Previous Article | Next Article 
Journal of Bacteriology, March 1999, p. 1694-1697, Vol. 181, No. 5
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
The Level of Expression of the Minor Pilin Subunit,
CooD, Determines the Number of CS1 Pili Assembled on the Cell
Surface of Escherichia coli
Harry
Sakellaris,
Vikram R.
Penumalli, and
June R.
Scott*
Department of Microbiology and Immunology,
Emory University School of Medicine, Atlanta, Georgia 30322
Received 1 October 1998/Accepted 18 December 1998
 |
ABSTRACT |
CooD, the minor subunit of CS1 pili of enterotoxigenic
Escherichia coli, is essential for the assembly of stable,
functional pili. We previously proposed that CooD is a rate-limiting
initiator of CS1 pilus assembly and predicted that the level of CooD
expression should therefore determine the number of CS1 pili assembled
on the cell surface. In this study, we confirm that CooD is required for the initiation of pilus assembly rather than for the stabilization of pili after they are assembled by demonstrating that specific modulation of cooD expression also modulates the number of
CS1 pili on bacterial cells.
| |
TEXT |
CS1 pili represent a family of
adhesins associated with enterotoxigenic Escherichia coli
(ETEC) that is pathogenic for humans and associated with
Burkholderia cepacia, a pathogen associated with cystic
fibrosis (23). Pili belonging to this family, including CS1,
CFA/I, CS2, and CS14, mediate the binding of ETEC to human enterocytes
in vitro (4, 11, 28) and are therefore thought to be
required for colonization of the host intestine. This has been
confirmed for CFA/I pili, which have been shown to be necessary for the
maintenance of ETEC in the intestines of human volunteers (6) and for the CS1-related Cbl type II pili of B. cepacia which have been implicated in binding to respiratory
mucins (20, 21).
The CS1 family is one of three major classes of pili associated with
gram-negative bacterial pathogens. It is distinguished from the other
two major families, the type IV and Pap (pyelonephrititis-associated pilus)-related pilus families, primarily by a lack of sequence similarity with any of the proteins involved in pilus assembly (23). Both the type IV pilus systems, which require up to 14 genes for the assembly of pili (16, 26, 27), and many
Pap-related pilus systems, which may require up to 9 pilus assembly
genes (9), are relatively complex. In contrast, for
assembly, CS1 pili require only the four cotranscribed genes
cooB, -A, -C, and -D
(7, 15, 17, 25).
CS1 pili are composed almost entirely of the major pilin subunit, CooA,
and contain on their tips CooD, which is estimated to contribute only
one subunit per pilus (22). The assembly of CooA and CooD
subunits into pili depends on the presence of two other proteins
encoded by the coo operon: CooC, a large outer membrane
protein that is probably involved in the transport of pilins across the
outer membrane (22, 29), and CooB, a periplasmic chaperone-like protein that forms intermolecular complexes with each of
the pilins in the periplasm and with CooC in the outer membrane and
stabilizes these proteins (22, 29). CS1 and Pap-related pili
share important morphogenetic features, including the transport of
pilins via the periplasm, a requirement for a periplasmic chaperone, and a large outer membrane assembly protein. Since the proteins of CS1
and Pap-related pili are unrelated, it seems likely that these
similarities result from convergent evolution (22, 29).
Although CooD is a minor pilin, it is also essential for the assembly
of functional pili (7). If CS1 pili are assembled like type
I pili by incorporation of subunits at the base of the pilus
(14), the location of CooD at the pilus tip (22)
suggests that it is probably the first subunit incorporated into the
pilus. The absolute requirement for CooD in pilus assembly, the
location of CooD at the pilus tip, and the very low level of CooD
expression in wild-type cells (22) suggest that CooD may be
a rate-limiting initiator for the assembly of CooA subunits into pili.
In this model, CooD is essential for the initiation of pilus assembly and so the level of CooD expression should determine the number of pili
on the cell surface (22).
Because pili are not detectable in the absence of CooD on the tip
(7), the alternative model is that CooD is added last but is
needed to stabilize the pilus structure. This model predicts that in
the absence of CooD, CooA is secreted to the cell exterior but does not
remain polymerized in a pilus structure. To test these models, we have
investigated whether CooA is secreted to the cell exterior in the
absence of CooD and whether modulating the expression of CooD
influences the number of pili assembled on the cell surface.
CooD is necessary for the extracellular transport of CooA.
