Previous Article | Next Article 
Journal of Bacteriology, March 1999, p. 1474-1480, Vol. 181, No. 5
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
An Lrp-Like Protein of the Hyperthermophilic
Archaeon Sulfolobus solfataricus Which Binds to Its
Own Promoter
Alessandra
Napoli,1
John
van der Oost,2
Christoph W.
Sensen,3
Robert L.
Charlebois,4
Mosé
Rossi,1 and
Maria
Ciaramella1,*
Institute of Protein Biochemistry and
Enzymology, Consiglio Nazionale delle Ricerche, 80125 Naples,
Italy1; Department of Microbiology,
Wageningen Agricultural University, Wageningen 6703 CT, The
Netherlands2; and Institute for
Marine Biosciences, National Research Council of Canada, Halifax, NS,
B3H 3Z1,3 and Department of Biology,
University of Ottawa, Ottawa, Ontario K1N 6N54
Canada
Received 20 October 1998/Accepted 21 December 1998
 |
ABSTRACT |
Regulation of gene expression in the domain Archaea,
and specifically hyperthermophiles, has been poorly investigated so
far. Biochemical experiments and genome sequencing have shown that, despite the prokaryotic cell and genome organization, basal
transcriptional elements of members of the domain Archaea
(i.e., TATA box-like sequences, RNA polymerase, and transcription
factors TBP, TFIIB, and TFIIS) are of the eukaryotic type. However,
open reading frames potentially coding for bacterium-type transcription
regulation factors have been recognized in different archaeal strains.
This finding raises the question of how bacterial and eukaryotic
elements interact in regulating gene expression in Archaea.
We have identified a gene coding for a bacterium-type transcription
factor in the hyperthermophilic archaeon Sulfolobus
solfataricus. The protein, named Lrs14, contains a potential
helix-turn-helix motif and is related to the Lrp-AsnC family of
regulators of gene expression in the class Bacteria. We
show that Lrs14, expressed in Escherichia coli, is a highly
thermostable DNA-binding protein. Bandshift and DNase I footprint
analyses show that Lrs14 specifically binds to multiple sequences in
its own promoter and that the region of binding overlaps the TATA box,
suggesting that, like the E. coli Lrp, Lrs14 is
autoregulated. We also show that the lrs14 transcript is
accumulated in the late growth stages of S. solfataricus.
| |
INTRODUCTION |
In the last few years, it has been
clearly shown that the basal transcription apparatus of the domain
Archaea is of a eukaryotic type. Indeed archaeal promoter
sequences and core proteins (RNA polymerase, transcription factors TBP,
TFIIB, and TFIIS) are structurally and functionally related to their
eukaryotic counterparts (recently reviewed in references
27 and 30).
In particular, a TATA box-like element is typically found about 25 bp
upstream of transcription start sites; this sequence is sufficient, in
the presence of purified TBP, TFIIB, and RNA polymerase, for correct in
vitro transcription initiation in cell-free transcription systems.
In the current view, the transcription initiation complex in
Archaea is a simple, ancient version of the eukaryal one and is composed of only absolutely essential factors
the starting point
for the evolution of the actual, complex eukaryotic transcription machinery. However, several lines of evidence suggest that this might
be an oversimplification. Regulation of gene expression in
Archaea, and specifically hyperthermophiles, has been poorly investigated; in the few examples reported so far, no eukaryote-type regulation factor (such as enhancer or silencer binding proteins) has
been described, and no clear evidence of DNA sequences (besides the
TATA box) involved in transcription regulation has been provided.
Instead, from the emerging sequences of archaeal genomes, a large
number of open reading frames (ORFs) potentially coding for
bacterium-type transcription regulation factors has been identified (3, 17, 29). This finding suggests that bacterium- and eukaryote-type elements cooperate in the regulation of gene expression in Archaea. Given the chimeric nature of the archaeal
transcription apparatus, neither the bacterial nor the eukaryotic model
can be simply applied to the regulation of gene expression in these organisms. Regulatory circuits need to be elucidated to explain the
interplay among eukaryote- and bacterium-type elements.
Putative homologs of the leucine-responsive regulation protein of
Escherichia coli (Lrp) have been found in
Archaea. Lrp is the prototype, and most extensively studied
member, of the Lrp-AsnC family of regulators of gene expression in both
Gram-positive and Gram-negative bacteria (reviewed in references
4 and 23). Lrp is a homodimer
containing two identical subunits of 18 kDa, and it acts either as an
activator or as a repressor on a number of different genes and operons.
Besides its role as a specific transcriptional regulator, Lrp also acts
as a chromosomal organizer, inducing conformational changes in DNA and
promoting the formation of higher-order DNA-protein complexes
(32).
ORFs potentially coding for Lrp-AsnC homologs are widely distributed in
the archaeal domain, since they have been found in the following
members of two distant subdomains, Crenarchaeota and
Euryarchaeota: Sulfolobus acidocaldarius
(reported as S. solfataricus in reference
6 and corrected in reference 5);
Sulfolobus solfataricus (10), Pyrococcus
furiosus (9, 20), Methanococcus jannaschii
(3), and Archaeoglobus fulgidus (17).
Interestingly, they are present in multiple copies within the same
genome. No functional studies of such proteins have been published so far.
We have identified in the genome of the hyperthermophilic archaeon
S. solfataricus a gene coding for a bacterium-type
transcription factor we named Lrs14, which is distantly related to the
Lrp-AsnC family. Lrs14, expressed in E. coli, is a highly
thermostable DNA-binding protein which binds to specific sequences in
its own promoter. Characterization of the Lrs14 DNA-binding activity in vitro and analysis of the lrs14 gene transcription in vivo
are presented in this report.
| |
MATERIALS AND METHODS |
DNA manipulations.
All enzymatic DNA reactions were
performed according to standard techniques. DNA fragments and
oligonucleotides were end labelled either with
[
-32P]ATP and T4 polynucleotide kinase or with the
Klenow enzyme and the appropriate 32P-labelled
deoxynucleotide. DNA amplifications were obtained by standard
techniques using the Pfu DNA polymerase (Stratagene); amplified fragments were always checked by DNA sequencing. For nucleic
acid hybridization, DNA probes were labelled with the Random Primer kit
from Boehringer; RNA probes were obtained with T7 RNA polymerase as
reported previously (26).
Cloning of the lrs14 gene.
