Journal of Bacteriology, February 1999, p. 1324-1329, Vol. 181, No. 4
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
The Enterococcus faecalis pyr Operon Is
Regulated by Autogenous Transcriptional Attenuation at a Single
Site in the 5' Leader
Sa-Youl
Ghim,
Charles C.
Kim,
Eric R.
Bonner,
John N.
D'Elia,
Gail K.
Grabner, and
Robert L.
Switzer*
Department of Biochemistry, University of
Illinois, Urbana, Illinois 61801
Received 3 August 1998/Accepted 11 December 1998
 |
ABSTRACT |
The 5' end of the Enterococcus faecalis pyr operon
specifies, in order, the promoter, a 5' untranslated leader, the
pyrR gene encoding the regulatory protein for the operon, a
39-nucleotide (nt) intercistronic region, the pyrP gene
encoding a uracil permease, a 13-nt intercistronic region, and the
pyrB gene encoding aspartate transcarbamylase. The 5'
leader RNA is capable of forming stem-loop structures involved in
attenuation control of the operon. No attenuation regions, such as
those found in the Bacillus subtilis pyr operon, are
present in the pyrR-pyrP or pyrP-pyrB
intercistronic regions. Several lines of evidence demonstrate that the
E. faecalis pyr operon is repressed by uracil via
transcriptional attenuation at the single 5' leader termination site
and that attenuation is mediated by the PyrR protein.
| |
TEXT |
The pyrimidine nucleotide
biosynthetic (pyr) operon in Bacillus subtilis is
regulated by an autogenous transcriptional attenuation mechanism in
which the first gene of the operon, pyrR, encodes a
regulatory protein that causes transcriptional termination by binding
in a uridine nucleotide-dependent manner to three specific sites in the
pyr mRNA (9, 19, 21). These sites are located in
the 5' untranslated leader of the operon, between the first (pyrR) and second (pyrP) cistrons, and between
the second and third (pyrB) cistrons of the operon (11,
21). The same arrangement of genes and regulatory sites is found
in the Bacillus caldolyticus pyr operon (4, 5). A
similar attenuation mechanism appears to regulate pyr genes
in Lactococcus lactis (1) and in
Lactobacillus plantarum (2), but different
organizations of the pyr genes and attenuation sites are
found in these cases. Regulation of pyr genes by
transcriptional attenuation in bacteria has been reviewed by Switzer et
al. (19).
The occurrence of transcriptional attenuation mechanisms for regulating
pyr genes in various gram-positive bacteria suggests that
they might also be found in medically important gram-positive pathogenic genera. A strong indication that such is the case was provided by the work of Li et al. (8), who showed that the pyr genes in Enterococcus faecalis are organized
into a cluster like that found in Bacillus spp. and that the
sequence of a portion of the first gene in the cluster indicated its
probable identity as a PyrR regulatory protein homologue. The sequence
data were not sufficiently complete to allow further characterization
of the regulation, however. As pointed out by Li et al. (8),
enterococci are a frequent cause of serious infections, and
antibiotic-resistant strains present a growing problem in therapy.
Since a capacity for de novo pyrimidine biosynthesis is required for
the virulence of some bacteria (3), an understanding of the
regulation of this pathway in enterococci may aid in development of
novel approaches to controlling their virulence.
Structure of the 5' end of the E. faecalis pyr gene
cluster.
E. faecalis DNA specifying the 5' end of the
pyr gene cluster was subcloned from the pBEM215 plasmid,
kindly provided by Barbara E. Murray (8), and the nucleotide
sequence of a 2.6-kbp contiguous segment was determined (Fig.
1). A putative promoter with good matches
to consensus sequences for gram-positive bacterial promoters (Fig. 1)
is followed by a 400-nucleotide (nt) untranslated leader sequence that
precedes the first open reading frame, which encodes a PyrR homologue.