To
investigate the extracellular secretion of CooA in a cooD
mutant, the coo genes were expressed in the E. coli
ara deletion mutant LMG194 (8) from plasmid pEU1290
which carries cooB, cooA, and cooC
expressed under the pTrc99A promoter regulated by
isopropyl-
-D-thiogalactopyranoside (IPTG)
(1). For the construction of pEU1290, an insert carrying
cooB, cooA, and cooC was amplified by
PCR from the template plasmid pEU494 (7), using
Pfu DNA polymerase (Stratagene) and the oligonucleotide primers BACUP (5'AAAAGGTACCGCCAAGTGTTAGGAGGGGG3') and
BACDOWN (5'AAAATAAGCTTCTTTTTCATTCAGTATCCTGATTG3'). The
4.1-kb insert was digested with
HindIII-Acc65I and cloned into corresponding
restriction sites in pTrc99A to place cooB, -A,
and -C under the control of the Ptrc promoter.
Bacteria were grown in Luria-Bertani (LB) medium (24) with
aeration at 37°C in the presence of ampicillin (100 µg/ml) and 0.1 mM IPTG to induce expression of cooB, -A, and
-C, and extracts were assayed by immunoblotting with
anti-CooA antiserum. Although no CooA was found in extracts of cells
plus supernatant of LMG194, as expected, CooA was readily detectable
(data not shown) in extracts of the LMG194/pEU1290 culture containing
both bacteria and supernatant. A comparison between the dilutions of
this extract and an extract from undiluted supernatant of this strain
from which the bacterial cells had been removed showed that the
supernatant contained between 1 and 10% of the total CooA present
(data not shown). Immunoblots showed that the fraction of CooA in the
culture supernatant was not greater than that of MalE, a
periplasmically located protein that would be present in the
supernatant only if the cells lysed (data not shown).
The stability of CooA subunits was tested with monomeric CooA isolated
from purified CS1 pili by boiling the pili for 20 min
in sterile
distilled water, as previously described for CFA/I
pilins
(
2). These subunits were added to a culture of LMG194
and
incubated at 37°C for 2 h. Immunoblots showed that the
concentration
of subunits did not change (data not shown), so if CooA
had been
secreted from the
cooBAC strain, it should have
been detectable.
We conclude that CooA does not appear to be secreted
to the cell
exterior in the absence of
CooD.
System to modulate cooD and cooBAC
expression independently.
To investigate whether the level of
cooD expression influences the number of CS1 pili assembled
on the cell surface, we used a two-plasmid system which allowed us to
specifically modulate the expression of cooD while keeping
the expression of cooB, -A, and -C
constant. Plasmid pEU1290 carries cooB, -A, and
-C under control of the IPTG-inducible Ptrc
promoter, and plasmid pEU1206 carries cooD under the
transcriptional control of the arabinose-inducible ParaBAD
promoter (8). To create pEU1206, the
HindIII-BglII cooD fragment from
pEU493 (23) was blunt ended, passed through an intermediate
vector to provide appropriate flanking restriction sites, and cloned
into pBAD30 (8) to which the 1.9-kb spectinomycin resistance
cassette of pHP45 (18) had been added at the FspI site.
For full repression of the P
araBAD promoter on multicopy
plasmids, glucose-mediated catabolite repression is usually needed
(
8). To confirm that glucose represses and arabinose induces
cooD expression in
E. coli
LMG194/pEU1290/pEU1206, immunoblots
of whole-cell extracts were probed
with anti-CooD. As expected,
no CooD was detectable in the
negative-control strain LMG194/pEU1290
(
cooBAC+)
(Fig.
1, lane 1). When grown in the
presence of glucose, LMG194/pEU1290/pEU1206
(
cooBAC+
cooD+) did not produce enough CooD to be detected
either (Fig.
1, lane
2). However, in the presence of arabinose, CooD
was easily detected
in this strain as a 38-kDa protein and a 25-kDa
truncated product
(Fig.
1, lanes 3 to 5) which has been described
previously (
22,
29). Using immunoblots, we have also
confirmed that neither
glucose nor arabinose affects the expression of
CooA from LMG194/pEU1290
(
cooBAC+) (data not
shown).
View larger version (54K):
[in this window]
[in a new window]
|
FIG. 1.
Regulated expression of CooD from the ParaBAD
promoter. Protein extracts were prepared from E. coli
LMG194/pEU1290/pEU1206 grown in the presence of 0.2% glucose (wt/vol)
(lane 2) or in the presence of arabinose at 0.002% (lane 3), 0.01%
(lane 4), and 0.05% (lane 5) and were analyzed by immunoblotting with
anti-CooD antiserum. Lane 1 contains a negative-control extract from
LMG194/pEU1290. Lane 6 contains protein markers with molecular masses
indicated in kilodaltons. The positions of the full-length, 38-kDa form
of CooD and the 25-kDa truncated form (CooD*) are indicated by
arrows.
|
|
Effect on CS1 piliation of modulating cooD
expression.
