18, 30). Recent elegant studies employing
succinoglycan-deficient strains of S. meliloti expressing
green fluorescent protein have shown that succinoglycan is required for
the formation of extended infection threads in the root hairs that
would otherwise allow the bacteria to populate the root nodule
(8). In addition to its role in symbiosis, the
physicochemical properties of succinoglycan have led to its use as a
gelling agent in certain industrial applications (13).
Like other bacterial exopolysaccharides, such as xanthan gum from
Xanthomonas campestris and acetan from Acetobacter
xylinum, succinoglycan is synthesized by the polymerization of an
oligosaccharide subunit that has been assembled upon a polyprenyl
pyrophosphate anchor (14, 27). This mechanism is similar to
that observed in the biosynthesis of the O-antigen portion of many
lipopolysaccharides and of some capsular polysaccharides of
gram-negative bacteria (33). The assembly of the
oligosaccharide unit of repetition is a key feature in the biosynthesis
of cell surface-associated polysaccharides.
Succinoglycan secreted by S. meliloti is a polymer of an
octasaccharide subunit, which is in turn comprised of one residue of
galactose and seven residues of glucose, joined in either
1-4,
1-3, or
1-6 glycosidic linkages (Fig.
1A) (22). Each octasaccharide is specifically replaced by one group each of acetate, succinate, and
pyruvate. The subunits are joined via a
1-4 linkage from the first
to the fourth residue, resulting in a branched, acidic polysaccharide.
Succinoglycan is found in two forms, a high-molecular-weight form of
fairly uniform molecular-mass distribution ranging from 106
to 107 Da and a low-molecular-weight form consisting of
monomers, dimers, and trimers of the octasaccharide subunit (11,
12). Several studies suggest that the low-molecular-weight form
is required for the invasion of the root nodules (2, 29).

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 1.
(A) Structure of the octasaccharide repeat unit of
succinoglycan with the point of ExoM activity indicated. (B) Reaction
catalyzed by ExoM, with the site of cellobiohydrolase II cleavage
indicated.
|
|
At least 26 genes are known to be involved in the biosynthetic pathway
of succinoglycan in S. meliloti 1021 (3-5, 9, 10, 19,
21), the majority of which are located in a single cluster (exo cluster) on one of two symbiotic megaplasmids (pSym
II). Studies of the biosynthetic intermediates produced by S. meliloti mutant strains and sequence similarities to other gene
products known to be involved in bacterial polysaccharide biosynthesis have allowed the assignment of putative activities to 11 gene products
in the cluster, whose activity is required for the production of the
fully substituted lipid-linked octasaccharide (24). The presence of both exoF and exoY is necessary for
the initial transfer of galactose-1-phosphate from UDP-galactose
(UDP-Gal) to polyprenyl-phosphate (24). Six putative
glucosyltransferases encoded by exoA, exoL, exoM, exoO, exoU, and exoW
are then thought to be responsible for the sequential transfer of the
remaining seven residues from UDP-glucose (UDP-Glc) to the growing
lipid-linked oligosaccharide (9, 24). As no mutants
producing lipid-linked heptasaccharides have been isolated and no other
genes resembling those that encode the glycosyltransferases have been
identified in the exo cluster, it has been proposed that
ExoW may be responsible for the addition of the two terminal
1-3-linked glucose residues of the octasaccharide (18).
Three putative glycosyl-modifying enzymes (ExoZ, an
acetyltransferase; ExoH, a succinyl transerase; and ExoV, a
pyruvyl transferase) act during the assembly of the oligosaccharide,
before the completed octasaccharide is polymerized (10,
24). TnphoA fusion studies of the relevant gene
products and the obligatory presence of nucleotide sugars support the
idea that the oligosaccharide subunit is biosynthesized on the
cytoplasmic face of the inner cell wall membrane (9, 23).
The Exo glucosyltransferases are functionally similar to one another in
that each presumably employs a UDP-Glc sugar donor to catalyze the
formation of a
-glycosidic linkage to a glucose residue (except
ExoA, which transfers to galactose), albeit with different
regiospecificities, i.e.,
1-3 for ExoA and ExoW,
1-4 for ExoM and
ExoL, and
1-6 for ExoO and ExoU. However, these enzymes (except
ExoL) have significant similarity only within an N-terminal
100-amino-acid region (domain A) which includes three highly conserved
aspartic acid residues (25). Two of these conserved Asp
residues (DXD motif) are also found in a number of other prokaryotic
and eukaryotic glycosyltransferases and in polysaccharide synthases
which employ nucleotide sugars to transfer hexoses such as
galactose, mannose, N-acetylglucosamine,
N-acetylgalactosamine, or
N-acetylmannosamine to a variety of different carbohydrate, protein, or steroid acceptors (6, 15, 34). Recent studies of
the glucosyltransferase domain of a large clostridial cytotoxin suggest
that both of the aspartic acid residues of the conserved DXD motif may
be involved in nucleotide sugar and/or divalent cation binding
(7). Therefore, despite their functional similarities, it is
not evident which feature of each of the Exo glucosyltransferases determines their nucleotide sugar donor usage, their acceptor specificity, and the regio- and stereospecificity of each glycosidic bond formed. The expression of recombinant forms of the Exo
glucosyltransferases and the verification of their putative activities
in vitro are the first steps towards functional and structural studies
which may resolve such questions. Here we report on the overexpression in Escherichia coli and subsequent study in vitro of a
recombinant form of ExoM. Our studies demonstrate that ExoM is a
nonprocessive glucosyltransferase responsible for the addition of the
fourth residue of the polyprenol-anchored octasaccharide subunit, most likely in a
1-4 linkage (Fig. 1B).
 |
MATERIALS AND METHODS |
Materials, culture conditions, and bacterial strains.
