INTRODUCTION

Top Abstract Introduction Materials and methods Results Discussion References

In diazotrophic proteobacteria, transcription of the nitrogen fixation (nif) genes is dependent on the nif-specific activator protein NifA, which is a member of the ^N-dependent family of bacterial activators (18, 28, 36). In most organisms, the activity of NifA is controlled in response to two major environmental factors, namely, the availability of oxygen and of fixed nitrogen, but the mechanism of this control differs from one organism to another (20, 36). In Klebsiella pneumoniae and Azotobacter vinelandii, nifA is coordinately transcribed with a second gene, nifL, the product of which antagonizes NifA activity in response to both oxygen and fixed nitrogen (6, 23, 34, 46). In K. pneumoniae, nifLA expression is itself regulated in response to the cellular N status, whereas in A. vinelandii, it is constitutive (6, 16, 54). The response of NifL to oxygen is at least partly understood in that NifL in both organisms is a flavoprotein with flavin adenine dinucleotide as a prosthetic group and the oxidized form of NifL inhibits NifA activity (23, 48, 49). However, the mechanism by which NifL senses and responds to the cellular nitrogen status is unknown.

In enteric bacteria, global responses to changes in nitrogen status are mediated by the nitrogen regulation (ntr) system, which is considered to comprise four proteins. Two of these proteins, a uridylyltransferase (encoded by glnD) and P_II (a small, trimeric protein encoded by glnB), comprise a sensory transduction system whereby GlnD uridylylates GlnB under N-limiting conditions and deuridylylates GlnB-UMP in N excess. Hence, the uridylylation status of GlnB signals the intracellular nitrogen status, which is then communicated to the NtrB-NtrC two-component regulatory system. In N limitation, NtrB is autophosphorylated on residue His139 and these phosphoryl groups are subsequently transferred to NtrC with the concomitant activation of NtrC-P-dependent genes. In N excess, GlnB stimulates the NtrB-dependent dephosphorylation of NtrC and inactivation of ntr-dependent operons (37, 40).

The potential roles of one or more of the ntr genes in NifL-dependent nif regulation has been investigated in both K. pneumoniae and A. vinelandii. In K. pneumoniae, NifL-dependent nitrogen control occurs in the absence of GlnB or GlnD, suggesting that neither protein is essential for the sensing of fixed nitrogen by NifL (19, 24). However, it should be noted that experiments with the glnD null mutant utilized a strain with a secondary ntrB mutation that allowed constitutive expression of NtrC-dependent genes, including nifLA. In A. vinelandii, a mutation in nfrX (a glnD homologue) produces a Nif phenotype that can be suppressed by a secondary mutation in nifL, suggesting that in this organism, the absence of uridylyltransferase results in permanent inhibition of NifA activity by NifL (11).

Our understanding of the global Ntr system in enteric bacteria was recently complicated by the recognition of a second P_II-like protein (encoded by glnK) in Escherichia coli (56). E. coli glnK appears to be cotranscribed with a downstream gene (amtB), the product of which has been proposed to be an ammonium transporter (31, 41, 56), and expression of the operon is NtrC dependent (51). The amino acid sequence of GlnK is 67% identical to that of GlnB, and GlnK can also be uridylylated in N limitation, presumably at the conserved Tyr51 residue (56). The presence of two P_II-like proteins has since been reported in Rhizobium etli, Azospirillum brasilense, Azorhizobium caulinodans, Herbaspirillum seropedicae, Azoarcus sp. strain BH72, Rhodobacter sphaeroides, and Acetobacter diazotrophicus (5, 13, 14, 32, 38, 42, 43, 53).

The precise role of GlnK in nitrogen metabolism remains to be elucidated (2), but recent experiments which examined the activities of K. pneumoniae NifL and NifA in a heterologous E. coli or Salmonella typhimurium background found that the release of NifA from NifL-dependent inhibition does not occur in an ntrC mutant (22). It was concluded that NtrC activates transcription of a gene the product of which functions to relieve NifL inhibition of NifA under N-limiting conditions. One candidate for such a gene is glnK.