To examine the effect of cooD expression on
CS1 piliation, cultures of E. coli LMG194/pEU1290/pEU1206
were grown in LB broth containing ampicillin (100 µg/ml) and
spectinomycin (100 µg/ml) in the presence of 0.1 mM IPTG to derepress
cooB, -A, and -C. The number of pili
on bacteria from cultures in which cooD was repressed by
growth in glucose (0.2% [wt/vol]) or induced by addition of
arabinose (0.002, 0.01, or 0.05% [wt/vol]) was determined by electron microscopy of broth-grown cells collected by centrifugation (as described previously [22]). In the
negative-control strain LMG194/pEU1290, no pili were detected, as
expected (data not shown). When glucose was used to repress
cooD expression, some pili (average of 28 pili/cell) were
detectable on the bacterial surface (Fig. 2 and Table
1). Since CooD is required for the
production of pili, it appears that there is some expression of
cooD even in the presence of glucose. However, when
cooD expression was induced with arabinose, the number of
CS1 pili per cell increased dramatically, with most cells producing
>150 pili per cell (Fig. 2 and Table 1). Therefore, the level of
cooD expression determines the number of CS1 pili assembled
on the cell surface.
View larger version (87K):
[in this window]
[in a new window]
|
FIG. 2.
Electron micrographs showing the effect of CooD
expression on CS1 piliation. E. coli LMG194/pEU1290/pEU1206
grown in 0.2% glucose (A) or in 0.002% arabinose (B) is shown.
|
|
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Effect of modulating CooD expression on the number of CS1
pili produced per cell in E. coli LMG194/pEU1206
|
|
Conclusion.
From the work presented here, we conclude that
CooD is essential for the extracellular transport of CooA, the major
pilus subunit, and that the level of CooD expression controls the
number of CS1 pili assembled. This is consistent with the model we
previously described (22, 29) in which CooD is the
rate-limiting initiator of pilus assembly. In this model, the major
pilin subunit CooA cannot be transported through the outer membrane and
polymerized into pili until CooD has first associated with CooC in the
outer membrane. When this occurs, CooA molecules are then able to be added to the CooD-CooC complex and CooA can continue to polymerize and
be transported through the outer membrane to form the pilus structure.
Because it is required to initiate pilus assembly and because pili grow
by addition of subunits proximal to the cell, a CooD molecule will be
located on the distal tip of the pilus structure.
Pili often serve as attachment structures for bacteria. Because many
bacterial pathogens are enclosed in capsules or other
types of surface
molecules, it has been suggested that the long
flexible structure of
the pilus serves to present the adhesin,
often located at its tip
(
3,
10,
12), to its receptor in
an environment free of other
bacterial surface molecules (
5).
The production of a pilus
structure with a distally located adhesin
would be assured if the polar
extrusion of the pilus depended
on the presence of the minor tip
protein.
As for some pili, some filamentous phages, like f1, are assembled at
the outer cell membrane and use a minor component to
initiate polar
extrusion from the cell (
13,
19). For f1, the
two minor coat
proteins, pVII and pIX, are required for initiation
of the growing
phage structure. However, because phage is completely
released from the
producing cell before it adheres to its target
cell, it is possible for
the phage adhesin protein that recognizes
the bacterial host to be
located at the proximal tip, i.e., on
the other end from the initiator
protein. Pili, on the other hand,
remain attached to the producing cell
when they adhere to their
target and so have only the distal end free.
It is presumably
for this reason that the minor pilin protein(s)
located on the
pilus tip may sometimes serve both as the initiator for
assembly
and as the adhesin (
3). We have presented evidence
above that
CooD, the minor CS1 pilus protein located at the distal tip
of
the structure, serves as the initiator for assembly. Work in
progress
suggests that it also serves as the specific adhesin which
attaches
to receptors on the
host.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology and Immunology, Emory University School of Medicine,
Atlanta, GA 30322. Phone: (404) 727-0402. Fax: (404) 727-8999. E-mail: scott{at}microbio.emory.edu.
| |
REFERENCES |
| 1.
|
Amann, E.,
B. Ochs, and K. J. Abel.
1988.
Tightly regulated tac promoter vectors useful for the expression of unfused and fused proteins in Escherichia coli.
Gene
69:301-315[Medline].
|
| 2.
|
Buhler, T.,
H. Hoschutzky, and K. Jann.
1991.