It should be noted that at least two other regions downstream from this
putative promoter site also fit reasonably well to promoter consensus
sequences, but the promoter shown in Fig. 1 was selected as more
probable because its location predicts the length of the attenuated
transcript from the 5' end of the operon that was detected on Northern
blot analysis, as described below. In analogy to the sequence of the 5'
end of pyr mRNA from B. subtilis (10,
21), the 5' leader mRNA can be folded into three hairpin
secondary structures (Fig. 2) whose
positions and sequences suggest that they are capable of functioning as
a transcription terminator, an antiterminator, and an
anti-antiterminator (Fig. 1). The terminator is a typical RNA hairpin
structure with a stem rich in G-C base pairs, followed on the 3' side
by a series of U residues in the mRNA (Fig. 2). The upstream
antiterminator is predicted to form a large hyphenated hairpin (Fig.
2). The trailing strand of the stem of this structure overlaps the 5'
strand of the terminator, so that formation of the antiterminator
structure would prevent the terminator from forming, as is typical of
attenuation systems of this type (19). The
anti-antiterminator hairpin is formed by alternative folding of the 5'
strand of the antiterminator structure (Fig. 2), so that its formation
would disrupt base pairing in the antiterminator stem and release the
nucleotides needed to form the terminator. Furthermore, the sequence of
nucleotides in the terminal loop of the anti-antiterminator
(CCUUUAAGUUUAGUCCCGUGAGGCUAGGAAGGA) fits well with the consensus sequence (underlined) in the same position of 10 other known pyr anti-antiterminator
structures. This region of B. subtilis pyr mRNA is the site
of binding of the PyrR regulatory protein (10, 20).
View larger version (58K):
[in this window]
[in a new window]
|
FIG. 1.
Nucleotide sequence of the DNA encoding the 5' end of
the E. faecalis pyr operon. Deduced amino acid sequences for
the protein encoded by the pyrR gene, the 5' and 3' ends of
the pyrP gene, and the 5' end of the pyrB gene
are shown in single letter code below the DNA sequences of the genes,
with the start codons in boldface type and putative ribosome binding
sites (RBS) underlined. Transcription termination codons are indicated
with asterisks. The presumed promoter for the operon is shown in
boldface type, consensus RNA polymerase recognition elements are
indicated with " 35" and "10," and the likely start of
transcription is designated "+1." The sequences specifying the
proposed anti-antiterminator and terminator stem-loop structures in
pyr mRNA are indicated in boldface type, and the sequence
specifying the proposed antiterminator stem-loop is underlined. The
sequence complementary to the deoxyribonucleotide probe, probe 1, used
in Northern hybridization analysis (Fig. 3) is indicated with a dashed
line.
|
|
View larger version (16K):
[in this window]
[in a new window]
|
FIG. 2.
Postulated secondary structures in the E. faecalis
pyr 5' leader mRNA. The anti-antiterminator and terminator
structures can exist simultaneously, but both are disrupted by
formation of the antiterminator structure. The RNA sequences denoted by
the lightly shaded bars are identical, as are those denoted by the
darkly-shaded bars, demonstrating that the two alternative sets of
secondary structures are mutually exclusive.
|
|
The first open reading frame, pyrR, is preceded by an
appropriately located ribosome binding site and encodes a protein of 178 residues with 60 and 73% amino acid sequence identity to the PyrR
proteins from B. subtilis and L. plantarum,
respectively. Several other bacterial PyrR sequences are compared to
the E. faecalis PyrR sequence in reference
19. The pyrR gene is separated from the
downstream open reading frame, pyrP, by a 39-nt
intercistronic region, which is not predicted to fold into any of the
secondary structures needed to form a functional attenuation region.
The pyrP open reading frame is preceded by a ribosome
binding site and is composed of 419 codons. The PyrP protein is
identifiable as a uracil permease from its sequence similarity to other
known uracil permeases (4, 21). A hydropathy plot (not
shown) of the deduced amino acid sequence of E. faecalis
PyrP predicts that it, like other uracil permeases, is capable of
forming 12 hydrophobic transmembrane helices. The pyrP gene
is separated from the downstream gene, pyrB, encoding
aspartate transcarbamylase, by only 13 nt. This intercistronic region
also lacks the structural features of an attenuation region. Thus, the
5' end of the E. faecalis pyr operon differs from the
corresponding regions from the pyr operons of other bacteria
(19) in one important respect: the E. faecalis
pyr operon has only one attenuation region, which is located in
its 5' untranslated leader.