The ORF coding for
Lrs14 was identified during the sequencing of the S. solfataricus (P2 strain) genome; the gene lrs14 was amplified from S. solfataricus MT4 DNA by using the
oligonucleotides N-FULL (5'CGGGATCCAATGCAAGTAGAGAATATAAG)
and C-FULL (5'CTGTCGACTTACTTTTCTTTCAATTCTTG), which
match the 5'- and the 3'-terminal ends of the coding sequence, respectively, with the addition of a BamHI site tail at the
5' end and a SalI site tail at the 3' end. The
BamHI-SalI fragment was subcloned in vector pGEM3
(Promega), producing plasmid pGEM-Hom; the insert of this plasmid was
checked by DNA sequencing.
Computer analysis.
The deduced protein sequence of Lrs14 was
compared with those in the Swiss Prot, PIR, and GenBank-EMBL libraries
by using standard software (programs FASTA, BLAST, and Gapped-BLAST).
The programs MultALIN (7) and CLUSTALW were used to obtain
sequence alignments. The program HTH, available at the NPSA server
(22a), has been used to predict the helix-turn-helix motif
(8).
Northern analysis.
S. solfataricus cultures (500 ml)
were grown at different optical densities at 600 nm
(OD600s) as indicated; RNA was extracted and analyzed as
previously described (26). The amount of RNA loaded was
normalized by the fluorescence of rRNAs in ethidium bromide-stained
gels and by staining the filters with methylene blue. The same filters
were hybridized sequentially with the 390-bp BamHI-SalI DNA fragment from pGEM-Hom, which
contains the whole lrs14 coding sequence, labelled by random
primer, and with a riboprobe prepared from the 185-bp
HindIII-BglII fragment internal to the lacS gene, as described previously (26).
Purification of Lrs14.
The BamHI-SalI
fragment from pGEM-Hom was subcloned in the
BamHI-XhoI sites of pRSET B (Invitrogen),
producing plasmid pRSET-390. This plasmid (after resequencing of the
insert) was transformed into E. coli JM109 (DE3). Protein
purification through Ni-nitrilotriacetic acid (NTA)-agarose (Qiagen)
was performed with modifications of the manufacturer's protocol.
Briefly, a 1-liter culture was grown at an OD600 of 0.9 in
Luria-Bertani medium supplemented with 50 µg of ampicillin per ml,
induced with 1 mM isopropyl-
-D-thiogalactopyranoside (IPTG), and grown overnight. Cells, together with a 10-ml uninduced sample, were centrifuged for 20 min at 4,000 rpm in a Sorvall GSA
rotor, resuspended in 10 ml of lysis buffer (50 mM
NaH2PO4 [pH 8.0], 300 mM NaCl, 10 mM
imidazole), and broken with a French press. The lysate was clarified by
centrifugation at 10,000 rpm in a Sorvall S534 rotor for 10 min. Three
milliliters of 50% Ni-NTA matrix was added to the supernatant (12 ml),
and the mixture was incubated for 1 h at 4°C with gentle shaking
and packed onto a column. The column was washed with 30 ml of washing
buffer (50 mM NaH2PO4 [pH 8.0], 300 mM NaCl,
20 mM imidazole), and eluted with elution buffer (50 mM
NaH2PO4 [pH 8.0], 300 mM NaCl) containing stepwise increasing amounts of imidazole (50, 150, and 300 mM); fractions were collected and checked by sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Fractions 11 to
13, which eluted at 150 mM imidazole, contained a single 14-kDa protein
band which was absent in other fractions (data not shown); the
fractions were pooled, and protein content was determined by the
Bio-Rad method (2). The total amount of pure Lrs14 recovered
was 1.5 mg.
Bandshift assays.
Standard reaction mixtures (10 µl)
contained 1× binding buffer (20 mM Tris-HCl [pH 7.5], 10% glycerol,
50 mM KCl, 0.1 mM dithiothreitol), purified Lrs14, cold competitor DNA
as indicated, and about 2 × 103 to 5 × 103 cpm of the appropriate end-labelled DNA. After
incubations, samples were immediately loaded on native 5% or 7%
polyacrylamide gels in 0.5× Tris-borate buffer and run at room
temperature. The gels were dried, and the autoradiograms were exposed
at 
80°C. The probes UP and DOWN were obtained by PCR amplification
with the following pairs of primers: 480Hinc (5'AAATCACGTTAACTT)
and 537Nde (5'TTGCATATGAATATAA) and N-FULL
(5'CGGGATCCAATGCAAGTAGAGAATATAAG) and 595Acc
(5'GTGCGTCTACTAATC).
Amplified fragments were end labelled with [-32P]ATP
and T4 polynucleotide kinase. The oligonucleotides cLRS and TATA (see Fig. 3) were purchased from PRIMM (Milan, Italy) and were annealed and
end labelled as previously reported (12).
DNase I footprinting.
A fragment spanning nucleotides 68
to +63 relative to the ATG was amplified by using the oligonucleotides
480Hinc and 595Acc (shown above). The primers were alternatively end
labelled. The Lrs14 protein was preincubated for 1 h at 75°C;
the probe was added, and binding reactions (5' at room temperature)
were performed as described above. DNase I digestion and
electrophoresis were performed as reported previously (32).
Nucleotide sequence accession number.
The nucleotide
sequence data reported in this paper will appear in the DDBL, EMBL, and
GenBank nucleotide sequence databases under accession no. AF098294.
| |
RESULTS |
Identification and transcriptional analysis of lrs14.
During the sequencing of the S. solfataricus genome, we have
identified an ORF, which we named lrs14, potentially coding
for a 123-amino-acid protein (molecular mass of 14 kDa). A database search showed that the predicted Lrs14 protein shares significant sequence similarity with three archaeal hypothetical proteins, and low
similarity with bacterial transcription regulation factors of the
Lrp-AsnC family (Fig. 1). In particular
the protein most similar to Lrs14 is an A. fulgidus ORF
(11) which, in turn, gives a significant hit (E value of
<e-4 in a BLAST search) with established Lrp homologs. Interestingly,
the xylose repressor of Bacillus subtilis (19)
also appears to be related somehow to Sulfolobus Lrs14 and
E. coli Lrp.
View larger version (46K):
[in this window]
[in a new window]
|
FIG. 1.