Analysis of colonization factor antigen I, an adhesin of enterotoxigenic Escherichia coli O78:H11: fimbrial morphology and location of the receptor-binding site.
Infect. Immun.
59:3876-3882[Abstract/Free Full Text].
|
| 3.
|
Cao, J.,
A. S. Khan,
M. E. Bayer, and D. M. Schifferli.
1995.
Ordered translocation of 987P fimbrial subunits through the outer membrane of Escherichia coli.
J. Bacteriol.
177:3704-3713[Abstract/Free Full Text].
|
| 4.
|
Cheney, C. P., and E. C. Boedeker.
1983.
Adherence of an enterotoxigenic Escherichia coli strain, serotype O78:H11, to purified human intestinal brush borders.
Infect. Immun.
39:1280-1284[Abstract/Free Full Text].
|
| 5.
|
Costerton, J. W.,
R. T. Irvin, and K. J. Cheng.
1981.
The role of bacterial surface structures in pathogenesis.
Crit. Rev. Microbiol.
8:303-338[Medline].
|
| 6.
|
Evans, D. G.,
T. K. Satterwhite,
D. J. Evans, Jr., and H. L. DuPont.
1978.
Differences in serological responses and excretion patterns of volunteers challenged with enterotoxigenic Escherichia coli with and without the colonization factor antigen.
Infect. Immun.
19:883-888[Abstract/Free Full Text].
|
| 7.
|
Froehlich, B. J.,
A. Karakashian,
L. R. Melsen,
J. C. Wakefield, and J. R. Scott.
1994.
CooC and CooD are required for assembly of CS1 pili.
Mol. Microbiol.
12:387-401[Medline].
|
| 8.
|
Guzman, L.-M.,
D. Belin,
M. J. Carson, and J. Beckwith.
1995.
Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter.
J. Bacteriol.
177:4121-4130[Abstract/Free Full Text].
|
| 9.
|
Hultgren, S. J.,
S. Normark, and S. N. Abraham.
1991.
Chaperone-assisted assembly and molecular architecture of adhesive pili.
Annu. Rev. Microbiol.
45:383-415[Medline].
|
| 10.
|
Jones, C. H.,
J. S. Pinkner,
R. Roth,
J. Heuser,
A. V. Nicholes,
S. N. Abraham, and S. J. Hultgren.
1995.
FimH adhesin of type 1 pili is assembled into a fibrillar tip structure in the Enterobacteriaceae.
Proc. Natl. Acad. Sci. USA
92:2081-2085[Abstract/Free Full Text].
|
| 11.
|
Knutton, S.,
D. R. Lloyd,
D. C. Candy, and A. S. McNeish.
1984.
In vitro adhesion of enterotoxigenic Escherichia coli to human intestinal epithelial cells from mucosal biopsies.
Infect. Immun.
44:514-518[Abstract/Free Full Text].
|
| 12.
|
Kuehn, M. J.,
J. Heuser,
S. Normark, and S. J. Hultgren.
1992.
P pili in uropathogenic E. coli are composite fibres with distinct fibrillar adhesive tips.
Nature
356:252-255[Medline].
|
| 13.
|
Lopez, J., and R. E. Webster.
1983.
Morphogenesis of filamentous bacteriophage f1: orientation of extrusion and production of polyphage.
Virology
127:177-193[Medline].
|
| 14.
|
Lowe, M. A.,
S. C. Holt, and B. I. Eisenstein.
1987.
Immunoelectron microscopic analysis of elongation of type 1 fimbriae in Escherichia coli.
J. Bacteriol.
169:157-163[Abstract/Free Full Text].
|
| 15.
|
Marron, M. B., and C. J. Smyth.
1995.
Molecular analysis of the cso operon of enterotoxigenic Escherichia coli reveals that CsoA is the adhesin of CS1 fimbriae and that the accessory genes are interchangeable with those of the cfa operon.
Microbiology
141:2849-2859[Abstract/Free Full Text].
|
| 16.
|
Ogierman, M. A.,
S. Zabihi,
L. Mourtzios, and P. A. Manning.
1993.
Genetic organization and sequence of the promoter-distal region of the tcp gene cluster of Vibrio cholerae.
Gene
126:51-60[Medline].
|
| 17.
|
Perez-Casal, J.,
J. S. Swartley, and J. R. Scott.
1990.
Gene encoding the major subunit of CS1 pili of human enterotoxigenic Escherichia coli.
Infect. Immun.
58:3594-3600[Abstract/Free Full Text].
|
| 18.
|
Prentki, P., and H. M. Krisch.
1984.