Repression of E. faecalis pyr genes by uracil in vivo.
E. faecalis OG1RF, kindly provided by Barbara E. Murray, was
grown on the defined medium described by Murray et al. (14) with or without supplementation with 150 µg of uracil per ml. The
cultures were grown with a 3% inoculum from a beef heart infusion culture. The cells were harvested after 2.5 h of growth at 37°C and disrupted by sonic oscillation, and the centrifuged extracts were
assayed for aspartate transcarbamylase activity by the procedure of
Shindler and Prescott (17). The specific activity of the cells grown without uracil (140 nmol of
carbamyl-L-aspartate per min per mg of protein) was 30 times that of cells grown in uracil-supplemented medium (4.5 nmol of
carbamyl-L-aspartate per min per mg of protein). This
clearly documents that expression of the E. faecalis pyr operon is repressed by exogenous uracil.
To determine whether repression results from transcriptional
attenuation, as proposed in the preceding paragraph, total RNA was
extracted (16) from strain OG1RF cells grown with and
without 150 µg of uracil per ml of medium, as described above. This
RNA was subjected to electrophoresis, the electropherogram was blotted, and the blot was probed with 32P end-labeled
deoxyribonucleotides (12) which were complementary to
E. faecalis pyr mRNA nt 227 to 299 (probe 1, complementary to the 5' leader transcript upstream of the putative transcription terminator [Fig. 1]) and nt 2367 to 2428 (probe 2, complementary to
the pyrB open reading frame [not shown]). Thus, probe 1 is expected to hybridize to all pyr transcripts, whereas probe
2 should not hybridize to those transcripts that are terminated within
the 5' leader. As seen in the Northern blot (Fig.
3), probe 1 detected a short transcript
(estimated at about 270 nt) in uracil-grown cells and a somewhat
smaller amount of the same transcript (about 90% of the amount found
in uracil-grown cells) and small amounts of much longer transcripts in
the cells grown without uracil. Probe 2 hybridized only to the longer
transcripts, as expected, and these were detected only in cells grown
without uracil. The length of the short transcript is consistent with
the postulated transcription start site and terminator location in Fig.
1 (268 nt). These observations are consistent with the presence of a uracil-regulated attenuation site in the 5' leader. The length of the
longest transcript was estimated to be about 9.5 knt, whereas the full
length transcript would be about 11 to 12 knt (8). The range
of sizes of the transcripts detected with probe 2 probably reflects
degradation of the full-length pyr transcript in vivo.
View larger version (66K):
[in this window]
[in a new window]
|
FIG. 3.
Northern hybridization analysis of pyr
transcripts from E. faecalis OG1RF cells grown on medium
(14) with and without 150 µg of uracil per ml. Probe 1 is
complementary to nt 227 to 299 in the 5' leader (Fig. 1), and probe 2 is complementary to nt 2367 to 2428 in the pyrB open reading
frame.
|
|
Transcriptional attenuation by E. faecalis PyrR in
vivo.
To demonstrate the ability of the E. faecalis
PyrR protein to function in vivo as a pyrimidine-responsive attenuation
regulatory protein, we examined its capacity to restore normal
regulation to a B. subtilis strain in which the
pyrR gene has been deleted (21). Aspartate
transcarbamylase activity in this strain is very high and resistant to
repression by exogenous uracil (Table 1).
When the pEFG2 plasmid, which contains the E. faecalis pyr promoter, 5' leader, and pyrR gene inserted into pHPS9
(7), was introduced into the B. subtilis 
pyrR
strain, regulation of the B. subtilis pyr genes by
endogenous and exogenous pyrimidines was observed. The same result was
obtained with pEFG3, in which the same segment of E. faecalis DNA was inserted into pHPS9 in the opposite orientation,
which indicates that expression of E. faecalis pyrR was
driven from the E. faecalis pyr promoter. The ability of the
E. faecalis PyrR protein to regulate transcriptional attenuation in B. subtilis suggests that this protein
regulates its own pyr attenuation by a similar mechanism.