We have now cloned and sequenced the glnK gene of K. pneumoniae. We have studied the control of glnK expression and investigated the effect of a glnK null mutation. We found that in the absence of GlnK, NifA activity is inhibited in an NifL-dependent manner, even under N-limiting conditions, suggesting that GlnK is involved, directly or indirectly, in the sensing of cellular nitrogen status by NifL.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and methods Results Discussion References

Strains and media. The strains and plasmids used in this work are listed in Table 1. All strains were grown on Luria medium (Luria broth or Luria agar [LA]). The nitrogen-free medium used (NFDM) was as described by Dixon et al. (15). When used for growth of K. pneumoniae strains, NFDM was supplemented with 25-µg/ml L-histidine, and for E. coli, it was supplemented with 1-µg/ml thiamine. Ammonium sulfate was added to NFDM as a nitrogen source at a final concentration of 1 mg/ml. The antibiotics used for E. coli were 100-µg/ml carbenicillin, 15-µg/ml kanamycin, 15-µg/ml chloramphenicol, and 30-µg/ml streptomycin; those used for K. pneumoniae were 200-µg/ml both carbenicillin and ampicillin together, 30-µg/ml kanamycin, 40-µg/ml chloramphenicol, and 200-µg/ml spectinomycin.

DNA methods. Plasmids were isolated by using a plasmid miniprep kit (Qiagen) in accordance with the manufacturer's instructions. Restriction enzyme digests, blunting of DNA, ligation, and Southern hybridization reactions were carried out as described by Sambrook et al. (45). Plasmid pRJ32 was constructed by cloning the PvuII fragment carrying the 3' end of mdl, the glnK promoter region, and the 5' end of glnK into lacZ translational fusion plasmid pNM480. Plasmid pRJ44 was constructed by cloning an EcoRI-DraIII fragment (which extends from 21 bp upstream of the glnK ATG to 15 bp downstream of the termination codon) in place of the DraI fragment internal to the cat gene of pACYC184. In order to change the selective marker on this plasmid from tetracycline resistance to streptomycin resistance, an  cassette was then cloned into the BamHI site.

Isolation of fragment containing glnK. An internal fragment of the K. pneumoniae glnK gene was isolated from genomic DNA by PCR using primers based on conserved regions of GlnB (5' CTGCGAATTCGATHATHAAACCHTTCAARCTGGA 3' and 5' ACGCGGATCCTCRCCGGTRCGRATRCGAATSACSCG 3', where H is A, C, or T, R is A or G, and S is C or G). The resultant fragment was cloned into pBluescript KS+ by using BamHI and EcoRI sites included in the primers, giving pRJ5, and sequenced to confirm its likely identity. Chromosomal DNA was isolated from wild-type K. pneumoniae UNF122 by the method of Ausubel et al. (3). Isolated DNA (10 µg) was subjected to either single or double digestion with EcoRI, BamHI, HindIII, SspI, and SphI and separated on 0.8% agarose. Fragments containing glnK were identified by Southern hybridization using the BamHI-EcoRI fragment from pRJ5 as a probe labelled with [³²P]dCTP using the Rediprime labelling kit (Amersham). DNA was redigested with BamHI and HindIII, and fragments of 1.5 kb were isolated from agarose and ligated into BamHI-HindIII-digested pTZ18 to form a minilibrary. Ligated DNA was used to transform E. coli 71-18. White, ampicillin-resistant colonies were patched onto nitrocellulose filters, laid onto LA-carbenicillin plates, and grown for 3 h. Filters were then transferred onto LA-chloramphenicol plates and incubated overnight. Clones containing glnK were identified by colony hybridization (45) using the [³²P]dCTP-labelled fragment described above. Sequencing of one hybridizing plasmid (pRJ16) was performed by using the dideoxy sequencing kit and protocol from Pharmacia.

Primer extension analysis of total RNA. Cells were grown overnight in the same media as used for -galactosidase assays and subcultured into fresh media, and total RNA was isolated from exponentially growing cells by using the RNeasy kit (Qiagen) in accordance with the manufacturer's instructions. Primer extension analysis was performed by using 10 µg of total RNA and 0.2 pmol of a primer end labelled with [-³²P]dATP as described by Sawers and Böck (47). The oligonucleotide used (5' GAATGGTTTGATTACCACGG 3') hybridizes to bases 33 to 14 of glnK. Primer extension reactions were carried out as described by Sawers and Böck (47). Products were separated on a 6% polyacrylamide sequencing gel alongside a sequence produced by using the same ³²P-labelled primer and pRJ16 as the template.