See
Table 1 for descriptions of plasmids and
genotypes of all strains employed. All cloning work was performed in
E. coli XL1-Blue cells. Recombinant proteins were expressed
in E. coli BL21(DE3)/pLysS. E. coli was grown in
Luria-Bertani (LB) medium at 37°C. S. meliloti was grown
in LB medium with 2.5 mM MgSO4 and 2.5 mM CaCl2
at 30°C. Antibiotics were used at the following concentrations:
kanamycin, 30 µg/ml; chloramphenicol, 34 µg/ml; neomycin, 200 µg/ml; gentamicin, 20 µg/ml; spectinomycin, 50 µg/ml; and
trimethoprim, 500 µg/ml. Oligonucleotide primers for PCR were purchased from Oligoexpress (Paris, France). Blunting and ligations were performed with the kits from Amersham France (Les Ulis, France). Pfu polymerase was from Stratagene (La Jolla, Calif.), and
all other enzymes used for molecular biology were purchased from New England Biolabs (Beverly, Mass.). 14C-labeled nucleotide
sugars were obtained from Amersham. The pET29b expression vector and
S-tag Western blotting kit were from Novagen (Madison, Wis.).
Recombinant cellobiohydrolase II of Humicola insolens was a
gift from M. Schülein. Glc
1-4Glc
1-3Gal was a gift from
Hugues Driguez. Protein concentrations were determined by the Bio-Rad
DC assay. Analytical-grade solvents were used, unless noted otherwise.
Isolation and subcloning of exoM.
The 943-bp open
reading frame (ORF) of exoM was amplified by PCR from the
cosmid pEX154 (19). Primers used were
ACTGCAGGTTCATGCCGAGGTCACC and
AGAGCTCCCTAATGCCGAACGAAAC. The underlined
sequences create PstI and SacI restriction sites
at each end of the gene. The desired product was obtained by using the
Pfu polymerase in 35 cycles, with each cycle comprising
45 s of denaturation at 94°C, 1 min of annealing at 58°C, and
2 min of elongation at 72°C. The PCR product was purified from an
agarose gel, subcloned in the EcoRV site of pBluescript
KS(+) to give pLGC1, and subsequently verified by DNA sequencing
(Genome Express SA, Grenoble, France). Cleavage of pLGC1 with
SacI-NotI generated two fragments corresponding to pBluescript and a 984-bp fragment containing the exoM
ORF. The 984-bp fragment was then cloned into the
SacI-NotI sites of the expression vector pET29b
to give pLGC2.
Expression of exoM.
E. coli BL21(DE3)/pLysS
cells were transformed with pLGC2 or with pET29b as a control. Cultures
(50 to 200 ml) were inoculated with 0.5 to 2.0 ml of preculture
prepared overnight. Optimal protein expression was obtained by
induction with 0.4 mM IPTG
(isopropyl-
-D-thiogalactopyranoside) when cultures had
reached an optical density at 600 nm (OD600) of 0.5. Expression of recombinant ExoM was monitored by sodium dodecyl sulfate
(SDS)-12% polyacrylamide gel electrophoresis (PAGE), followed by
staining with Coomassie brilliant blue R250. The presence of the
N-terminal S-tag epitope fusion was confirmed by transfer of an
SDS-12% PAGE gel to a polyvinylidene difluoride membrane and
subsequent treatment with the Novagen S-tag Western blotting kit with
alkaline phosphatase S-protein conjugate per the manufacturer's instructions. For N-terminal sequencing, 20 µg of protein from a
membrane fraction preparation was treated with 0.1 U of thrombin for
2 h at 20°C in the presence of 0.1% SDS to release the S-tag fragment. The protein sample was separated by SDS-PAGE and transferred electrophoretically onto polyvinylidene difluoride membranes, according
to the protocol defined for ProBlott membranes (Applied Biosystems).
Amino acid sequence determination of the digestion product was
performed with a gas-phase sequencer (model 477A; Applied Biosystems).
Phenylthiohydantoin amino acid derivatives were identified and
quantitated on-line with a model 120A high-pressure liquid
chromatography system (Applied Biosystems), as recommended by the
manufacturer (20).
For protein production, cells were harvested 2 h after induction,
washed once with 70 mM Tris-HCl (pH 8), resuspended in 70
mM
Tris-HCl-10 mM EDTA (pH 8.2) at 40 OD equivalents/ml, and passed
through the French press (18,000 lb/in
2) three times.
Unbroken cells and inclusion bodies were recovered
by a 15-min
centrifugation (5,000 ×
g) at 4°C. Membrane
fractions
were recovered from the 5,000 ×
g
supernatant by a 1-h centrifugation
(100,000 ×
g) at
4°C (Beckman, model LE-70, Ti70 centrifuge).
The membrane pellet was
resuspended in a volume of buffer (70
mM Tris-HCl, 10 mM EDTA, pH 8.2)
equivalent to that of the starting
sample, divided into 100-µl
aliquots, and stored at

20°C until
they were used. The stock
membrane fractions were typically 7
to 9 mg of total protein per
ml.
Preparation of rhizobial glycolipid acceptors.
EDTA-permeabilized samples of S. meliloti exoMBR
or exoOBR triple mutants were obtained essentially by the
freeze-thaw method described by Tolmasky et al. (28).
Briefly, 200-ml cultures were harvested at an OD600 of 0.6 to 1.0. Cells were collected, washed once with 70 mM Tris-HCl (pH 8.2),
resuspended in 70 mM Tris-HCl-10 mM EDTA (pH 8.2), and subsequently
subjected to three cycles of freeze-thawing in liquid nitrogen. The
cells were finally stored in 70-µl aliquots at
70°C. To
synthesize the unlabeled glycolipid acceptor, the permeabilized cells
were incubated at 10°C for 30 min in the presence of 0.5 mM UDP-Glc,
0.5 mM UDP-Gal, and 12 mM MgCl2 in a total volume of 100 µl. For the preparation of 14C-labeled acceptor, the
appropriate nucleotide sugar donor was replaced with 0.25 µCi of
UDP-[U-14C]glucose or UDP-[U-14C]galactose
(specific activities of 231 and 261 mCi/mmol, respectively). The
reaction was stopped by the addition of 0.5 ml of ice-cold 70 mM
Tris-HCl-10 mM EDTA (pH 8.2), and washed once with 0.3 ml of 70 mM
Tris-HCl (pH 8.2). The glycolipid acceptors were recovered by two
150-µl extractions with CHCl3:MeOH:H2O at a
ratio of 1:2:0.3. The extract was stored at
20°C until it was used.
