INTRODUCTION

Top Abstract Introduction Materials and Methods Results AND Discussion References

Iron is an essential nutrient required by virtually all bacteria (30). Because the concentration of free iron in tissue has been estimated to be as low as 10¹² µM (3), most pathogenic bacteria have developed elaborate mechanisms to obtain iron at concentrations sufficient for growth. One of these mechanisms involves the production of low-molecular-weight chelators, collectively called siderophores. Once complexed with iron, siderophores are transported into cells by specific receptors. Both siderophores and their receptors have been well characterized for gram-negative organisms, but their production and utilization in gram-positive bacteria is less well understood.

The production of siderophores by staphylococcal strains has recently been demonstrated. Staphylococcus hyicus has been shown to produce at least two siderophores, staphyloferrins A and B (8, 17). Both staphyloferrins A and B were also found to be produced by certain strains of Staphylococcus aureus. Recently, Courcol et al. (5) identified a third siderophore produced by S. aureus called aureochelin. Modun et al. (18) described the binding of human transferrin by intact S. aureus cells and identified a 42-kDa protein that is presumably responsible for this binding. In addition, several proteins of unknown function have also been shown to be regulated by the available iron concentration. These include proteins with apparent molecular masses of 120, 88, 57, 35, and 33 kDa (5) and of 36 and 39 kDa (15), all of which are repressed by high iron concentrations.

We report here the molecular cloning and characterization of a locus (called sir, for staphylococcal iron regulated) from S. aureus with homology to the siderophore acquisition locus cbr of Erwinia chrysanthemi. We examined the expression of the product of the first gene in this locus, sirA, under iron-limiting conditions and describe a regulatory region upstream of the gene which is similar to ferric uptake regulator (Fur) boxes of gram-negative bacteria. We also provide evidence that production of this protein correlates with accumulation of siderophore activity in supernatants of S. aureus cultures grown under iron-limited conditions. These results suggest that SirA may be a membrane-associated siderophore-binding protein and may serve as an effective target for antimicrobial agents or vaccines.

(A preliminary account of this work was presented at the 98th General Meeting of the American Society for Microbiology [12].)

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results AND Discussion References

Strains and plasmids. The strains and plasmids used in this study are listed in Table 1. Escherichia coli clones were grown in Luria-Bertani medium containing 50 µg of carbenicillin per ml or on the same medium solidified with 1.5% agar. S. aureus and Staphylococcus epidermidis strains were grown on Trypticase soy agar or in Trypticase soy broth (Difco, Detroit, Mich.) or in defined medium as described below.

Cloning and expression of sirA. The genome of S. aureus ISP3 was sequenced by the whole-genome random-sequencing method essentially as previously described for the sequencing of other microbial genomes (7). An S. aureus homolog of the cbrABC locus of E. chrysanthemi was identified from the collection of genomic DNA sequences based on sequence homology. The open reading frame encoding SirA beginning at amino acid 22 (serine) was amplified by PCR with the N-terminal primer 5' ACTGTCGACCAGTGGGAATTCAAATAAACAATCATC 3' and the C-terminal primer 5' AGTCTGCAGTTTTGATTGTTTTTCAATATTTAAC 3'. The PCR product was digested with the restriction endonucleases SalI and PstI (Boehringer Mannheim, Indianapolis, Ind.), ligated into the same sites in the expression vector pQE10 (Qiagen, Chatsworth, Calif.), and transformed into the E. coli host strain M15(pREP4). The identity of the cloned DNA fragment was verified by completely sequencing both strands of the DNA. A recombinant polyhistidine-tagged SirA fusion protein (His₆SirA) was purified under denaturing conditions by using Ni-nitrilotriacetic acid resin (Qiagen) as described by the manufacturer, and denatured protein was refolded by slowly dialyzing it into phosphate-buffered saline (PBS) (pH 7.5) (33). The purity of the recombinant protein was evaluated by Sypro-Red (Molecular Probes, Eugene, Oreg.) staining of a sodium dodecyl sulfate (SDS)-polyacrylamide gel followed by visualization of the fluorescently stained band on a Storm imaging system and quantitation with ImageQuant software (Molecular Dynamics, Sunnyvale, Calif.) and was determined to be 91.4%. The identity of the recombinant protein was confirmed by N-terminal sequencing of the first 20 amino acids.