Construction of glnK::KIXX mutation. The kanamycin resistance-encoding KIXX cassette from pUC4KIXX was cloned into the EagI site blunted 5'3' by using mung bean nuclease (New England Biolabs), creating pRJ17, in which the kan gene is transcribed in the direction opposite to that of glnK. The BamHI-PvuI fragment of pRJ17, containing all of the cloned region, was then blunted 3'5' by using large-fragment Klenow polymerase (Pharmacia), ligated into the SmaI site of sacB-containing vector pSG335 (21) to give pRJ25, and transformed into UNF122. Recombinant strains were identified by the ability to grow on LA supplemented with 5% sucrose and resistance to kanamycin. The glnK::KIXX mutation was then transduced, by using the P1 phage, into K. pneumoniae UNF923 to create UNF3433. The correct insertion of glnK::KIXX into both chromosomes was checked by PCR. Reactions were carried out in 100-µl volumes using Taq DNA polymerase (Boehringer) and primers homologous to the sequence of the glnK PCR fragment (sense, 5' TTCAAGCTGGAAGATGTG 3'; antisense, 5' CCTTTCTGACGGCGGAAC 3') at a concentration of 20 pmol/reaction mixture.

-Galactosidase assays. For K. pneumoniae strains, -galactosidase assays were carried out as described by Holtel and Merrick (24): for N-limitation, the nitrogen source was 100-µg/ml glutamine (see Table 2 experiments) or 100-µg/ml serine (see Table 3 experiments), and for N sufficiency, it was 100-µg/ml glutamine plus 1-mg/ml (NH₄)₂SO₄ (see Table 2) or 1-mg/ml (NH₄)₂SO₄ (see Table 3). For E. coli strains, cultures were grown for 24 h in Luria broth before subculture in NFDM supplemented with 0.02% Casamino Acids rather than glutamine. The data in Tables 2 and 3 are the means of at least three experiments in which the standard deviations were not greater than ±10%.

[¹⁴C]methylamine transport assays. Cells were grown overnight in the same way as for -galactosidase assays. Cultures were then washed two times in saline phosphate and resuspended in 4.8 ml of NFDM. The optical density at 650 nm was measured to determine the protein concentration. At zero time, 20 µl of ¹⁴CH₃NH₃⁺ (826 Ci/mol) was added to give a final concentration of 10 µM ¹⁴CH₃NH₃⁺. Samples of 500 µl were taken at 0, 2, 4, 6, 10, and 20 min, and uptake was terminated by filtration through nitrocellulose filters (Millipore type HA; 0.45 µm pore size) under a constant vacuum. Filters were then washed five times with NFDM and exposed for 1 h to a PhosphoImager plate from which counts were determined. Data were calibrated by using internal standards spotted on filters and counted in the same experiment.

Nucleotide sequence accession number. The sequence of the BamHI-HindIII fragment carried on pRJ16 (Fig. 1) has been assigned EMBL accession no. AJ006531.

	RESULTS

Top Abstract Introduction Materials and methods Results Discussion References

Cloning of glnK. A 300-bp fragment encoding part of K. pneumoniae glnK was amplified by PCR using degenerate primers based on the conserved regions of the E. coli and K. pneumoniae glnB sequences. This fragment was cloned into Bluescript KS+ by using EcoRI and BamHI restriction sites incorporated into the primers. The sequence of the cloned fragment confirmed that it encoded a polypeptide with 93% identity to the Ile8-to-Ala94 region of E. coli GlnK. This cloned fragment was then used as a probe to isolate a 1.5-kb hybridizing fragment from a minigene bank of BamHI-HindIII-digested chromosomal K. pneumoniae DNA cloned in pTZ18. The resultant plasmid was designated pRJ16.

Sequencing. Sequencing of the fragment in pRJ16 identified three open reading frames, all of which were transcribed in the same direction, from BamHI to HindIII, and which, by homology to the equivalent E. coli genes, encode the 3' end of mdl, all of glnK, and the 5' end of amtB (Fig. 1). Within the 240-bp glnK promoter region (Fig. 1), a consensus ^N-dependent 24, 12 promoter sequence is located 60 bp upstream of the glnK translation start and two potential NtrC-binding sites are present; one complete site is 100 bp upstream of the proposed promoter, and a half site is 30 bp upstream of that. There are two potential initiating methionine codons for amtB, of which we consider the second the most likely to be correct, based on homology with E. coli amtB and the presence of an appropriate ribosome-binding site. In this case, the K. pneumoniae amtB gene is separated by 35 bp from the 3' end of glnK, a spacing almost identical to that found in E. coli (56). No obvious termination or promoter sequences are apparent between glnK and amtB, suggesting that the two genes comprise a single operon, as proposed for the homologous genes in E. coli, R. etli, and A. vinelandii (33, 50, 53). The K. pneumoniae glnK gene encodes a polypeptide that is 94% identical to E. coli GlnK but only 69% identical to E. coli GlnB.