Alignment of Lrs14 with some of the best matches from a
BLAST search. Shown are results for three sequences of hypothetical
archaeal proteins (MJ Orf, MJO82 in the M. jannaschii
database [3]; Hs Orf, Halobacterium sp.
strain NRC-1 [15]; Af Orf, A. fulgidus
[11]) E. coli Lrp (Ec Lrp
[36]), and the B. subtilis xylose repressor
(Bs XylR; 200 C-terminal amino acids are not shown
[19]). The helix-turn-helix motif of E. coli Lrp (25) and that of Lrs14, predicted by the
program HTH (8), are underlined; asterisks indicate C
termini. Amino acid residues that are identical or similar in at least
three sequences are boxed.
|
|
Figure
1 shows that conservation is higher in a region corresponding to
the helix-turn-helix motif of
E. coli Lrp, which is
responsible for its DNA-binding activity (
25). A potential
helix-turn-helix
motif in the corresponding region of Lrs14 (amino
acids 45 to
66) has been predicted by the program HTH (
8).
We have analyzed the transcription of the
lrs14 gene by
Northern blotting (Fig.
2A). Total RNA
was extracted from
S. solfataricus cells at different growth
stages and was probed with a DNA fragment
corresponding to the
lrs14 coding sequence. The probe hybridizes
to a 0.4-kb-long
transcript, accounting for a monocistronic transcription
of the gene.
This finding suggests that the
lrs14 promoter is
adjacent to
its coding sequence; indeed the sequence TTTATA, which
matches exactly
the consensus for the archaeal TATA box, is located
31 bp upstream of
the presumptive first ATG (Fig.
3), a
distance
rather common in archaeal genes (for a recent review, see
reference
31). This result also suggests that
eventual transcription regulatory
sequences, if present, should be
located within 100 bp upstream
of the coding sequence (see below).
View larger version (29K):
[in this window]
[in a new window]
|
FIG. 2.
(A) Northern blot showing the lrs14
transcript at different growth stages. S. solfataricus RNAs
were extracted from cultures grown at different OD600s:
lane 1, 0.2; lane 2, 0.4; lane 3, 0.6; lane 4, 0.8. The same amount of
RNA (2 µg) was loaded in each lane; the filter was hybridized with
the 390-bp BamHI-SalI DNA fragment from pGEM-Hom,
which contained the whole lrs14 coding sequence. (B) The
same filter was hybridized with a riboprobe prepared from the
HindIII-BglII fragment of the lacS
gene (26).
|
|
View larger version (18K):
[in this window]
[in a new window]
|
FIG. 3.
DNA sequence of the region spanning nt 68 to +63 of
lrs14 relative to ATG, which is indicated by an arrow. The
putative TATA-like sequence is boxed. The probes used in bandshift
analysis are shown as follows: UP, boldface; DOWN, underlined. cLRS and
TATA are the oligonucleotides used in the experiment described in the
legend to Fig. 6. The whole fragment shown, labelled at the 5' end, was
used in the DNase I footprinting experiment; the region protected from
DNase I cleavage is indicated by dashed box underlines.
|
|
RNA samples in Fig.
2 were prepared from cultures grown at
OD
600s of 0.2, 0.4, 0.6, and 0.8, respectively. Despite the
small
difference in OD, these conditions reflect very different growth
stages, since
S. solfataricus has a very slow growth rate
(doubling
time of about 7.5 h in rich medium) and grows at low
density;
in the experiment shown in Fig.
2, the maximal
OD
600 was 0.8,
which was therefore assumed to be stationary
phase. Steady-state
lrs14 RNA shows a growth phase-regulated
pattern: it is undetectable
in the early growth stages (Fig.
2A, lane
1), is highly induced
during the exponential phase (lane 2), and
declines in the late
logarithmic phase (lane 3), but is maintained at
relatively high
levels in the stationary phase (lane 4). This
accumulation in
late stages of growth is specific for the
lrs14 transcript, as
shown by control hybridization of the
same filter with a probe
from the
lacS gene, which is not
expressed at an OD
600 of 0.8
(Fig.
2B) (
26).
Moreover, a transcription pattern similar to
that of
lacS is
shown by the Sso7d gene of
S. solfataricus, coding
for a
nonspecific DNA-binding protein (
22). To our knowledge,
lrs14 is the first
Sulfolobus gene whose
transcript accumulates
in late stages of growth described so far.
Interestingly, the
E. coli Lrp transcription is also
sustained during the stationary
phase (
21).
Lrs14 is a DNA-binding protein which binds to its own
promoter.
In order to characterize the Lrs14 protein, we have
expressed it in E. coli by using vector pRSETB (see
Materials and Methods). In this system, the protein is obtained as a
fusion with a histidine tag at the N terminus, and can be purified by
affinity chromatography on an Ni-NTA-agarose column (14).
Using this single-step purification, we have obtained Lrs14 >95%
pure, as verified by SDS-PAGE (not shown).
The Lrs14 protein purified from
E. coli shows the ability to
bind total
S. solfataricus DNA in nitrocellulose binding
assays
(not shown). In order to characterize its DNA-binding activity,
we needed to identify its target sequences. The
E. coli Lrp
protein
binds to specific sequences in the promoters of many different
genes, including its own (
34); we reasoned that Lrs14 might
have the same autoregulatory
function.
We therefore performed bandshift analysis with a probe spanning 68 bp
immediately upstream of the first ATG of the
lrs14 gene
(probe UP [Fig.
3]). As a control, we used a fragment of similar
length located immediately downstream of the ATG (probe DOWN [Fig.
3]). The purified Lrs14 protein binds to the probe UP (Fig.
4,
lanes 2 to 4), forming a single band
at a low protein concentration
and two bands at increasing protein
concentrations (also described
below). Both bands are specific, since
they do not form with the
probe DOWN (lane 9), and they are effectively
competed by an excess
of cold UP (lanes 5 and 6), but not DOWN (lanes 7 and 8), fragments.
View larger version (32K):
[in this window]
[in a new window]
|
FIG. 4.
Binding of purified Lrs14 expressed in E. coli to the UP and DOWN probes, as analyzed by bandshift assay.
Lanes 1 to 8, probe UP; lane 1, naked probe; lane 2, 0.1 µg of
purified Lrs14; lane 3, 0.6 µg of purified Lrs14; lane 4, 1.2 µg of
purified Lrs14; lanes 5 to 8, 0.6 µg of purified Lrs14 preincubated
with cold competitors; lane 5, 10× excess of UP; lane 6, 100× excess
of UP; lane 7, 10× excess of DOWN; lane 8, 100× excess of DOWN; lanes
9 and 10, probe DOWN; lane 9, DOWN with 1.2 µg of purified Lrs14;
lane 10, naked probe. Prebinding and binding reactions were performed
for 10 min at 25°C and run on 5% polyacrylamide gels.
|
|
Lrs14 is a highly thermostable DNA-binding protein.