Removal of the attenuator increases production of recombinant
E. faecalis PyrR.
A plasmid was constructed in which
the bulk of the 5' leader region between the pyr promoter
and the pyrR gene was deleted so that no attenuation of
transcription could occur. This plasmid was derived from pEFG1, which
contains a 1.16-kb DNA fragment that specifies the E. faecalis
pyr promoter, 5' leader, and complete pyrR gene in the
pUC18 (15) vector (construction of pEFG1 is described in
Table 1, footnote b). PCR primers were designed for
amplification of all of the pEFG1 DNA except for the attenuation region
between nt 205 and 400 (Fig. 1) by using primers with engineered XbaI 5' ends. The amplified PCR product was digested with
XbaI to generate a linear product with cohesive ends, which
was self-ligated to yield the desired plasmid, pEFG5, identical to the
parent pEFG1 plasmid except for the 195-bp deletion from the
pyr attenuation region. Escherichia coli TG1 was
then transformed with plasmids pEFG5 and pEFG1. A very high level of
PyrR was produced in E. coli TG1/pEFG5; we estimate that as
much as 50% of the cell protein was PyrR (Fig.
4). The fact that much more PyrR was
produced in TG1/pEFG5 cells than in TG1/pEFG1 cells (Fig. 4) indicates
that the attenuation region in the 5' leader functions to reduce
expression of downstream genes.
View larger version (93K):
[in this window]
[in a new window]
|
FIG. 4.
Deletion of pyr attenuation sequences leads
to overproduction of PyrR. Extracts of E. coli TG1
(12) bearing pEFG1, which contains the complete 5' leader,
or pEFG5, from which the leader was deleted, grown to late log phase on
Luria-Bertani medium (13) containing 100 µg of Timentin (a
mixture of ticarcillin and clavulanic acid that was included to help
maintain a high plasmid copy number) per ml, were analyzed by SDS-PAGE.
Triplicate cultures were examined to evaluate reproducibility. The
position of migration of PyrR is shown by the arrow.
|
|
Properties of the purified E. faecalis PyrR
protein.
The pEFG5 plasmid was introduced into E. coli
SØ408 (relA1 rpsL254 metB1 upp-11) (from J. Neuhard,
University of Copenhagen) for overproduction of PyrR, which was
purified by a modification of the procedure developed by Turner et al.
for purification of recombinant B. subtilis PyrR
(20). There were two significant differences in the behavior
of PyrR from these two sources. B. subtilis PyrR
precipitated between 35 and 65% saturation with ammonium sulfate,
whereas greater than 70% saturation was required to precipitate
E. faecalis PyrR. Also, elution of E. faecalis PyrR from Q-Sepharose FF (Pharmacia) required significantly higher NaCl
concentrations than needed to elute B. subtilis PyrR. The purified PyrR was at least 95% pure on sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (not shown).
Purified E. faecalis PyrR was shown by electrophoretic gel
mobility shift analysis, with procedures previously described by Turner
et al. (20), to bind to a 73-nt segment of E. faecalis pyr RNA corresponding to the anti-antiterminator region of the 5'
leader (nt 160 to 232 [Fig. 1]). The pattern of binding was complex
and appeared to consist of two phases (Fig.
5A). The first PyrR-RNA complex formed at
roughly 1 to 5 µM PyrR (50 pM RNA), and a second, more highly shifted
complex formed at higher PyrR concentrations. The second complex is
probably an artifact of PyrR aggregation at the very high
concentrations used in the gel shift assays, because a similar, more
highly shifted complex was formed with B. subtilis pyr
anti-antiterminator RNA when bound to PyrR from either E. faecalis or B. subtilis at concentrations above 5 µM
(data not shown). However, even with such high concentrations of PyrR,
no gel-shifted complexes were detected with the other RNA species
described below (20). Whereas the addition of UMP stimulated
PyrR binding to B. subtilis RNA quite well (next paragraph), it stimulated binding to E. faecalis RNA only slightly. For
example, the levels of RNA bound to 1 µM PyrR were 15% in the
absence of UMP and 24% in the presence of 0.5 mM UMP, as determined
from quantitation of the gel shift pattern in Fig. 5 with a
PhosphorImager.
View larger version (63K):
[in this window]
[in a new window]
|
FIG. 5.