Glucosyltransferase assay.
The
CHCl3:MeOH:H2O (1:2:0.3) extract containing the
glycolipid acceptor (either cold or 14C labeled) was dried
to a final volume of approximately 10 µl under a stream of compressed
air immediately prior to use. To the lipid emulsion was added 0.1%
Triton X-100, 12 mM MgCl2, 0.5 mM UDP-Glc, and 50 µl
(~350 µg) of resuspended E. coli membranes to a final
reaction mixture volume of 100 µl. For inhibition studies, glucose,
cellobiose, or the trisaccharide Glc
1-4Glc
1-3Glc was added to the
reaction mixture at a final concentration of 1 mM. The reaction mixture
was incubated for 30 min at 37°C, and the reaction was stopped by the
addition of 100 µl of H2O and 200 µl of
CHCl3:MeOH (1:2). The reaction mixture was mixed vigorously in a Vortex mixer and centrifuged for 3 min, and the aqueous layer was
discarded. The remaining organic and particulate phases were washed
twice with 1 volume of H2O and 0.5 volumes of
CHCl3:MeOH (1:2) to remove any traces of unreacted
nucleotide 14C-sugar. The organic phase was removed and
saved. The particulate phase was extracted twice with 150 µl of
CHCl3:MeOH:H2O (1:2:0.3), and extracts were
pooled with the organic phase. A 1/10 volume of the final organic
extract pool was monitored by liquid scintillation counting. The
remaining organic extract pool was dried on a SpeedVac. The
oligosaccharide was cleaved from the lipid anchor by mild acid
hydrolysis with 200 µl of 0.01 N aqueous trifluoroacetic acid for 10 min at 100°C. The hydrolysate was neutralized with 2 µl of 1 M
NH4OH and treated overnight with 5 U of bovine alkaline phosphatase in the presence of 10 mM glycine-NaOH-10 mM
MgCl2 (pH 9) to remove any remaining sugar-linked
phosphates. The reaction mixture was extracted with 0.5 ml of
CHCl3:MeOH (2:1) to remove the released lipid moiety. The
aqueous phase was desalted over a mixed bed resin. The resin was rinsed
twice with 200 µl of H2O, and the washes were pooled with
the sample. A 1/10 volume was removed for counting. The final sample
was dried on a SpeedVac and resuspended in 10 to 20 µl of
H2O before thin-layer chromatography (TLC).
TLC analysis of products.
Typically 10,000 cpm of each
sample to be analyzed, in 5 to 10 µl of H2O, was applied
to a TLC plate (silica gel 60, 0.25-mm-thick layer of silica gel;
Sigma). One microliter of oligomaltose (50 mg/ml) was applied to each
sample lane as a carrier sugar. Glucose, maltose, and oligomaltose
(dimer to pentamer) were run in adjacent lanes as standards. Plates
were developed twice in 50:20:20
1-propanol:nitromethane:H2O. Standard lanes were separated
from the rest of the plate and revealed by charring after treatment
with 5% H2SO4 in ethanol. The remaining portion of the plate containing the radiolabeled samples was treated with 0.4% PPO (2,5-diphenyloxazole) in 2-methylnaphthalene (Aldrich) to enhance the signal and exposed on photographic film (Amersham) for
24 to 72 h.
Cellobiohydrolase digestion.
One microliter of recombinant
cellobiohydrolase from H. insolens (3 mg/ml) was added to
the released oligosaccharide sample during the overnight phosphatase
treatment. Samples were processed as described above.
 |
RESULTS |
S-tag-ExoM is expressed as a membrane-associated protein in
E. coli.
Rather than purifying ExoM activity from S. meliloti, we overexpressed a recombinant form of ExoM in E. coli. In order to facilitate the detection and eventual
purification of the recombinant product, ExoM was expressed as an
N-terminal fusion with the S-tag epitope. The desired exoM
ORF was amplified by PCR from the cosmid pEX154 containing a 14-kb
fragment of the symbiotic megaplasmid II of S. meliloti 1021 (21). After the full-length amplified product in pLGC1 had
been sequenced, the gene was cloned into the expression vector pET29b
to produce pLGC2. The resulting recombinant protein should consist of
the predicted 309 amino acids with an N-terminal fusion of 36 amino
acids corresponding to the S-tag epitope and a unique thrombin cleavage
site with a total predicted molecular mass of 37.5 kDa. Expression of
recombinant ExoM was monitored by SDS-PAGE (Fig.
2). A significant novel band of
approximately 38 kDa was produced by BL21(DE3)/pLysS cells harboring
pLGC2 1 h after induction. The relative quantity of recombinant
protein appeared to increase up to 3 h after induction but was
significantly diminished after overnight culturing. Protein samples
were prepared from cultures 2 h after induction. The presence of
the S-tag epitope in the new product was confirmed by Western blotting
with the alkaline-phosphatase conjugated S-protein (data not shown).
The identity of the novel product was further confirmed by thrombin digestion of the crude extract and N-terminal sequencing of the subsequent lower-molecular-mass product appearing in the SDS-PAGE. The
sequence determined was in accordance with published results (9).

View larger version (111K):
[in this window]
[in a new window]
|
FIG. 2.