S.
solfataricus is a hyperthermophilic microorganism, with optimum
growth temperature above 80°C; to date, only nonspecific DNA-binding
activities from such organisms have been characterized (1,
12). The DNA-binding activity of the S. solfataricus Sso7d protein is not affected by temperatures up to 70°C
(12). In order to test the effect of temperature on the
binding of Lrs14 to DNA, we performed binding experiments at different
temperatures (Fig. 5A). Lrs14 binds with
the same efficiency to the UP probe at 25°C and 65°C; in contrast,
no DNA-protein complex is formed if the reaction is carried out at
70°C. This result might be due to protein inactivation or to local
denaturation of the DNA probe, which is A/T rich (Fig. 3). To test the
thermostability of Lrs14, we incubated the protein in the absence of
DNA at different temperatures; subsequently we added the probe and
carried out the binding reaction at room temperature for 5 min. The
DNA-binding activity of Lrs14 is completely stable to 1 h of
incubation at 85°C (Fig. 5b). Interestingly, we noticed that
incubation at 75°C results in a more efficient binding, and a third,
slower DNA-protein complex appears (also described below). This
observation suggests that the binding activity of Lrs14 is activated by
preincubation at 75°C and can be explained assuming that high
temperatures induce subtle conformational changes in the protein.
Experiments are in progress to determine the effect of high temperature
on the structural stability and flexibility of Lrs14.
View larger version (33K):
[in this window]
[in a new window]
|
FIG. 5.
Lrs14 is a thermostable DNA-binding protein. (A) Binding
of Lrs14 to the probe UP at different temperatures. Lane 1, naked
probe; lanes 2 to 10, 0.8 µg of Lrs14. Lanes 2 to 4 were incubated
for 2, 5, and 10 min, respectively, at room temperature. Lanes 5 to 7 were incubated for 2, 5, and 10 min, respectively, at 65°C. Lanes 8 to 10 were incubated for 2, 5, and 10 min, respectively, at 70°C.
Loss of material occurred in lane 7; repetion showed the same result as
in lane 6. (B) Lrs14 (0.8 µg) was preincubated at the indicated
temperatures for 1 h. Lane 1, room temperature; lane 2, 55°C;
lane 3, 75°C; lane 4, 85°C. The assay for DNA binding with the UP
probe was performed at room temperature for 5 min.
|
|
Lrs14 binds to multiple sites in its promoter.
DNase I
footprinting was performed in order to further define the region of
Lrs14 binding. Lrs14 protects a continuous region of about 60 bp,
spanning from 5 to 60 relative to the ATG (Fig. 6). This extended protection suggests
that Lrs14 might bind to multiple sites in the region.
View larger version (30K):
[in this window]
[in a new window]
|
FIG. 6.
DNase I protection of the lrs14 promoter by
Lrs14. A 130-bp fragment spanning nt 68 to +63 of the
lrs14 gene was labelled at the distal (68) end and
incubated with no protein (lanes 1 and 2) or with 2 µg (lane 3) or 4 µg (lane 4) of Lrs14, preincubated for 1 h at 75°C. After
binding, 10 ng of DNase I was added to lanes 2 to 4; in lane 1, no
DNase was added. GATC indicates a sequence ladder used as a molecular
weight marker. The open bar indicates the region protected by Lrs14.
The position of ATG is indicated.
|
|
To test this hypothesis, we performed a bandshift experiment with
increasing concentrations of Lrs14 (Fig.
7). At a relatively
low protein
concentration, only one complex (I) was formed, whereas
two slower
complexes (II and III) appeared at increasing protein
concentrations;
this result suggests that Lrs14 binds to multiple
sites in the upstream
region of its gene. A similar behavior is
shown by the
E. coli Lrp protein, which binds to several (up to
six) distinct
sites in upstream regions of its target genes, producing
extended
footprints (
28,
33,
34,
35).
View larger version (33K):
[in this window]
[in a new window]
|
FIG. 7.
Binding of different amounts of Lrs14 to the UP probe.
The protein was preincubated for 1 h at 75°C; binding was for 5 min at room temperature. Lane 1, naked probe; lane 2, 0.02 µg of
Lrs14; lane 3, 0.04 µg of Lrs14; lane 4, 0.1 µg of Lrs14; lane 5, 0.2 µg of Lrs14; lane 6, 0.4 µg of Lrs14; lane 7, 0.8 µg of
Lrs14; lane 8, 1.6 µg of Lrs14. In lane 9, 3 µg of Lrs14 was used
in the reaction, but only one-fifth of the sample was loaded in order
to resolve the three complexes.
|
|
The affinity of Lrs14 for its promoter, as calculated from data in Fig.
7, is quite low for a sequence-specific DNA-binding
protein (apparent
Kd of about 5 µM). The
Kd is 2 or 3 orders of
magnitude higher than
that of the
E. coli Lrp (
28,
33,
35),
but is
comparable to that measured for the TATA binding protein
of the
hyperthermophile
Pyrococcus woesei (
24).
Different possibilities
could explain how this low affinity is coupled
with sequence-specific
recognition in vivo; for instance, the
intracellular concentration
of Lrs14 might be very high, or the
affinity might be increased
by physical and chemical parameters (ionic
strength, pH, temperature,
and so on) or by specific mechanisms
(posttranslational modifications,
interaction with other proteins).
Moreover, because Lrp binding
affinities for different sites greatly
vary (
28,
33,
35),
we cannot rule out the possibility that
Lrs14 higher-affinity
sites exist (showing, for instance, palindromic
sequences or
bending).
Binding of
E. coli Lrp to some, but not all, sites within a
promoter is cooperative (
33). By comparing the relative
affinity
with which Lrs14 binds to the three different sites, we could
not find any cooperative effect (data not
shown).
Bacterial Lrp proteins bind to A/T-rich sequences whose degenerate
consensus is (c/t)AG(a/t/c)A(a/t)ATT(a/t)T(a/c/t)CT(a/g)
(
28). The A/T-rich upstream region of
lrs14
contains sequences
related to this consensus (Fig.
3). We constructed
an oligonucleotide
containing one of these sites (cLRS) and a control
oligonucleotide
overlapping the TATA box (TATA [Fig.