View larger version (28K): [in this window] [in a new window]   FIG. 1.   Map of the cloned BamHI-HindIII fragment (pRJ16) showing restriction sites used for genetic manipulations and the site of insertion of the KIXX cassette in glnK. The sequence of a region of the cloned fragment (300 bp, bp 481 to 781 of the sequence under accession no. AJ006531) comprising the 3' end of mdl, the glnK promoter region, and the start of glnK is shown. The proposed NtrC binding sites (filled boxes), 54-dependent promoter (clear box), and ribosome-binding site (underlined) are highlighted, and the transcriptional start site (+1) is marked.

Comparison of GlnB and GlnK. Database searching for homologues of K. pneumoniae GlnK identified 21 gene products in the  and  subdivisions of the class Proteobacteria. These fall into two distinct groups, which are homologous to E. coli GlnB and GlnK, respectively. In six organisms, both GlnB and GlnK have been identified, and alignment of their amino acid sequences using ClustalW indicates that the two proteins are characterized by differences at just 5 of the 112 residues (residues 3, 5, 52, 54, and 64) (Fig. 2). In GlnB proteins, residue 3 is lysine, residue 5 is glutamate or aspartate, residue 52 is methionine or valine, residue 54 is aspartate, and residue 64 is valine. By contrast, in GlnK, residue 3 is leucine or isoleucine, residue 5 is threonine, methionine, or isoleucine, residue 52 is serine or alanine, residue 54 is serine or asparagine, and residue 64 is alanine (with the exception of R. sphaeroides GlnK, in which residue 64 is valine).

View larger version (57K): [in this window] [in a new window]   FIG. 2.   Alignment of GlnB and GlnK polypeptide sequences. Residues that distinguish GlnK and GlnB (residues 3, 5, 52, 54, and 64) are in boldface type.

In vivo transcript analysis. Primer extension analysis was carried out on RNA from wild-type K. pneumoniae (UNF122), an rpoN derivative (UNF2792), and the wild-type strain carrying a glnK-lacZ fusion plasmid (pRJ32). One specific signal was identified as the major transcript with a number of minor signals which appeared to be nonspecific in that they were present in all samples and did not correspond to any obvious motifs in the nontranslated sequence. Transcription was shown to begin 44 bp upstream of the translational start and at the appropriate distance from the proposed ^N-binding site (Fig. 3). Transcription from this site was greatly reduced when cells were grown under nitrogen-rich conditions and was undetectable in an rpoN mutant which does not contain ^N.

View larger version (73K): [in this window] [in a new window]   FIG. 3.   Transcriptional start site of the glnK amtB operon determined by primer extension analysis of RNA from wild-type K. pneumoniae UNF122 (lanes 1 and 2), UNF122 with glnK-lacZ fusion plasmid pRJ32 (lanes 3 and 4), and UNF2792 rpoN (lanes 5 and 6). The RNAs in lanes 1, 3, and 5 were from strains grown under nitrogen-limiting conditions [NFDM containing histidine (25 µg/ml)], and glutamine (100 µg/ml)], and those in lanes 2, 4, and 6 were from strains grown under nitrogen-sufficient conditions [NFDM containing histidine (25 µg/ml) and (NH4)2SO4 (1 mg/ml)]. Reaction mixtures run alongside the sequence were generated by using the same primer.

In vivo analysis of glnK expression. To analyze the expression of the glnK amtB operon in vivo, a translational glnK-lacZ fusion (pRJ32) was constructed and -galactosidase activity was assayed in a variety of genetic backgrounds under nitrogen-limiting and nitrogen-sufficient conditions (Table 2). The pattern of expression of glnK was largely as predicted from the promoter elements identified in the DNA sequence. Expression was elevated under nitrogen-limiting compared to nitrogen-sufficient conditions and was essentially eliminated in the absence of ^N (rpoN), NtrC, or GlnD. Expression from pglnK was constitutive in the absence of GlnB, whereas it was essentially wild type in the absence of GlnK. In both K. pneumoniae and E. coli, the level of expression in nitrogen sufficiency was considerably greater than in an rpoN or ntrC mutant strain.