Expression of ExoM. BL21(DE3)/pLysS harboring pET29b
( ) or pLGC2 (+) was cultured as described in Materials and Methods.
Aliquots were removed before ( and 0) or at different times after
IPTG induction (+, 60 min, 120 min, 180 min, and overnight [ON]).
Total cell samples were normalized for cell density and analyzed by
SDS-12% PAGE.
|
|
To investigate the localization of the recombinant protein in
E. coli, crude French press extracts were subjected to a series
of
centrifugations, and the protein composition of each fraction
was
analyzed by SDS-PAGE and Western blotting against the S-tag
epitope
(Fig.
3). Equivalent quantities (~3
µg) of protein from
each fraction were precipitated with
trichloroacetic acid and
used in the analysis. A 5,000 ×
g centrifugation pelleted a protein
fraction very highly enriched
with ExoM, suggesting that some
portion of the recombinant protein is
expressed in the form of
an inclusion body. The ExoM remaining in
solution after the 5,000
×
g centrifugation pelleted
at a 100,000 ×
g centrifugation, suggesting
that as
predicted by the presence of a C-terminal hydrophobic
region, the
recombinant protein is membrane bound (
9). The
recombinant
protein pelleted at high speeds could be solubilized
in detergents such
as 0.5% 3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate
(CHAPS) or 0.1% Triton X-100, as would be expected for a membrane
protein (data not shown). No recombinant protein or enzyme activity
could be detected in the supernatant after the high-speed
centrifugation.
All assays of glycosyltransferase activity were
performed with
the membrane fraction obtained by high-speed
centrifugation.

View larger version (60K):
[in this window]
[in a new window]
|
FIG. 3.
Membrane localization of ExoM. BL21(DE3)/pLysS cells
harboring pET29b ( ) or pLGC2 (+) were cultured, disrupted, and
subjected to 5,000 × g (5K) and 100,000 × g (100K) centrifugations, as described in Materials and Methods.
(A) Coomassie blue-stained SDS-12% PAGE gel of each fraction. (B)
S-protein blot against S-tag epitope of samples of each fraction. SN,
supernatant.
|
|
ExoM displays glucosyltransferase activity in vitro.
Because
the predicted trisaccharide acceptor substrate for ExoM,
Glc
1-4Glc
1-3Gal, is not commercially available and it was not
known at the outset whether a soluble saccharide could replace the
natural glycolipid acceptor, mutant strains of S. meliloti were used as a source of authentic glycolipid substrates. The S. meliloti exoMBR triple mutant contains a disruption in
exoM, as well as in exoB and exoR.
exoB is believed to encode the UDP-4-glucose epimerase which
generates the UDP-Gal necessary to initiate succinoglycan biosynthesis,
while exoR is a negative regulator of exo gene
transcription (24). Therefore, the triple mutant strain
accumulates the
Glc
1-4Glc
1-3Gal
-pyrophosphoryl-polyprenol-linked acceptor for
ExoM (hereafter referred to as Glc2Gal-PPL) only when
provided with exogenous nucleotide sugars. The characterization of the
native lipid-linked octasaccharide from wild-type S. meliloti and the glycolipids produced by the mutant strains have
been reported previously (24, 28). We found that crude
extracts of BL21(DE3)/pLysS, containing pLGC2, but not the pET29b
control, were capable of transferring [14C]glucose from
UDP-[14C]Glc to the
CHCl3:MeOH:H2O (1:2:0.3) lipid-extractable
fraction in the presence of unlabeled glycolipids prepared from
permeabilized exoMBR mutant cells (Table
2). No incorporation into the
CHCl3:MeOH:H2O (1:2:0.3) fraction was observed
in the absence of pLGC2 or rhizobial lipids, demonstrating that
E. coli possesses no endogenous glucosyltransferase activity
and furthermore that the E. coli membranes do not contain a
lipid-anchored substrate for ExoM. Following the recombinant ExoM
reaction, the CHCl3:MeOH:H2O (1:2:0.3) extract
was dried, and the oligosaccharides were released from the lipid anchor
by mild acid hydrolysis and subsequently analyzed by TLC, as described in the previous section. The radiolabeled product recovered was found
to comigrate with a sample of the expected product
Glc
1-4Glc
1-4Glc
1-3Gal (Glc3Gal), isolated from the
rhizobial exoOBR triple mutant which accumulates the
biosynthetic intermediate corresponding to the ExoM reaction product
(Fig. 4) (24). Interestingly,
no significant incorporation was detected when the
CHCl3:MeOH:H2O (1:2:0.3) fraction from the
exoOBR cells was used as the source of glycolipid acceptor (data not shown).

View larger version (55K):
[in this window]
[in a new window]
|
FIG. 4.
TLC analysis of oligosaccharides released after
ExoM-mediated transfer of UDP-[14C]Glc to unlabeled
rhizobial glycolipids. Lanes 1 and 2, Glc2[14C]Gal isolated from S. meliloti exoMBR triple mutant; lanes 3 and 4, unlabeled
Glc2Gal incubated with UDP-[14C]Glc and
membranes from E. coli(DE3)/pLysS/pLGC; lanes 5 and 6, Glc3[14C]Gal isolated from S. meliloti exoOBR triple mutant. Dimer, trimer, and
tetramer refer to maltobiose, maltotriose, and maltotetraose standards,
respectively. Oligosaccharides were treated with (+) or without ( )
cellobiohydrolase.
|
|
In the converse experiment, in which the glycolipid acceptor prepared
with the permeabilized rhizobial cells was labeled with
either
[
14C]glucose or [
14C]galactose rather than
the nucleotide sugar donor, ExoM was also
found to be active. The
E. coli membrane fractions expressing
ExoM modified the
radiolabeled product in the presence of cold
UDP-Glc and
MgCl
2, demonstrating that the observed glucosyltransferase
activity is specific for the appropriate acceptor of rhizobial
origin
(Fig.