3]), and we used
them as
competitors in bandshift experiments (Fig.
8). Binding of Lrs14
to the fragment UP
was competed by the cLRS (lanes 4 and 5), but
not TATA (lanes 2 and 3),
oligonucleotide, suggesting that Lrs14
recognizes sequences similar to
those in the Lrp consensus. We
noticed that complete competition is
obtained when a large excess
of cLRS is used, suggesting that
additional sequences are required
for the binding to be more effective.
View larger version (51K):
[in this window]
[in a new window]
|
FIG. 8.
Lrs14 binds to Lrp consensus sequences. Binding of Lrs14
(0.8 µg) to the UP probe in the presence of different competitor
oligonucleotides (Fig. 3). Lane 1, no competitors; lane 2, oligonucleotide TATA (1 µg); lane 3, oligonucleotide TATA (0.1 µg);
lane 4, oligonucleotide cLRS (1 µg); lane 5, oligonucleotide cLRS
(0.1 µg). Prebinding and binding reactions were performed at room
temperature for 10 min.
|
|
| |
DISCUSSION |
We have identified a new gene of S. solfataricus
(lrs14) coding for a protein related to the
Lrp-AsnC family of transcriptional regulators. The predicted Lrs14
protein contains a potential helix-turn-helix motif typical of this
class of DNA-binding proteins. We have expressed the Lrs14 protein in
E. coli fused to a histidine tag at the N terminus and
purified it by affinity chromatography. We have shown that Lrs14 is a
highly thermostable DNA-binding protein, which specifically binds to
multiple sites in its own promoter and which, in DNase I footprinting
experiments, protects a large region of about 60 bp immediately
upstream of the ATG. At least one of the Lrs14 binding sites is related
to A/T-rich binding sequences of bacterial Lrp proteins. Finally, we
have shown that the lrs14 gene is transcribed in a
monocistronic RNA which accumulates in the midexponential and late
growth stages.
Despite the low sequence similarity, most of these features are
reminiscent of the E. coli Lrp protein and suggest that the function and regulation of the two proteins might be similar. Lrp
regulates more than 40 genes and operons in E. coli; target genes are involved in cellular processes as diverse as amino acid biosynthesis, transport, and degradation, fimbrial synthesis, tRNA
synthesis, maltose transport, outer membrane structure, osmoregulation, and others (4, 23). Unfortunately, due to the lack of
molecular tools for the construction of targeted mutants in S. solfataricus, the role of Lrs14 in cell physiology is currently
only a matter of speculation. Apparently multiple Lrp-AsnC homologs are
present in archaeal strains (3, 17, 29), and, in particular,
an S. solfataricus Lrp-related ORF distinct from Lrs14 is
present in the database (10); this fact suggests either that
the functions of these factors in Archaea are redundant or
that each factor is specialized to accomplish a specific set of functions.
E. coli Lrp activity is modulated by its effector ligand,
leucine. Leucine is required for binding of Lrp to some operators, whereas it inhibits or has no effect on binding to other sites. The
opposite effects of leucine on binding of Lrp to different operator
sites can be reproduced in vitro (35). Similarly, the homologous AsnC protein is regulated by asparagine (18).
Neither leucine nor asparagine affects binding of Lrs14 to its promoter under the conditions tested (unpublished results).
Based on its global role and the fact that its levels vary inversely
with the growth rate of cells, it has been suggested that Lrp is
involved in adaptation to changes in the nutritional environment
(21). The lrs14 transcript is also accumulated
during late growth stages, suggesting a similar regulation for the
Lrs14 protein.
Lrp is negatively autoregulated (34); although we do not
have such direct functional evidence, the fact that the region of the
footprint of Lrs14 overlaps the TATA box of the gene suggests that it
may act as a repressor of its own transcription, reducing the affinity
of the transcription machinery to the promoter or reducing its ability
to initiate transcription.
The presence of Lrp-AsnC-like transcription regulators in
Archaea is puzzling from an evolutionary point of view. Most
likely, these factors have evolved before the divergence of
Bacteria and Archaea, and it is tempting to
speculate that they are among the oldest transcription regulators. Such
ancient factors, still conserved in two domains of life, apparently
have been lost (or dramatically changed) in eukaryotes.
According to current models of regulation of gene expression, in both
prokaryotes and eukaryotes, a key role is played by protein-protein
interactions between activators (and, in some cases, repressors) and
components of the basal transcription machinery (TFIID,
carboxy-terminal domain of the RNA polymerase, sigma factors) or other
factors (coactivators, corepressors, adapters) (13, 16).
The molecular mechanism of transcriptional activation or repression by
Lrp and AsnC proteins has not been elucidated, and, to date, no
interactions with components of the basal transcription machinery or
other factors has been reported. Identification of the Lrs14 target
sites, as well as analysis of possible interactions of Lrs14 with other
proteins involved in the transcription initiation process, will be
addressed in future experiments. Such studies will help clarify
mechanisms of archaeal gene expression and, possibly, those of the
Lrp-AsnC class of factors.
| |
ACKNOWLEDGMENTS |
We thank Maria Riflettivo who participated in some experiments
during work on her thesis, Marco Moracci for helpful discussion, and
Giovanni Imperato and Ottavio Piedimonte for technical assistance.
This work was partially supported by EU project "Biotechnology of
Extremophiles" contract no. BIO2-CT93-0274 and by MURST project
"Biomolecole per la salute umana."
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Institute of
Protein Biochemistry and Enzymology, Consiglio Nazionale delle
Ricerche, Via Marconi 10, 80125 Naples, Italy. Phone: 39 081 7257 246. Fax: 39 081 239 6525. E-mail:
ciaramel{at}dafne.ibpe.na.cnr.it.
NRCC publication 42281.
| |
REFERENCES |
| 1.
|
Baumann, H.,
S. Knapp,
T. Lundback,
R. Ladenstein, and T. Hard.
1994.
Solution structure and DNA-binding properties of a small thermostable protein from the archaeon Sulfolobus solfataricus.
Nat. Struct. Biol.
1:808-819[Medline].
|
| 2.
|
Bradford, M. M.
1976.
A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding.
Anal. Biochem.