In vitro insertional mutagenesis with a selectable DNA fragment.
Gene
29:303-313[Medline].
|
| 19.
|
Russel, M.
1991.
Filamentous phage assembly.
Mol. Microbiol.
5:1607-1613[Medline].
|
| 20.
|
Sajjan, S. U., and J. F. Forstner.
1992.
Identification of the mucin-binding adhesin of Pseudomonas cepacia isolated from patients with cystic fibrosis.
Infect. Immun.
60:1434-1440[Abstract/Free Full Text].
|
| 21.
|
Sajjan, U. S.,
L. Sun,
R. Goldstein, and J. F. Forstner.
1995.
Cable (Cbl) type II pili of cystic fibrosis-associated Burkholderia (Pseudomonas) cepacia: nucleotide sequence of the cblA major pilin subunit pilin gene and novel morphology of the assembled appendage fibers.
J. Bacteriol.
177:1030-1038[Abstract/Free Full Text].
|
| 22.
|
Sakellaris, H.,
D. P. Balding, and J. R. Scott.
1996.
Assembly proteins of CS1 pili of enterotoxigenic Escherichia coli.
Mol. Microbiol.
21:529-541[Medline].
|
| 23.
|
Sakellaris, H., and J. R. Scott.
1998.
New tools in an old trade: CS1 pilus morphogenesis.
Mol. Microbiol.
30:681-687[Medline].
|
| 24.
|
Scott, J. R.
1974.
A turbid plaque-forming mutant of phage P1 that cannot lysogenize Escherichia coli.
Virology
62:344-349[Medline].
|
| 25.
|
Scott, J. R.,
J. C. Wakefield,
P. W. Russell,
P. E. Orndorff, and B. J. Froehlich.
1992.
CooB is required for assembly but not transport of CS1 pilin.
Mol. Microbiol.
6:293-300[Medline].
|
| 26.
|
Sohel, I.,
J. L. Puente,
S. W. Ramer,
D. Bieber,
C. Y. Wu, and G. K. Schoolnik.
1996.
Enteropathogenic Escherichia coli: identification of a gene cluster coding for bundle-forming pilus morphogenesis.
J. Bacteriol.
178:2613-2628[Abstract/Free Full Text].
|
| 27.
|
Stone, K. D.,
H. Z. Zhang,
L. K. Carlson, and M. S. Donnenberg.
1996.
A cluster of fourteen genes from enteropathogenic Escherichia coli is sufficient for the biogenesis of a type IV pilus.
Mol. Microbiol.
20:325-337[Medline].
|
| 28.
|
Viboud, G. I.,
M. M. McConnell,
A. Helander, and A. M. Svennerholm.
1996.
Binding of enterotoxigenic Escherichia coli expressing different colonization factors to tissue-cultured Caco-2 cells and to isolated human enterocytes.
Microb. Pathog.
21:139-147[Medline].
|
| 29.
|
Voegele, K.,
H. Sakellaris, and J. R. Scott.
1997.
CooB plays a chaperone-like role for the protein involved in formation of CS1 pili of enterotoxigenic Escherichia coli.
Proc. Natl. Acad. Sci. USA
94:13257-13261[Abstract/Free Full Text].
|
Journal of Bacteriology, March 1999, p. 1694-1697, Vol. 181, No. 5
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Starks, A. M., Froehlich, B. J., Jones, T. N., Scott, J. R.
(2006). Assembly of CS1 Pili: the Role of Specific Residues of the Major Pilin, CooA. J. Bacteriol.
188: 231-239
[Abstract]
[Full Text]
-
Anantha, R. P., McVeigh, A. L., Lee, L. H., Agnew, M. K., Cassels, F. J., Scott, D. A., Whittam, T. S., Savarino, S. J.
(2004). Evolutionary and Functional Relationships of Colonization Factor Antigen I and Other Class 5 Adhesive Fimbriae of Enterotoxigenic Escherichia coli. Infect. Immun.
72: 7190-7201
[Abstract]
[Full Text]
-
Duthy, T. G., Manning, P. A., Heuzenroeder, M. W.
(2002). Identification and Characterization of Assembly Proteins of CS5 Pili from Enterotoxigenic Escherichia coli. J. Bacteriol.
184: 1065-1077
[Abstract]
[Full Text]
-
Sakellaris, H., Munson, G. P., Scott, J. R.
(1999). A conserved residue in the tip proteins of CS1 and CFA/I pili of enterotoxigenic Escherichia coli that is essential for adherence. Proc. Natl. Acad. Sci. USA
96: 12828-12832
[Abstract]
[Full Text]
Top
Abstract
Text