Generation of antisera. Polyclonal antiserum to His₆SirA was generated at Covance, Inc. (Denver, Pa.). Briefly, a New Zealand White rabbit was immunized with 250 µg of recombinant protein in Freund's complete adjuvant by intradermal injection. Three and 6 weeks later, the rabbit was boosted with 125 µg of protein in Freund's incomplete adjuvant by subcutaneous injection. The animal was sacrificed, and serum was collected, 14 days following the second boost. As a negative control, antiserum against an irrelevant recombinant histidine-tagged protein from Streptococcus agalactiae was generated in the same way.

Growth of S. aureus under iron-limited conditions. Bacteria were grown in disposable plastic labware in staphylococcal siderophore detection (SSD) medium (15), containing 2 mM KH₂PO₄, 7.9 mM NaCl, 17.2 mM NH₄Cl, 2% (vol/vol) 1.5 M Tris-HCl (pH 8.8) solution, 20 mM glucose, 0.6% (wt/vol) Casamino Acids (Difco), 39 µM tryptophan, 32 µM nicotinic acid, and 6 µM thiamine-HCl. Iron was removed from the medium by treatment with 10 g of Chelex resin (Bio-Rad, Hercules, Calif.) per liter for 1 h at room temperature. The medium was sterilized and the resin was removed by filtration, and MgCl₂ was added to the medium to 50 µM. Inoculum cultures for iron limitation experiments were grown overnight in SSD medium supplemented with 2 µM FeCl₃ at 37°C with shaking (200 rpm) and then diluted 1:100 into fresh medium containing a range of FeCl₃ concentrations. In some experiments, CaCl₂ was also added at concentrations of between 1 and 10 µM. Growth was continued at 37°C for the specified times. Cells were collected by centrifugation. Cell pellets were used for production of cell lysates, while culture supernatants were filtered through a 0.2-µm-pore-size filter and siderophore activity was determined by the chrome azurol S (CAS) assay (25).

SDS-polyacrylamide gel electrophoresis and immunoblot analysis. SDS-polyacrylamide gel electrophoresis was performed with gels purchased from Novex (San Diego, Calif.) or cast by the method of Laemmli (14). Proteins were transferred to nitrocellulose membranes, and unbound membrane sites were blocked with PBS containing 0.1% Triton X-100 (PBS-T) with 5% nonfat dry milk and thimerosol (0.01%). To reduce binding of antibody molecules to protein A in cell lysates of S. aureus, normal human serum was added to the blocking solution to 5% (vol/vol). SirA was detected by incubating the membrane for 1 h at room temperature in His₆SirA-specific rabbit antiserum diluted to 1:20,000 in PBS-T. Bound antibody was detected by incubation for 1 h at room temperature with a goat anti-rabbit immunoglobulin G alkaline phosphatase-conjugated secondary antibody diluted 1:10,000 in PBS-T or with a goat anti-rabbit immunoglobulin G horseradish peroxidase-conjugated secondary antibody diluted 1:20,000 in PBS-T (both from Kirkegaard & Perry Laboratories, Gaithersburg, Md.). Alkaline phosphatase activity was visualized fluorescently by using Vistra reagent (Amersham, Arlington Heights, Ill.) and a Storm imaging system. Horseradish peroxidase was detected by exposure to film with ECL reagent (Amersham). Molecular weight markers (Rainbow markers) were purchased from Amersham.

Detection of siderophore activity. Siderophore activity in culture supernatants was estimated by the liquid CAS assay described by Schwyn and Neilands (25). Five-hundred-microliter portions of culture supernatants, or dilutions of supernatants, were mixed with 500 µl of CAS assay solution. Ten microliters of 0.2 M 5-sulfosalicylic acid was then added, and after 5 min of incubation at room temperature, the absorbance at 630 nm was determined. SSD medium was used as a blank, and deferroxamine mesylate (Sigma, St. Louis, Mo.) was used as a reference standard for siderophore activity.