72:248-254[Medline].
|
| 3.
|
Bult, C. J.,
O. White,
G. J. Olsen,
L. Zhou,
R. D. Fleischmann,
G. G. Sutton,
J. A. Blake,
L. M. Fitzgerald,
R. A. Clayton,
J. D. Gocayne,
A. R. Kerlavage,
B. A. Dougherty,
J.-F. Tomb,
M. D. Adams,
C. I. Reich,
R. Overbeek,
E. F. Kirkness,
K. G. Weinstock,
J. M. Merrick,
A. Glodek,
J. L. Scott,
N. S. M. Geoghagen,
J. F. Weidman,
J. L. Fuhrmann,
D. Nguyen,
T. R. Utterback,
J. M. Kelley,
J. D. Peterson,
P. W. Sadow,
M. C. Hanna,
M. D. Cotton,
K. M. Roberts,
M. A. Hurst,
B. P. Kaine,
M. Borodovsky,
H.-P. Klenk,
C. M. Fraser,
H. O. Smith,
C. R. Woese, and J. C. Venter.
1996.
Complete genome sequence of the methanogenic archaeon Methanococcus jannaschii.
Science
273:1058-1073[Abstract].
|
| 4.
|
Calvo, J. M., and R. G. Matthews.
1994.
The leucine-responsive regulatory protein, a global regulator of metabolism in Escherichia coli.
Microbiol. Rev.
58:466-490[Abstract/Free Full Text].
|
| 5.
| Charlier, D. Personal communication.
|
| 6.
|
Charlier, D.,
M. Roovers,
T. L. Thia-Toong,
V. Durbecq, and N. Glansdorff.
1997.
Cloning and identification of the Sulfolobus solfataricus Lrp gene encoding an archaeal homologue of the eubacterial leucine-responsive global transcription regulator Lrp.
Gene
201:63-68[Medline].
|
| 7.
|
Corpet, F.
1988.
Multiple sequence alignment with hierarchical clustering.
Nucleic Acids Res.
16:10881-10890[Abstract/Free Full Text].
|
| 8.
|
Dodd, I. B., and J. B. Egan.
1990.
Improved detection of helix-turn-helix DNA-binding motifs in protein sequences.
Nucleic Acids Res.
18:5019-5026[Abstract/Free Full Text].
|
| 9.
|
Eggen, R. I.,
A. C. Geerling,
K. Wadkotter,
G. Antranikian, and W. M. de Vos.
1993.
The glutamate-dehydrogenase-encoding gene of the hyperthermophilic archaeon Pyrococcus furiosus: sequence, transcription and analysis of the deduced amino acid sequence.
Gene
132:143-148[Medline].
|
| 10.
| GenBank. Accession no. e283948.
|
| 11.
| GenBank. Accession no. AE001064.
|
| 12.
|
Guagliardi, A.,
A. Napoli,
M. Rossi, and M. Ciaramella.
1997.
Annealing of complementary DNA strands above the melting point of the duplex promoted by an archaeal protein.
J. Mol. Biol.
267:841-848[Medline].
|
| 13.
|
Hochschild, A., and S. L. Dove.
1998.
Protein-protein contacts that activate or repress prokaryotic transcription.
Cell
92:597-600[Medline].
|
| 14.
|
Janknecht, R.,
G. de Martynoff,
J. Lou,
R. A. Hispkind,
A. Nordheim, and H. G. Stunnenberg.
1991.
Rapid and efficient purification of native histidine-tagged protein expressed in recombinant vaccinia virus.
Proc. Natl. Acad. Sci. USA
88:8972-8976[Abstract/Free Full Text].
|
| 15.
|
Jones, J. G.,
N. R. Hackett,
J. T. Halladay,
D. J. Scothorn,
C. F. Yang,
W. L. Ng, and S. DasSarma.
1989.
Analysis of insertion mutants reveals two new genes in the pNRC100 gas vesicle gene cluster of Halobacterium halobium.
Nucleic Acids Res.
17:7785-7793[Abstract/Free Full Text].
|
| 16.
|
Kadonaga, J. T.
1998.
Eukaryotic transcription: an interlaced network of transcription factors and chromatin-modifying machines.
Cell
92:307-313[Medline].
|
| 17.
|
Klenk, H. P.,
R. A. Clayton,
J. F. Tomb,
O. White,
K. E. Nelson,
K. A. Ketchum,
R. J. Dodson,
M. Gwinn,
E. K. Hickey,
J. D. Peterson,
D. L. Richardson,
A. R. Kerlavage,
D. E. Graham,
N. C. Kyrpides,
R. D. Fleischmann,
J. Quackenbush,
N. H. Lee,
G. G. Sutton,
S. Gill,
E. F. Kirkness,
B. A. Dougherty,
K. McKenney,
M. D. Adams,
B. Loftus,
S. Peterson,
C. I. Reich,
L. K. McNeil,
J. H. Badger,
A. Glodek,
L. Zhou,
R. Overbeek,
J. D. Gocayne,
J. F. Weidman,
L. McDonald,
T. Utterback,
M. D. Cotton,
T. Spriggs,
P. Artiach,
B. P. Kaine,
S. M. Sykes,
P. W. Sadow,
K. P. D'Andrea,
C. Bowman,
C. Fujii,
S. A. Garland,
T. M. Mason,
G. J. Olsen,
C. M. Fraser,
H. O. Smith,
C. R. Woese, and J. C. Venter.
1997.
The complete genome sequence of the hyperthermophilic, sulphate-reducing archaeon Archaeoglobus fulgidus.
Nature
390:364-370[Medline].
|
| 18.
|
Kölling, R., and H. Lother.
1985.
AsnC: an autogenously regulated activator of asparagine synthetase A transcription in Escherichia coli.
J. Bacteriol.
164:310-315[Abstract/Free Full Text].
|
| 19.
|
Kreuzer, P.,
D. Gärtner,
R. Allmansberger, and W. Hillen.
1989.
Identification and sequence analysis of the Bacillus subtilis W23 xylR gene and xyl operator.
J. Bacteriol.
171:3840-3845[Abstract/Free Full Text].
|
| 20.
|
Kyrpides, N. C., and C. A. Ouzounis.
1995.
The eubacterial transcriptional activator Lrp is present in the archaeon Pyrococcus furiosus.
Trends Biochem. Sci.
20:140-141[Medline].
|
| 21.
|
Landgraf, J. R.,
J. Wu, and J. M. Calvo.
1996.
Effects of nutrition and growth rate on Lrp levels in Escherichia coli.