5). In this second experiment
employing the
14C-labeled glycolipid acceptor, the
conversion of the starting
substrate into the expected product was
detected directly. Under
the conditions assayed, the reaction did not
go to completion,
as both the starting material and the product were
detected. These
results taken together demonstrate that the gene
product of
exoM has glucosyltransferase activity towards a
specific glycolipid
substrate of
S. meliloti origin in
vitro.

View larger version (99K):
[in this window]
[in a new window]
|
FIG. 5.
TLC analysis of oligosaccharides released after
ExoM-mediated transfer of unlabeled UDP-Glc to
[14C]galactose-labeled rhizobial lipids. Lanes 1 and 2, [14C]galactose-labeled Glc2Gal standard
isolated from S. meliloti exoMBR triple mutant.
Lane 3, oligosaccharides released after treatment of
[14C]galactose-labeled Glc2Gal-PP lipid with
pET29b E. coli membrane preparations. Lanes 4 and 5, oligosaccharides released after treatment of
[14C]galactose-labeled Glc2Gal-PP lipid with
recombinant ExoM E. coli membrane preparations. Lane 6, oligosaccharide recovered after treatment of lipid-free
[14C]galactose-labeled Glc2Gal with
recombinant ExoM E. coli membrane preparations. Lanes 7 and
8, [14C]galactose-labeled Glc3Gal standard
isolated from S. meliloti exoOBR triple mutant.
Dimer, trimer, and tetramer refer to maltobiose, maltotriose, and
maltotetraose standards, respectively. Oligosaccharides were analyzed
with (+) or without ( ) cellobiohydrolase digestion.
|
|
The product of ExoM activity is sensitive to cellobiohydrolase
degradation.
In order to show that the glycosidic linkage
resulting from ExoM activity is in the predicted
1-4 regio- and
stereochemistry, the product of the ExoM reaction was treated with the
recombinant catalytic domain of cellobiohydrolase II of H. insolens. This cellobiohydrolase recognizes a nonreducing terminal
cellotriose sequence (Glc
1-4Glc
1-4Glc) and specifically cleaves
the
1-4 glucosidic linkage, resulting in the release of cellobiose
from the nonreducing terminus (Fig. 1B) (26). As expected,
[14C]galactose-labeled trisaccharide
(Glc
1-4Glc
1-3Gal) from Glc2Gal-PPL substrate acceptor
for ExoM is insensitive to the cellobiohydrolase digestion, presumably
because the residue adjacent to the cellobiose moiety is
1-3-linked
galactose. However, the product of the in vitro reaction with
recombinant ExoM, adding an additional glucose residue to either cold
or [14C]galactose-labeled acceptor (Fig. 4 and 5),
converts the previously insensitive trisaccharide into a
cellobiohydrolase-sensitive tetrasaccharide which must now contain the
cellotriose structure and a galactose residue. These results strongly
suggest that recombinant ExoM catalyzes the formation of a
1-4
glucosidic linkage. Further enzymological investigations of ExoM will
require the direct chemical characterization of reaction products
derived from either natural or synthetic glycolipid acceptors.
A lipid-anchored substrate is required for ExoM activity.
The
study of ExoM would be greatly facilitated if a soluble substrate could
be found for the enzyme. In order to determine whether a soluble form
of the trisaccharide Glc2Gal could serve as an acceptor for
ExoM, [14C]galactose-labeled Glc2Gal-PPL was
prepared as described previously. The trisaccharide moiety was then
released from the lipid anchor by mild acid hydrolysis, phosphatase
treated, and desalted before use in the transferase assay. When equal
counts of [14C]galactose-labeled trisaccharide, either in
the soluble or in the lipid-anchored form, were employed in the assay,
TLC analysis of the products revealed that no conversion of the
starting material could be observed when the trisaccharide had been
released from the lipid anchor prior to the assay (Fig. 5). In order to
determine whether soluble saccharides could inhibit the transfer of
[14C]glucose to the Glc2Gal-PPL, glucose,
cellobiose, or the trisaccharide analog Glc
1-4Glc
1-3Glc was added
to the reaction mixture (1 mM final concentration) in addition to the
usual quantities of nucleotide sugar, detergent, and
Glc2Gal-PPL (Table 2). No significant reduction in the
amount of [14C]glucose transfer to the glycolipid
fraction was observed. These findings together support the idea that
the polyprenyl-pyrophosphate anchor is necessary for the
glucosyltransferase activity.
 |
DISCUSSION |
Here we report on both the overexpression of an active
membrane-associated form of the S. meliloti protein ExoM in
E. coli and our results which clearly establish the fact
that this recombinant protein is a glucosyltransferase capable of
transferring glucose from UDP-Glc to a rhizobial glycolipid in vitro.
Furthermore, the fact that the ExoM reaction product is sensitive to
digestion by a cellobiohydrolase is consistent with the prediction that ExoM possesses
1-4 glucosyltransferase activity. These results directly confirm in vitro the biosynthetic role previously attributed to the exoM gene product, based on in vivo studies (2,
9, 24). ExoM is the first of the six putative
glucosyltransferases involved in the assembly of this biologically
important polysaccharide to have been analyzed in vitro.