Binding of purified E. faecalis PyrR to
pyr anti-antiterminator mRNA from E. faecalis and
B. subtilis. Electrophoretic gel mobility shift analysis was
used as described by Turner et al. (20) with 50 pM RNA, no
UMP or 500 µM UMP, and the concentrations of purified E. faecalis PyrR shown in the figure. (A) E. faecalis pyr
anti-antiterminator RNA. This RNA was prepared by PCR amplification of
nt 160 to 232 from pEFG1 with an EcoRI site and T7 promoter
on the 5' side and a BamHI site on the 3' side, followed by
ligation into pUC18. The plasmid product was linearized with
BamHI and used as a template for in vitro transcription. The
RNA was isolated as described previously (20). (B) B. subtilis pyr anti-antiterminator RNA from pBSBL2 (20).
The positions of unbound [32P]pyr RNA and the
PyrR-RNA complex after electrophoresis are shown with arrows. Although
it is not shown in this figure, no shift in the RNA was seen when no
PyrR was added.
|
|
We also tested binding of E. faecalis PyrR to an 80-nt
B. subtilis pyr mRNA segment derived from the
pyrR-pyrP intercistronic attenuation region, which contains
the conserved sequence found in the anti-antiterminator identified in
the E. faecalis 5' leader RNA and has been shown to bind
tightly to B. subtilis PyrR (20). PyrR bound much
more tightly to this RNA than to the E. faecalis pyr RNA
described in the preceding paragraph. In this case, only a single
complex was observed (Fig. 5B). The apparent dissociation constants for
the complex were about 270 nM in the absence of UMP and about 4 nM in
the presence of 0.5 mM UMP. The binding of PyrR to the
anti-antiterminator RNA was highly specific. Three control RNAs,
described by Turner et al. (20), all failed to bind
significantly under the same conditions (data not shown).
Purified E. faecalis PyrR catalyzes substantial uracil
phosphoribosyltransferase (UPRTase) activity. At pH 9.2, the pH optimum for UPRTase activity, the maximal velocity at saturating substrate concentrations was 6 µmol per min per mg of protein, a value which is
about 75% of that seen for B. subtilis PyrR at the same pH. As with the UPRTase activity of B. subtilis PyrR
(20), the steady-state kinetics of the E. faecalis PyrR-catalyzed UPRTase fit best to a Ping Pong Bi Bi rate
equation. The UPRTase activity of E. faecalis PyrR was
described by Michaelis constants for uracil and PRPP (5-phosphoribosyl-
-1-pyrophosphate) of 2,500 ± 470 and
750 ± 130 µM, respectively, at pH 9.2. The corresponding values
for B. subtilis PyrR at pH 9.2 were 98 ± 14 µM and
104 ± 14 µM, respectively (20). These very large
values for the Michaelis constants for E. faecalis PyrR,
which are substantially larger than the probable intracellular
concentrations of their corresponding metabolites, lead us to suggest
that the UPRTase activity of PyrR is not physiologically important for
uracil salvage in E. faecalis. The high Michaelis constant
for uracil is not an artifact of assaying the enzyme at pH 9.2, because
this value was much higher (4 ± 0.8 mM) at pH 7.7, and the
maximal velocity was much lower (1.3 µmol per min per mg).
Although the experiments described here do not establish the regulation
of the E. faecalis pyr operon by transcriptional attenuation as fully as has been done with the B. subtilis pyr operon
(9-11, 19-21), our findings make it virtually certain that
essentially the same regulatory mechanism governs pyr operon
expression in both organisms. Since E. faecalis PyrR has
been demonstrated to regulate B. subtilis pyr genes in
response to exogenous pyrimidines in vivo and the Northern maps of
E. faecalis pyr transcripts are consistent with the proposed
attenuation mechanism, there can be little question that PyrR regulates
expression of the E. faecalis pyr operon. E. faecalis PyrR binds to the expected RNA sequences from the
E. faecalis pyr attenuation region in vitro with high specificity. Curiously, E. faecalis PyrR binds the
corresponding RNA from a heterologous B. subtilis
attenuation region much more tightly than the homologous RNA, and only
binding to the heterologous RNA is appreciably stimulated by UMP. The
binding of E. faecalis RNA by E. faecalis PyrR
has not been characterized in detail.