J. Bacteriol.
178:6930-6936[Abstract/Free Full Text].
|
| 22.
| Napoli, A., and M. Ciaramella. Unpublished results.
|
| 22a.
| NPSA. 21 December 1998, revision date. [Online.]
HTH program. http://pbil.ibcp.fr/NPSA/npsa_hth.html. [19 January 1999, last date accessed.]
|
| 23.
|
Newman, E. B., and R. Lin.
1995.
Leucine-responsive regulatory protein: a global regulator of gene expression in E. coli.
Annu. Rev. Microbiol.
49:747-775[Medline].
|
| 24.
|
O'Brien, R.,
B. DeDecker,
K. G. Fleming,
P. B. Sigler, and J. E. Ladbury.
1998.
The effects of salt on the TATA binding protein-DNA interaction from a hyperthermophilic archaeon.
J. Mol. Biol.
279:117-125[Medline].
|
| 25.
|
Platko, J. V., and J. M. Calvo.
1993.
Mutations affecting the ability of Escherichia coli Lrp to bind DNA, activate transcription, or respond to leucine.
J. Bacteriol.
175:1110-1117[Abstract/Free Full Text].
|
| 26.
|
Prisco, A.,
M. Moracci,
M. Rossi, and M. Ciaramella.
1995.
A gene encoding a putative membrane protein homologous to the major facilitator superfamily of transporters maps upstream of the -glycosidase gene in the archaeon Sulfolobus solfataricus.
J. Bacteriol.
177:1614-1619[Abstract/Free Full Text].
|
| 27.
|
Reeve, J. N.,
K. Sandman, and C. J. Daniels.
1997.
Archaeal histones, nucleosomes and transcription initiation.
Cell
89:999-1002[Medline].
|
| 28.
|
Rhee, K. Y.,
B. S. Parekh, and G. W. Hatfield.
1996.
Leucine-responsive regulatory protein-DNA interactions in the leader region of the ilvGMEDA operon of Escherichia coli.
J. Biol. Chem.
271:26499-26507[Abstract/Free Full Text].
|
| 29.
|
Smith, D. R.,
L. A. Doucette-Stamm,
C. Deloughery,
H. Lee,
J. Dubois,
T. Aldredge,
R. Bashirzadeh,
D. Blakely,
R. Cook,
K. Gilbert,
D. Harrison,
L. Hoang,
P. Keagle,
W. Lumm,
B. Pothier,
D. Qiu,
R. Spadafora,
R. Vicaire,
Y. Wang,
J. Wierzbowski,
R. Gibson,
N. Jiwani,
A. Caruso,
D. Bush,
H. Safer,
D. Patwell,
S. Prabhakar,
S. McDougall,
G. Shimer,
A. Goyal,
S. Pietrokovski,
G. M. Church,
C. J. Daniels,
J.-I. Mao,
P. Rice,
J. Nölling, and J. N. Reeve.
1997.
Complete genome sequence of Methanobacterium thermoautotrophicum  H: functional analysis and comparative genomics.
J. Bacteriol.
179:7135-7155[Abstract/Free Full Text].
|
| 30.
|
Thomm, M.
1996.
Archaeal transcription factors and their role in transcription initiation.
FEMS Microbiol. Rev.
18:159-171[Medline].
|
| 31.
|
Van der Oost, J.,
M. Ciaramella,
M. Moracci,
F. M. Pisani,
M. Rossi, and W. M. de Vos.
1998.
Molecular biology of hyperthermophilic Archaea.
Adv. Biochem. Eng. Biotechnol.
61:87-115[Medline].
|
| 32.
|
Wang, Q., and J. M. Calvo.
1993.
Lrp, a major regulatory protein in Escherichia coli, bends DNA and can organize the assembly of a higher-order nucleoprotein structure.
EMBO J.
12:2495-2501[Medline].
|
| 33.
|
Wang, Q., and J. M. Calvo.
1993.
Lrp, a global regulatory protein of Escherichia coli, binds co-operatively to multiple sites and activates transcription of ilvIH.
J. Mol. Biol.
229:306-318[Medline].
|
| 34.
|
Wang, Q.,
J. Wu,
D. Friedberg,
J. Platko, and J. M. Calvo.
1994.
Regulation of the Escherichia coli lrp gene.
J. Bacteriol.
176:1831-1839[Abstract/Free Full Text].
|
| 35.
|
Wiese, D. E.,
B. R. Ernsting,
R. M. Blumenthal, and R. G. Matthews.
1997.
A nucleoprotein activation complex between the leucine-responsive regulatory protein and DNA upstream of the gltBDF operon in Escherichia coli.
J. Mol. Biol.
270:152-168[Medline].
|
| 36.
|
Willins, D. A.,
C. W. Ryan,
J. V. Platko, and J. M. Calvo.
1991.
Characterization of Lrp, an Escherichia coli regulatory protein that mediates a global response to leucine.
J. Biol. Chem.
266:10768-10774[Abstract/Free Full Text].
|
Journal of Bacteriology, March 1999, p. 1474-1480, Vol. 181, No. 5
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Kumarevel, T., Nakano, N., Ponnuraj, K., Gopinath, S. C. B., Sakamoto, K., Shinkai, A., Kumar, P. K. R., Yokoyama, S.
(2008). Crystal structure of glutamine receptor protein from Sulfolobus tokodaii strain 7 in complex with its effector L-glutamine: implications of effector binding in molecular association and DNA binding. Nucleic Acids Res
36: 4808-4820
[Abstract]
[Full Text]
-
Abella, M., Rodriguez, S., Paytubi, S., Campoy, S., White, M. F., Barbe, J.
(2007). The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein. Nucleic Acids Res
35: 6788-6797
[Abstract]
[Full Text]
-
Kessler, A., Sezonov, G., Guijarro, J. I., Desnoues, N., Rose, T., Delepierre, M., Bell, S. D., Prangishvili, D.
(2006). A novel archaeal regulatory protein, Sta1, activates transcription from viral promoters. Nucleic Acids Res
34: 4837-4845
[Abstract]
[Full Text]
-
Peeters, E., Willaert, R., Maes, D., Charlier, D.
(2006). Ss-LrpB from Sulfolobus solfataricus Condenses about 100 Base Pairs of Its Own Operator DNA into Globular Nucleoprotein Complexes. J. Biol. Chem.
281: 11721-11728
[Abstract]
[Full Text]
-
Thaw, P., Sedelnikova, S. E., Muranova, T., Wiese, S., Ayora, S., Alonso, J. C., Brinkman, A. B., Akerboom, J., van der Oost, J., Rafferty, J. B.