Fur titration assay. To determine whether the presumptive regulatory sequence upstream of the sirA gene is recognized by the ferric uptake regulator (Fur) protein of E. coli, a Fur titration assay as described by Stojiljkovic et al. (26) was utilized. Oligonucleotide pairs (Fur 7 and Fur 8) were designed to encode the E. coli Fur box designated Fur1 by Stojiljkovic et al. (26) (5' AATTCGAGATAATGAGAATCATTTTCACG 3' [Fur 7] and 5' GTGAAAATGATTCTCATTATCTCG 3' [Fur 8]), the sirA Fur box-like sequence (Fur 9 and Fur 10) (see Fig. 2A) (5' GATAATGATTCTCATTGTCG 3' [Fur 9] and 5' AATTCGACAATCAGAATCATTATCG 3' [Fur 10]), or a scrambled version of the sirA Fur box-like sequence (Fur 11 and Fur 12) (5' TATAATGATTCTGTTACTCG 3' [Fur 11] and 5' AATTCGAGTAACAGAATCATTATCG 3' [Fur 12]). The oligonucleotides were designed to generate restriction endonuclease site 5' overhangs when annealed to their complementary strands (Fur 7, 10, and 12 contain an EcoRI overhang [single underline], and Fur 8, 9, and 11 contain a BamHI overhang [double underline]). Oligonucleotides (0.25 pmol each) were annealed to their complementary pairs (Fur 7 to Fur 8, Fur 9 to Fur 10, and Fur 11 to Fur 12) by being placed in boiling water for 5 min and then allowed to cool slowly to room temperature. Double-stranded oligonucleotides were then ligated into the vector pUC18, which had previously been digested with BamHI and EcoRI, by using standard cloning techniques (23) and then were transformed into E. coli XL1-Blue (Stratagene, La Jolla, Calif.). Inserts were confirmed by PCR and DNA sequencing, and the plasmids were isolated and transformed by electroporation into E. coli H1717 (26). Transformants were selected on Luria-Bertani agar containing carbenicillin (50 µg/ml) and then streaked onto MacConkey agar plates (Difco) containing carbenicillin and 20 µM Fe(NH₄)₂(SO₄)₂. Cultures were incubated overnight at 37°C and examined for brick-red colonies, indicating fermentation of lactose.

Detergent extraction and phase partitioning. A mid-log-phase culture of S. aureus 8325-4 was harvested by centrifugation, washed two times in PBS-T, and resuspended in 800 µl of PBS. Cells were lysed by incubation at 37°C with 50 µg of lysostaphin (Applied Microbiology, Inc., Tarrytown, N.Y.) followed by sonication. Triton X-114 phase partitioning was performed essentially as described by Stover et al. (27). Proteins in cellular fractions were precipitated with acetone and suspended in Laemmli sample buffer, and aliquots were subjected to electrophoresis on SDS-polyacrylamide gels followed by Western blotting.

Nucleotide sequence accession number. The nucleotide sequence described here has been deposited with GenBank and is available under accession number AF079518.

	RESULTS AND Discussion

Top Abstract Introduction Materials and Methods Results AND Discussion References

Identification and analysis of the sir locus. Analysis of the S. aureus ISP3 genome revealed a locus containing three open reading frames with homology for siderophore transport genes in other bacteria. This locus was designated sir (for staphylococcal iron regulated) because of its presumed role in iron uptake. Analysis of the deduced amino acid sequences of the open reading frames revealed that they are most homologous to an iron acquisition locus termed cbr that was previously identified in the plant pathogen E. chrysanthemi (16) (Fig. 1). Iron-mediated control of gene expression in E. chrysanthemi is regulated, at the transcriptional level, by the intracellular iron concentration, which is indirectly dependent on the cbr locus. The cbr locus contains four genes encoding proteins involved in the transport of siderophores. These include cbrA (encoding a periplasmic component), cbrB and cbrC (encoding integral membrane proteins), and cbrD (encoding an ATP-binding protein) (16). This transporter allowed for the accumulation of iron by E. chrysanthemi, via a siderophore distinct from the previously described chrysobactin, when the medium was supplemented with iron as ⁵⁹FeCl₃ or ⁵⁹Fe dicitrate.