Many gram-negative bacterial exopolysaccharides, as well as O antigen
from lipopolysaccharides and the glycopeptide precursors of
peptidoglycan, are assembled from polyprenyl-pyrophosphate-linked subunits (31). In the cases where the lipid anchor has been fully characterized, it is most often found to be undecaprenol (C55). Early studies of the succinoglycan intermediates of
S. meliloti have shown that the lipid anchor contains a
pyrophosphate and possesses chemical characteristics consistent with
the presence of a polyisoprene chain with an unsaturated
-subunit;
however, the exact chain length of the polyisoprene carrier is not
known (28). We found that ExoM is incapable of transferring
glucose to a lipid-pyrophosphate free trisaccharide acceptor, which
suggests that some portion of the polyprenyl-pyrophosphate moiety is
necessary for the enzyme activity. This finding was somewhat
surprising, given that ExoM does not act upon a sugar residue very
close to the lipid anchor. However, similar results have been reported for the yeast
1-4 mannosyltransferase (ALG1), which normally acts
upon a dolichol-pyrophosphate-linked chitobiose acceptor during the
assembly of the N-glycan core oligosaccharide
(Glc3Man9GlcNac2-PP-dolichol) (35). In vitro studies employing synthetic glycolipid
acceptor analogs have shown that recombinant ALG1 requires the
pyrophosphate linkage and a branched lipid anchor for activity
(32). The glycosyltransferases involved in the assembly of
the polyprenyl-pyrophosphate-linked tetrasaccharide repeat unit of the
Streptococcus pneumoniae serotype 14 capsular polysaccharide
display different substrate requirements. Cps14J is thought to transfer
galactose to a lipid-anchored trisaccharide structure in vivo and is
active with soluble FCHASE [6-(5-fluorescein-carboxyamido)-hexanoic acid succimyl ester]-derivatized trisaccharide analog in vitro. However, Cps14I, which transfers N-acetylglucosamine to a
lipid-linked lactose acceptor in the step preceding the one involving
Cps14J, is not active on a soluble FCHASE-derivatized lactose in vitro. The authors speculated that Cps14I has more stringent substrate requirements that may involve the lipid anchor (16).
Only a very limited number of glycosyltransferases which use
polyprenyl-pyrophosphate-linked acceptors have been studied in vitro.
It is not clear, even in the case of ALG1, exactly what role the lipid
anchor plays in substrate recognition or if its recognition is a
general phenomenon. It has been proposed that the membrane anchor of
glycosyltransferases involved in N-glycan assembly may be involved in
recognition of the dolichol anchor of the oligosaccharide acceptor
substrate (1). However, in the case of ALG1, the acceptor
lipid anchor is still required for transferase activity, even after the
transmembrane region of the mannosyltransferase has been removed
(32). In addition, preliminary results from our laboratory
indicate that AceA, a soluble recombinant mannosyltransferase from
A. xylinum involved in acetan biosynthesis, is also
incapable of transferring mannose to a lipid-pyrophosphate free
cellobiose acceptor (8a). These findings suggest that it is
not merely the presence of a transmembrane region that renders the
glycosyltransferase sensitive to the presence or absence of the
acceptor lipid anchor. The production of a soluble form of ExoM with
which to investigate the role of the putative C-terminal transmembrane
region in substrate recognition is currently under way in our laboratory.
The purification of native rhizobial glycolipid substrates on a large
scale and the preparation of synthetic glycolipid analog substrates
will allow more detailed investigations of ExoM in vitro. Future points
to investigate include the influence of nonglycosidic substrate
modifications (e.g., O-acetylation) upon ExoM activity, the minimal
acceptor structure requirements for the enzymatic activity (including
features of the lipid anchor), and divalent cation usage. The reaction
catalyzed by ExoM, i.e., the transfer of glucose from UDP-Glc to a
Glc
1-4Glc-containing acceptor, is very close to the reaction
performed processively by cellulose synthase in the production of the
cellulose [(Glc
1-4Glc)n]. Aside from domain
A and the conserved aspartic acid residues, ExoM and bacterial
cellulose synthases have no significant overall sequence similarity
(25). Our findings support the assumption that ExoM is a
nonprocessive glucosyltransferase, as we have found no evidence for the
addition of more than one sugar residue under the conditions tested.
However, as ExoM is one of the rare glucosyltransferases (other than
cellulose synthases) to catalyze the formation of a Glc
1-4Glc
structure, further studies on the molecular mechanisms of ExoM may also
provide useful insight into the biosynthesis of cellulose.
S. meliloti mutants producing glycolipid intermediates
corresponding to almost every step in the assembly of the succinoglycan octasaccharide subunit have been described, and thus a similar strategy
to that presented here can be applied to the initial study of each of
the other exo cluster glucosyltransferases as well
(24). For example, ExoL is required in vivo for the addition of the third saccharide residue (
1-4Glc, like ExoM) to the lipid anchor, generating Glc
1-4Glc
1-3Gal-pyrophosphate lipid. However, ExoL does not possess any detectable similarity to any currently known
glycosyltransferase (18a). It is tempting to speculate that
if this gene product catalyzes the formation of a
1-4Glc linkage, it
may function differently than the other Exo glucosyltransferases, perhaps not employing a nucleotide sugar donor. Alternatively, ExoL
alone may not be directly responsible for the glucose transfer. An in
vitro study, analogous to the one described here and employing recombinant ExoL, will allow us to directly determine the function of
this unusual protein also involved in succinoglycan biosynthesis.
 |
ACKNOWLEDGMENTS |
We thank G. C. Walker for kindly providing the cosmid pEX154
and the rhizobial strains, Valerie Chazalet for her expert technical assistance, and Sabine Flitsch for helpful advice. The N-terminal amino
acid sequence of recombinant ExoM was determined by Jean Gagnon,
Institut de Biologie Structurale, Grenoble, France.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Centre de
Recherches sur les Macromolécules Végétales, CNRS,
Joseph Fourier University, BP53, F38041 Grenoble Cedex 09, France.
Phone: (33) (0) 4 76 03 76 50. Fax: (33) (0) 4 76 54 72 03. E-mail:
lellouch{at}cermav.cnrs.fr.
 |
REFERENCES |
| 1.
|
Albright, C. F.,
P. Orlean, and P. W. Robbins.
1989.
A 13 amino acid peptide in three yeast glycosyltransferases may be involved in dolichol recognition.
Proc. Natl. Acad. Sci. USA
86:7366-7369[Abstract/Free Full Text].
|
| 2.
|
Battisti, L.,
J. C. Lara, and J. A. Leigh.
1992.