(2006). Structural insight into gene transcriptional regulation and effector binding by the Lrp/AsnC family. Nucleic Acids Res
34: 1439-1449
[Abstract]
[Full Text]
-
Cordone, A., Mauriello, E. M. F., Pickard, D. J., Dougan, G., De Felice, M., Ricca, E.
(2005). The lrp Gene and Its Role in Type I Fimbriation in Citrobacter rodentium. J. Bacteriol.
187: 7009-7017
[Abstract]
[Full Text]
-
Xie, Y., Reeve, J. N.
(2005). Regulation of Tryptophan Operon Expression in the Archaeon Methanothermobacter thermautotrophicus. J. Bacteriol.
187: 6419-6429
[Abstract]
[Full Text]
-
Salerno, V., Napoli, A., White, M. F., Rossi, M., Ciaramella, M.
(2003). Transcriptional response to DNA damage in the archaeon Sulfolobus solfataricus. Nucleic Acids Res
31: 6127-6138
[Abstract]
[Full Text]
-
Fiorentino, G., Cannio, R., Rossi, M., Bartolucci, S.
(2003). Transcriptional Regulation of the Gene Encoding an Alcohol Dehydrogenase in the Archaeon Sulfolobus solfataricus Involves Multiple Factors and Control Elements. J. Bacteriol.
185: 3926-3934
[Abstract]
[Full Text]
-
Lee, S.-J., Engelmann, A., Horlacher, R., Qu, Q., Vierke, G., Hebbeln, C., Thomm, M., Boos, W.
(2003). TrmB, a Sugar-specific Transcriptional Regulator of the Trehalose/Maltose ABC Transporter from the Hyperthermophilic Archaeon Thermococcus litoralis. J. Biol. Chem.
278: 983-990
[Abstract]
[Full Text]
-
Brinkman, A. B., Bell, S. D., Lebbink, R. J., de Vos, W. M., van der Oost, J.
(2002). The Sulfolobus solfataricus Lrp-like Protein LysM Regulates Lysine Biosynthesis in Response to Lysine Availability. J. Biol. Chem.
277: 29537-29549
[Abstract]
[Full Text]
-
Napoli, A., Zivanovic, Y., Bocs, C., Buhler, C., Rossi, M., Forterre, P., Ciaramella, M.
(2002). DNA bending, compaction and negative supercoiling by the architectural protein Sso7d of Sulfolobus solfataricus. Nucleic Acids Res
30: 2656-2662
[Abstract]
[Full Text]
-
Dahlke, I., Thomm, M.
(2002). A Pyrococcus homolog of the leucine-responsive regulatory protein, LrpA, inhibits transcription by abrogating RNA polymerase recruitment. Nucleic Acids Res
30: 701-710
[Abstract]
[Full Text]
-
She, Q., Singh, R. K., Confalonieri, F., Zivanovic, Y., Allard, G., Awayez, M. J., Chan-Weiher, C. C.-Y., Clausen, I. G., Curtis, B. A., De Moors, A., Erauso, G., Fletcher, C., Gordon, P. M. K., Heikamp-de Jong, I., Jeffries, A. C., Kozera, C. J., Medina, N., Peng, X., Thi-Ngoc, H. P., Redder, P., Schenk, M. E., Theriault, C., Tolstrup, N., Charlebois, R. L., Doolittle, W. F., Duguet, M., Gaasterland, T., Garrett, R. A., Ragan, M. A., Sensen, C. W., Van der Oost, J.
(2001). The complete genome of the crenarchaeon Sulfolobus solfataricus P2. Proc. Natl. Acad. Sci. USA
10.1073/pnas.141222098v1
[Abstract]
[Full Text]
-
Hanzelka, B. L., Darcy, T. J., Reeve, J. N.
(2001). TFE, an Archaeal Transcription Factor in Methanobacterium thermoautotrophicum Related to Eucaryal Transcription Factor TFIIE{alpha}. J. Bacteriol.
183: 1813-1818
[Abstract]
[Full Text]
-
Enoru-Eta, J., Gigot, D., Thia-Toong, T.-L., Glansdorff, N., Charlier, D.
(2000). Purification and Characterization of Sa-Lrp, a DNA-Binding Protein from the Extreme Thermoacidophilic Archaeon Sulfolobus acidocaldarius Homologous to the Bacterial Global Transcriptional Regulator Lrp. J. Bacteriol.
182: 3661-3672
[Abstract]
[Full Text]
-
Bell, S. D., Jackson, S. P.
(2000). Mechanism of Autoregulation by an Archaeal Transcriptional Repressor. J. Biol. Chem.
275: 31624-31629
[Abstract]
[Full Text]
-
Brinkman, A. B., Dahlke, I., Tuininga, J. E., Lammers, T., Dumay, V., de Heus, E., Lebbink, J. H. G., Thomm, M., de Vos, W. M., van der Oost, J.
(2000). An Lrp-like Transcriptional Regulator from the Archaeon Pyrococcus furiosus Is Negatively Autoregulated. J. Biol. Chem.
275: 38160-38169
[Abstract]
[Full Text]
-
Napoli, A., Kvaratskelia, M., White, M. F., Rossi, M., Ciaramella, M.
(2001). A Novel Member of the Bacterial-Archaeal Regulator Family Is a Nonspecific DNA-binding Protein and Induces Positive Supercoiling. J. Biol. Chem.
276: 10745-10752
[Abstract]
[Full Text]
-
She, Q., Singh, R. K., Confalonieri, F., Zivanovic, Y., Allard, G., Awayez, M. J., Chan-Weiher, C. C.-Y., Clausen, I. G., Curtis, B. A., De Moors, A., Erauso, G., Fletcher, C., Gordon, P. M. K., Heikamp-de Jong, I., Jeffries, A. C., Kozera, C. J., Medina, N., Peng, X., Thi-Ngoc, H. P., Redder, P., Schenk, M. E., Theriault, C., Tolstrup, N., Charlebois, R. L., Doolittle, W. F., Duguet, M., Gaasterland, T., Garrett, R. A., Ragan, M. A., Sensen, C. W., Van der Oost, J.
(2001). The complete genome of the crenarchaeon Sulfolobus solfataricus P2. Proc. Natl. Acad. Sci. USA
98: 7835-7840
[Abstract]
[Full Text]
Top
Abstract
Introduction