View larger version (69K): [in this window] [in a new window]   FIG. 1.   (A) Genetic organization of the sir and cbr loci. The three open reading frames encompassing the sir locus and four open reading frames contained within the cbr locus are indicated. Open reading frames with significant amino acid sequence homology are shown with identical shading patterns. The location of the putative sirA Fur box-like sequence is indicated. (B) Comparison of SirA and CbrA amino acid sequences. The deduced amino acid sequence of SirA was aligned to the CbrA sequence by using the BestFit analysis program of the Wisconsin Sequence Analysis Package (version 8.0). Identical residues are indicated by vertical lines.

View larger version (56K): [in this window] [in a new window]   FIG. 2.   (A) Analysis of the putative sirA Fur-binding site. An alignment of the presumptive Fur regulon-binding site (Fur box) of the sirA gene against two proposed Fur boxes of the B. subtilis fhuD gene (24) and the E. coli consensus binding site (6) is shown. Nucleotides that are identical to the E. coli sequence are boxed. (B) Nucleotide and deduced amino acid sequences of sirA. The putative Fur box and Shine-Dalgarno (SD) sequences are indicated. The proposed lipoprotein signal sequence is shown, and the cysteine residue that presumably becomes lipid modified is indicated with an arrowhead.

Evidence for posttranslational modification of SirA. Immunoblot analysis of cell lysates of S. aureus 8325-4 with rabbit polyclonal antiserum generated against recombinant SirA revealed a single band of 37 kDa. Phase partitioning of the Triton X-114-solubilized proteins revealed that SirA was amphipathic, being found predominantly in the detergent phase (Fig. 3). However, Kyte-Doolittle analysis of the SirA sequence predicted that SirA is fairly hydrophilic overall (results not shown). These observations were similar to those made for other bacterial lipoproteins (1, 21) and suggested that the presumptive signal peptidase II cleavage site at cysteine 21 was indeed acylated by S. aureus, thereby conferring an amphipathic character to the native SirA molecule.

View larger version (54K): [in this window] [in a new window]   FIG. 3.   Fractionation of proteins from whole-cell lysates of S. aureus 8325-4 by phase partitioning with the detergent Triton X-114. Proteins in cellular fractions were analyzed by Western blotting with rabbit polyclonal antisera generated against the recombinant SirA protein or against an irrelevant recombinant protein cloned from S. agalactiae. The filled arrow indicates the position of SirA. The higher-molecular-weight band (open arrow) is presumably due to binding of the antibody molecules to protein A. Lane His6SirA, 100 ng of recombinant SirA; lane MW, molecular weight markers (in thousands).

Growth of S. aureus and S. epidermidis under iron-limited conditions. To evaluate the expression of SirA under iron-limited conditions, S. aureus 8325-4, growing in SSD medium under iron-replete conditions (2 µM FeCl₃), was subcultured in minimal medium supplemented with FeCl₃ to iron concentrations of between 0.05 and 10 µM. Cell lysates were made and normalized for cell numbers. Lysates were examined for the presence of SirA by immunoblotting with rabbit antiserum raised against the recombinant protein. A dramatic increase in production of this protein under low-iron conditions was observed (Fig. 4). Production of SirA was nearly completely repressed in this culture medium at iron concentrations of 5 µM. Since Chelex treatment may have also removed other divalent cations, such as Ca²⁺, from the SSD medium, we examined the effect of Ca²⁺ supplementation on production of SirA. Supplementation of culture medium with CaCl₂, at levels of between 1 and 10 µM, had no effect on the production of SirA (results not shown).

View larger version (45K): [in this window] [in a new window]   FIG. 4.   Expression of SirA under reduced-iron conditions. S. aureus 8325-4 was grown for 8 or 25 h in deferrated minimal medium supplemented with FeCl3 at concentrations of between 0.05 and 10 µM. SirA was detected in cellular lysates with rabbit polyclonal antiserum raised against His6SirA. Lane His6SirA, 100 ng of recombinant protein.

View larger version (55K): [in this window] [in a new window]   FIG. 5.   Expression of a SirA homolog in S. epidermidis. S. epidermidis 35984 was grown in deferrated minimal medium supplemented with either 1 or 10 µM FeCl3. Cells were normalized for optical density and lysed, and expression of the SirA homolog was determined by Western blotting. Lane His6SirA, 100 ng of recombinant SirA.