Specific oligosaccharide form of the Rhizobium meliloti exopolysaccharide promotes nodule invasion in alfalfa.
Proc. Natl. Acad. Sci. USA
89:5625-5629[Abstract/Free Full Text].
|
| 3.
|
Becker, A.,
A. Kleickmann,
M. Keller,
W. Arnold, and A. Pühler.
1993.
Identification and analysis of the Rhizobium meliloti exoAMONP genes involved in exopolysaccharide biosynthesis and mapping of promoters located on the exoHKLAMONP fragment.
Mol. Gen. Genet.
241:367-379[Medline].
|
| 4.
|
Becker, A.,
A. Kleickmann,
H. Küster,
M. Keller,
W. Arnold, and A. Pühler.
1993.
Analysis of the Rhizobium meliloti genes exoU, exoV, exoW, exoT, and exoI involved in exopolysaccharide biosynthesis and nodule invasion: exoU and exoW probably encode glucosyltransferases.
Mol. Plant-Microbe Interact.
6:735-744[Medline].
|
| 5.
|
Becker, A.,
H. Küster,
K. Niehaus, and A. Pühler.
1995.
Extension of the Rhizobium meliloti succinoglycan biosynthesis gene cluster: identification of the exsA gene encoding an ABC transporter protein, and the exsB gene which probably codes for a regulator of succinoglycan biosynthesis.
Mol. Gen. Genet.
249:487-497[Medline].
|
| 6.
|
Breton, C.,
E. Bettler,
D. Joziasse,
R. Geremia, and A. Imberty.
1998.
Sequence-function relationships in prokaryotic and eukaryotic galactosyltransferases.
J. Biochem.
123:1000-1009[Abstract/Free Full Text].
|
| 7.
|
Busch, C.,
F. Hofmann,
J. Selzer,
S. Munro,
D. Jeckel, and K. Aktories.
1998.
A common motif of eukaryotic glycosyltransferases is essential for the enzyme activity of large clostridial cytotoxins.
J. Biol. Chem.
273:19566-19572[Abstract/Free Full Text].
|
| 8.
|
Cheng, H.-P., and G. C. Walker.
1998.
Succinoglycan is required for the initiation and elongation of infection threads during nodulation of alfalfa by Rhizobium meliloti.
J. Bacteriol.
180:5183-5191[Abstract/Free Full Text].
|
| 8a.
| Geremia, R. A. Personal communication.
|
| 9.
|
Glucksmann, M. A.,
T. L. Rueber, and G. C. Walker.
1993.
Family of glycosyltransferases needed for the synthesis of succinoglycan by Rhizobium meliloti.
J. Bacteriol.
175:7033-7044[Abstract/Free Full Text].
|
| 10.
|
Glucksmann, M. A.,
T. L. Rueber, and G. C. Walker.
1993.
Genes needed for the modification, polymerization, export, and processing of succinoglycan by Rhizobium meliloti: a model for succinoglycan biosynthesis.
J. Bacteriol.
175:7045-7055[Abstract/Free Full Text].
|
| 11.
|
González, J. E.,
C. E. Semino,
L.-X. Wang,
L. E. Castellano-Torres, and G. C. Walker.
1998.
Biosynthetic control of molecular weight in the polymerization of the octasaccharide subunits of succinoglycan, a symbiotically important exopolysaccharide of Rhizobium meliloti.
Proc. Natl. Acad. Sci. USA
95:13477-13482[Abstract/Free Full Text].
|
| 12.
|
Gonzalez, J. E.,
G. M. York, and G. C. Walker.
1996.
Rhizobium meliloti exopolysaccharides: synthesis and symbiotic function.
Gene
179:141-146[Medline].
|
| 13.
|
Gravanis, G.,
M. Milas,
M. Rinaudo, and A. J. Clarke-Sturman.
1990.
Rheological behavior of a succinoglycan polysaccharide in dilute and semi-dilute solutions.
Int. J. Biol. Macromol.
12:201-206[Medline].
|
| 14.
|
Ielpi, L.,
R. O. Couso, and M. A. Dankert.
1993.
Sequential assembly and polymerization of the polyprenol-linked pentasaccharide repeating unit of the xanthan polysaccharide in Xanthomonas campestris.
J. Bacteriol.
175:2490-2500[Abstract/Free Full Text].
|
| 15.
|
Keenleyside, W. J., and C. Whitfield.
1996.
A novel pathway for O-polysaccharide biosynthesis in Salmonella enterica serovar Borreze.
J. Biol. Chem.
271:28581-28592[Abstract/Free Full Text].
|
| 16.
|
Kolkman, M. A. B.,
W. Wakarchuk,
P. J. M. Nuijten, and B. A. M. van der Zeijst.
1997.
Capsular polysaccharide synthesis in Streptococcus pneumoniae serotype 14: molecular analysis of the complete cps locus and identification of genes encoding glycosyltransferases required for the biosynthesis of the tetrasaccharide subunit.
Mol. Microbiol.
25:197-208.
|
| 17.
|
Leigh, J. A.,
R. Signer, and G. C. Walker.
1985.
Exopolysaccharide deficient mutants of Rhizobium meliloti that form ineffective nodules.
Proc. Natl. Acad. Sci. USA
82:6231-6235[Abstract/Free Full Text].
|
| 18.
|
Leigh, J. A., and G. C. Walker.
1994.
Exopolysaccharides of Rhizobium: synthesis, regulation and symbiotic function.
Trends Genet.
10:63-67[Medline].
|
| 18a.
| Lellouch, A. C. Personal communication.
|
| 19.
|
Long, S.,
J. W. Reed,
J. Himawan, and G. C. Walker.
1988.
Genetic analysis of a cluster of genes required for synthesis of the Calcofluor-binding exopolysaccharide of Rhizobium meliloti.