More interesting than the similarities between the systems are their
differences. Operons encoding pyr genes from gram-positive organisms that are regulated by PyrR-dependent attenuation at one
(E. faecalis [this work]), two (L. plantarum,
which lacks a pyrP gene [2]), or three
(B. subtilis [11] and B. caldolyticus [4]) sites in their operons have now
been described. All three arrangements presumably provide adequate
regulation of the pyrimidine biosynthetic enzymes for their host
organisms. Since the effects of pyr attenuators in tandem
are cumulative (11), one would predict that the most
stringent control, as expressed by the ratio of fully derepressed to
fully repressed activity of pyrimidine biosynthetic enzymes, would be
found in the Bacillus species. It is also to be expected
that repression of E. faecalis genes would not be complete;
some transcriptional readthrough of the single attenuator is needed in
all of the species to allow sufficient synthesis of PyrR for regulation
of the operon. Another variant of this theme is found in L. lactis, in which the pyr genes are scattered among
several small operons, at least one of which appears to be regulated by
a single attenuation region in its 5' leader, although the L. lactis pyrR gene has not yet been found (1). The degree
of repressive control by pyrimidines of these various PyrR-dependent
attenuation regions has not been compared quantitatively under
experimentally equivalent conditions. It would be interesting to learn
whether there are quantitative differences among them and, if so,
whether the differences correlate with the predicted stabilities of the
secondary structures which they form.
Nucleotide sequence accession number.
The complete nucleotide
sequence determined in this study has been deposited in the GenBank
database under accession no. AF044978.
| |
ACKNOWLEDGMENTS |
We gratefully acknowledge James H. Hageman for valuable assistance
with preparation of the manuscript and of Fig. 2.
This research was supported by Public Health Service grant GM47112 from
the National Institute of General Medical Sciences. Eric Bonner was
supported by a fellowship from the National Science Foundation.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biochemistry, University of Illinois, 600 South Mathews Ave., Urbana, IL 61801. Phone: (217) 333-3940. Fax: (217) 244-5858. E-mail: rswitzer{at}uiuc.edu.
Present address: Department of Biology, Teacher's College,
KyungPook National University, Buk-Gu, Taegu 702-701, Republic of Korea.
Present address: Department of Microbiology and Immunology,
Stanford University Medical Center, Stanford, CA 94305.
| |
REFERENCES |
| 1.
|
Andersen, P. S.,
J. Martinussen, and K. Hammer.
1996.
Sequence analysis and identification of the pyrKDbF operon from Lactococcus lactis including a novel gene, pyrK, involved in pyrimidine biosynthesis.
J. Bacteriol.
178:5005-5012[Abstract/Free Full Text].
|
| 2.
|
Elagöz, A.,
A. Abdi,
J.-C. Hubert, and B. Kammerer.
1996.
Structure and organisation of the pyrimidine biosynthesis pathway genes in Lactobacillus plantarum: a PCR strategy for sequencing without cloning.
Gene
182:37-43[Medline].
|
| 3.
|
Fields, P. I.,
R. V. Swanson,
C. G. Haidaris, and F. Heffron.
1986.
Mutants of Salmonella typhimurium that cannot survive within the macrophage are avirulent.
Proc. Natl. Acad. Sci. USA
83:5189-5193[Abstract/Free Full Text].
|
| 4.
|
Ghim, S.-Y., and J. Neuhard.
1994.
The pyrimidine biosynthesis operon of the thermophile Bacillus caldolyticus includes genes for uracil phosphoribosyltransferase and uracil permease.
J. Bacteriol.
176:3698-3707[Abstract/Free Full Text].
|
| 5.
|
Ghim, S.-Y.,
P. Nielsen, and J. Neuhard.
1994.
Molecular characterization of pyrimidine biosynthesis genes from the thermophile Bacillus caldolyticus.
Microbiology
140:479-491[Abstract].
|
| 6.
|
Ghim, S.-Y., and R. L. Switzer.
1996.
Characterization of cis-acting mutations in the first attenuator region of the Bacillus subtilis pyr operon that are defective in regulation of expression by pyrimidines.