Correlation of siderophore activity in culture supernatants with SirA expression. The CAS assay was employed to detect and quantify the accumulation of siderophore activity in culture supernatants of S. aureus. In this assay, a decrease in absorbance indicates the presence of siderophore activity which competes with the CAS dye for binding iron. The production of siderophore activity decreased with increasing concentrations of iron and approached baseline levels at 1 µM iron or greater (Fig. 6A). Decreasing concentrations of iron in culture media had little effect on the growth rate of the bacteria throughout the logarithmic and stationary phases under these conditions (Fig. 6B). The increase in the levels of siderophore activity paralleled an increase in the intensity of bands in immunoblots probed with antiserum specific for SirA (Fig. 4). At iron concentrations of 1 µM or higher, no siderophore activity could be detected by the CAS assay at any time point during growth. Cell lysates of S. aureus cells grown in 1 µM iron still produce a considerable amount of SirA. This may reflect the different levels of control over expression of SirA and siderophore activity or may be due to a relative insensitivity of the CAS assay for staphylococcal siderophore detection. It is also true that the CAS assay indicates the total siderophore activity, which, in this strain of S. aureus, is probably contributed to by more than one type of siderophore (8). The correlation of siderophore production with SirA translation suggests that these two functions may be physiologically related. However, confirmation of the function of SirA awaits identification of the individual siderophore which is presumably transported by this protein.

View larger version (19K): [in this window] [in a new window]   FIG. 6.   (A) Expression of siderophore activity by S. aureus 8325-4. Bacteria were grown in deferrated minimal medium supplemented with FeCl3. At 6, 8, 25, and 48 h of growth, bacteria were removed by centrifugation and siderophore activity present in culture supernatants was detected by the CAS assay (25). (B) Growth was monitored by measuring the absorbance at 600 nm.

Evaluation of the Fur-like box in E. coli. At the outset of these studies, an S. aureus homolog of the E. coli Fur repressor had not been identified but was presumed to exist. We used a Fur activity reporter system in a heterologous E. coli background to evaluate the functionality of the presumptive operator region upstream of the sirA gene (26). A synthetic DNA fragment encompassing the putative Fur-like box upstream of sirA was cloned into pUC18. In addition, the DNA sequence of the putative operator was scrambled and cloned to serve as a negative control. Plasmids containing these synthetic DNA fragments were transformed into the E. coli reporter strain H1717 to determine whether the potential sirA operator sequences contained on a multicopy plasmid could successfully compete for binding of the E. coli Fur protein to the promoter region of the chromosomally encoded fhuF::lacZ fusion. Titration of the Fur protein away from the fhuF::lacZ operator leads to derepression of transcription and expression of the lacZ gene, encoding -galactosidase activity. When E. coli H1717(pFur9,10), containing a DNA fragment encompassing the putative sirA Fur-binding site, was streaked to a MacConkey agar plate containing 20 µM ferrous ammonium sulfate, the resulting brick-red colonies surrounded by red-pigmented agar indicated that they were capable of fermenting lactose (Fig. 7). These results were similar to those with E. coli H1717(pFur7,8) carrying pUC18 containing the Fur box described by Stojilkovic et al. (Fur1) (26). Neither E. coli H1717(pFur11,12), which contained a scrambled S. aureus Fur box in pUC18, nor E. coli H1717 carrying pUC18 without an insert was able to derepress expression of the lacZ reporter gene, suggesting that the correct sequence of the SirA Fur box was essential for derepression, presumably through binding of the Fur protein in the H1717 host strain.

View larger version (153K): [in this window] [in a new window]   FIG. 7.   Fur titration analysis of the cloned S. aureus Fur-like sequence in the E. coli reporter strain H1717. E. coli H1717 clones were streaked to MacConkey agar plates supplemented with 20 µM ferrous ammonium sulfate and carbenicillin. Clockwise from top: pFur9,10 (sirA Fur-like sequence), pFur11,12 (scrambled sirA), pFur7,8 (E. coli Fur box), and pUC18 without an insert.