Polarity of glnK::KIXX mutation glnK1. The introduction of a glnK::KIXX mutation into the glnK amtB operon might be expected to have a polar effect on expression of amtB. This was analyzed by using [¹⁴C]methylamine transport assays to measure the activity of AmtB. [¹⁴C]methylamine transport was assessed in three strains: wild-type UNF122, glnK::KIXX mutant UNF3432, and UNF3432 carrying a plasmid-borne, constitutively expressed glnK gene [UNF3432(pRJ44)]. In N-limited wild-type cells, methylamine uptake was linear for 20 min at a rate of 140 pmol/mg of dry weight/min, and this uptake was reduced to less than 20 pmol/mg of dry weight/min in ammonia-grown cells. Methylamine transport was less than 5 pmol/mg of dry weight/min in glnK::KIXX mutant strain UNF3433 and was not complemented by the reintroduction of a plasmid-borne copy of glnK (pRJ44). Expression of glnK from pRJ44 was shown to be constitutive by introducing the plasmid into a glnB glnK double mutant of E. coli and analyzing GlnK levels in N limitation and N sufficiency by Western blotting with an antibody raised against an oligopeptide equivalent to conserved residues 31 to 50 of GlnB (14) (data not shown). These data confirm the polarity of the glnK1 mutation on amtB and support the proposal that the two genes constitute an operon.

Phenotypic characterization of a glnK::KIXX mutation. The effect of the glnK::KIXX mutation on the activity of the nifLA gene products was assessed by using, as a genetic background, K. pneumoniae UNF923, which carries a chromosomal pnifH-lacZ fusion and has all of the nif genes, from nifD through to nifQ and into the his operon, deleted. The nifLA genes were cloned on low-copy-number plasmid pCC46 so that their expression from plac on this replicon was independent of the cellular nitrogen status. This independence of expression was confirmed by measuring lacZ expression from the same promoter on the same replicon in N limitation and N sufficiency (data not shown). When pCC46 is introduced into UNF923, expression from pnifH is normally regulated in response to the cellular nitrogen status (Table 3). Hence, in this strain, where nifLA expression is uncoupled from ntr-dependent regulation, the response of pnifH to nitrogen status reflects the activity of the NifA protein as regulated by its interaction with NifL. As a control plasmid, pCC47, which expresses NifA alone from the same promoter as that in pCC46, was used.

	DISCUSSION

Top Abstract Introduction Materials and methods Results Discussion References

Sequence comparison of GlnB and GlnK proteins. The occurrence of duplicate copies of genes encoding P_II-like proteins now appears to be common among members of the  and  subdivisions of the class Proteobacteria. The tertiary structures of E. coli GlnB and GlnK are very similar, the major differences being in the conformations of the T loops and of C-terminal residues 109 to 112 (57). Nevertheless, under some conditions, GlnB and GlnK are simultaneously expressed in the cell, and this raises questions about their respective roles. The fact that in some organisms, specific phenotypes can be assigned to mutations in glnB demonstrates that, at least in some respects, the two proteins have discrete functions, but the precise function of GlnK is still unclear (2).

Regulation of glnK and amtB. Expression of K. pneumoniae glnK is dependent on ^N and NtrC, as in E. coli, R. etli, A. caulinodans, and A. brasilense (glnZ) (13, 38, 53, 56). The functionality of the proposed ^N promoter in K. pneumoniae glnK was supported by transcript mapping and by analysis of the expression of a pglnK-lacZ fusion which showed a significant level of expression under nitrogen-sufficient conditions that was still NtrC dependent. Very similar results were reported for the A. caulinodans glnK-amtB promoter (38) and for A. brasilense glnZ expression (13). These data suggest that pglnK could be activated by low levels of NtrC-P present under nitrogen-sufficient growth conditions. However, studies with single-copy chromosomal lacZ fusions to the E. coli glnK promoter did not show such expression (2, 51). Our observation of pglnK-lacZ expression in ammonia may be a consequence of NtrC titration by the fusion plasmid, and indeed, we recognize that regulation in this system may be very sensitive to gene expression levels and copy number. A mutation in glnK did not affect pglnK-lacZ expression, indicating that GlnK is not autoregulatory.

Role of GlnK in nitrogen fixation. The NifL protein of K. pneumoniae was first implicated in nif-specific nitrogen regulation by Merrick et al. (34), but the means by which NifL senses the nitrogen status of the cell has remained elusive. Our previous studies indicated that neither uridylyltransferase (GlnD) nor the P_II protein (GlnB) was directly involved in the regulation of NifL activity in response to nitrogen status. We concluded that another nitrogen-sensing component, possibly an alternative P_II-like protein, might be responsible (19, 24), and we have now shown that this is so.