J. Bacteriol.
178:2351-2355[Abstract/Free Full Text].
|
| 7.
|
Haima, P.,
D. V. Sinderen,
S. Bron, and G. Venema.
1990.
An improved  -galactosidase -complementation system for molecular cloning in Bacillus subtilis.
Gene
93:41-47[Medline].
|
| 8.
|
Li, X.,
G. M. Weinstock, and B. E. Murray.
1995.
Generation of auxotrophic mutants of Enterococcus faecalis.
J. Bacteriol.
177:6866-6873[Abstract/Free Full Text].
|
| 9.
|
Lu, Y., and R. L. Switzer.
1996.
Transcriptional attenuation of the Bacillus subtilis pyr operon by the PyrR regulatory protein and uridine nucleotides in vitro.
J. Bacteriol.
178:7206-7211[Abstract/Free Full Text].
|
| 10.
|
Lu, Y.,
R. J. Turner, and R. L. Switzer.
1996.
Function of RNA secondary structures in transcriptional attenuation of the Bacillus subtilis pyr operon.
Proc. Natl. Acad. Sci. USA
93:14462-14467[Abstract/Free Full Text].
|
| 11.
|
Lu, Y.,
R. J. Turner, and R. L. Switzer.
1995.
Roles of the three transcriptional attenuators of the Bacillus subtilis pyrimidine biosynthetic operon in the regulation of its expression.
J. Bacteriol.
177:1315-1325[Abstract/Free Full Text].
|
| 12.
|
Maniatis, T.,
E. F. Fritsch, and J. Sambrook.
1982.
Molecular cloning: a laboratory manual, p. 4.14.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 13.
|
Miller, J. H.
1972.
Experiments in molecular genetics, p. 353-355.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 14.
|
Murray, B. E.,
K. V. Singh,
R. P. Ross,
J. D. Heath,
G. M. Dunny, and G. M. Weinstock.
1993.
Generation of restriction map of Enterococcus faecalis OG1 and investigation of growth requirements and regions encoding biosynthetic function.
J. Bacteriol.
175:5216-5223[Abstract/Free Full Text].
|
| 15.
|
Norrander, J.,
T. Kempe, and J. Messing.
1983.
Construction of improved M13 vectors using oligonucleotide-directed mutagenesis.
Gene
26:101-106[Medline].
|
| 16.
|
Shimotsu, H.,
M. I. Kuroda,
C. Yanofsky, and D. J. Henner.
1986.
Novel form of transcription attenuation regulates expression of the Bacillus subtilis tryptophan operon.
J. Bacteriol.
166:461-471[Abstract/Free Full Text].
|
| 17.
|
Shindler, D. B., and L. M. Prescott.
1979.
Improvements on the Prescott-Jones method for the colorimetric analysis of ureido compounds.
Anal. Biochem.
97:421-422[Medline].
|
| 18.
|
Spizizen, J.
1958.
Transformation of biochemically deficient strains of Bacillus subtilis by deoxyribonucleate.
Proc. Natl. Acad. Sci. USA
44:1072-1078[Free Full Text].
|
| 19.
|
Switzer, R. L.,
R. J. Turner, and Y. Lu.
1999.
Regulation of the Bacillus subtilis pyrimidine biosynthetic operon by transcriptional attenuation: control of gene expression by an mRNA-binding protein.
Prog. Nucleic Acids Res. Mol. Biol.
62:329-367[Medline].
|
| 20.
|
Turner, R. J.,
E. R. Bonner,
G. K. Grabner, and R. L. Switzer.
1998.
Purification and characterization of Bacillus subtilis PyrR, a bifunctional pyr mRNA-binding attenuation protein/uracil phosphoribosyltransferase.
J. Biol. Chem.
273:5932-5938[Abstract/Free Full Text].
|
| 21.
|
Turner, R. J.,
Y. Lu, and R. L. Switzer.
1994.
Regulation of the Bacillus subtilis pyrimidine biosynthetic (pyr) gene cluster by an autogenous transcriptional attenuation mechanism.
J. Bacteriol.
176:3708-3722[Abstract/Free Full Text].
|
Journal of Bacteriology, February 1999, p. 1324-1329, Vol. 181, No. 4
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Top
Abstract
Text