J. Bacteriol.
170:4239-4248[Abstract/Free Full Text].
|
| 20.
|
Matusdaira, P.
1987.
Sequence from picomole quantities of proteins electroblotted onto polyvinylidene difluoride membranes.
J. Biol. Chem.
262:10035-10038[Abstract/Free Full Text].
|
| 21.
|
Reed, J. W.,
M. Capage, and G. C. Walker.
1991.
Rhizobium meliloti exoG and exoJ mutations affect the ExoX-ExoY system for modulation of exopolysaccharide production.
J. Bacteriol.
173:3776-3788[Abstract/Free Full Text].
|
| 22.
|
Reinhold, B. R.,
S. Y. Chan,
T. L. Reuber,
A. Marra,
G. C. Walker, and V. N. Reinhold.
1994.
Detailed structural characterization of succinoglycan, the major exopolysaccharide of Rhizobium meliloti Rm1021.
J. Bacteriol.
176:1997-2002[Abstract/Free Full Text].
|
| 23.
|
Reuber, T. L.,
S. Long, and G. C. Walker.
1991.
Regulation of Rhizobium meliloti exo genes in free-living cells and in planta examined by using TnphoA fusions.
J. Bacteriol.
173:426-434[Abstract/Free Full Text].
|
| 24.
|
Reuber, T. L., and G. C. Walker.
1993.
Biosynthesis of succinoglycan, a symbiotically important exopolysaccharide of Rhizobium meliloti.
Cell
74:269-280[Medline].
|
| 25.
|
Saxena, I. M.,
R. M. Brown, Jr.,
M. Fevre,
R. A. Geremia, and B. Henrissat.
1995.
Multidomain architecture of -glycosyl transferases: implications for mechanism of action.
J. Bacteriol.
177:1419-1424[Free Full Text].
|
| 26.
|
Schülein, M.
1997.
Enzymatic properties of cellulases from Humicola insolens.
J. Biotechnol.
57:71-81[Medline].
|
| 27.
|
Semino, C. E., and M. A. Dankert.
1993.
In vitro biosynthesis of acetan using electroporated Acetobacter xylinum cells as enzyme preparations.
J. Gen. Microbiol.
139:2745-2756[Abstract/Free Full Text].
|
| 28.
|
Tolmasky, M. E.,
R. J. Staneloni, and L. F. Leloir.
1982.
Lipid-bound saccharides in Rhizobium meliloti.
J. Biol. Chem.
257:6751-6757[Abstract/Free Full Text].
|
| 29.
|
Urzainqui, A., and G. C. Walker.
1992.
Exogenous suppression of the symbiotic deficiencies of Rhizobium meliloti exo mutants.
J. Bacteriol.
174:3403-3406[Abstract/Free Full Text].
|
| 30.
|
van Rhijn, P., and J. Vanderleyden.
1995.
The Rhizobium-plant symbiosis.
Microbiol. Rev.
59:124-142[Abstract/Free Full Text].
|
| 31.
|
Warren, C. D., and R. W. Jeanloz.
1972.
Chemical synthesis of pyrophosphodiesters of carbohydrates and isoprenoid anchors. Lipid intermediates of bacterial cell wall and antigenic polysaccharide biosynthesis.
Biochemistry
11:2565-2572[Medline].
|
| 32.
|
Watt, G. M.,
L. Revers,
M. C. Webberley,
I. B. H. Wilson, and S. L. Flitsch.
1998.
The chemo-enzymatic synthesis of the core trisaccharide of N-linked oligosaccharides using a recombinant -mannosyltransferase.
Carbohydr. Res.
305:533-541.
|
| 33.
|
Whitfield, C., and M. A. Valvano.
1993.
Biosynthesis and expression of cell-surface polysaccharides in gram-negative bacteria.
Adv. Microb. Physiol.
35:135-246[Medline].
|
| 34.
|
Wiggins, C. A., and S. Munro.
1998.
Activity of the yeast MNN1 alpha 1-3 mannosyltransferase requires a motif conserved in many other families of glycosyltransferases.
Proc. Natl. Acad. Sci. USA
14:7945-7950.
|
| 35.
|
Wilson, I. B. H.,
M. C. Webberley,
L. Revers, and S. L. Flitsch.
1995.
Dolichol is not a necessary moiety for lipid-linked oligosaccharide substrates of the mannosyltransferases involved in in vitro N-linked-oligosaccharide assembly.
Biochem. J.
310:909-916.
|
Journal of Bacteriology, February 1999, p. 1141-1148, Vol. 181, No. 4
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Toh, E., Kurtz, H. D. Jr., Brun, Y. V.
(2008). Characterization of the Caulobacter crescentus Holdfast Polysaccharide Biosynthesis Pathway Reveals Significant Redundancy in the Initiating Glycosyltransferase and Polymerase Steps. J. Bacteriol.
190: 7219-7231
[Abstract]
[Full Text]
-
Barreras, M., Abdian, P. L., Ielpi, L.
(2004). Functional characterization of GumK, a membrane-associated {beta}-glucuronosyltransferase from Xanthomonas campestris required for xanthan polysaccharide synthesis. Glycobiology
14: 233-241
[Abstract]
[Full Text]
-
Dean, C. R., Datta, A., Carlson, R. W., Goldberg, J. B.
(2002). WbjA Adds Glucose To Complete the O-Antigen Trisaccharide Repeating Unit of the Lipopolysaccharide of Pseudomonas aeruginosa Serogroup O11. J. Bacteriol.
184: 323-326
[Abstract]
[Full Text]
-
Garinot-Schneider, C., Lellouch, A. C., Geremia, R. A.
(2000). Identification of Essential Amino Acid Residues in the Sinorhizobium meliloti Glucosyltransferase ExoM. J. Biol. Chem.
275: 31407-31413
[Abstract]
[Full Text]