Previous Article | Next Article 
Journal of Bacteriology, March 1999, p. 1739-1747, Vol. 181, No. 6
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Tyrosine Aminotransferase Catalyzes the Final Step
of Methionine Recycling in Klebsiella pneumoniae
Jacqueline
Heilbronn,1,2
Judith
Wilson,1 and
Bradley
J.
Berger1,*
Department of Biochemistry, University of
Dundee,1 and Scottish Crop Research
Institute, Invergowrie,2 Dundee, United
Kingdom
Received 8 September 1998/Accepted 12 January 1999
 |
ABSTRACT |
An aminotransferase which catalyzes the final step in methionine
recycling from methylthioadenosine, the conversion of
-ketomethiobutyrate to methionine, has been purified from
Klebsiella pneumoniae and characterized. The enzyme was
found to be a homodimer of 45-kDa subunits, and it catalyzed methionine
formation primarily using aromatic amino acids and glutamate as the
amino donors. Histidine, leucine, asparagine, and arginine were also
functional amino donors but to a lesser extent. The N-terminal amino
acid sequence of the enzyme was determined and found to be almost
identical to the N-terminal sequence of both the Escherichia
coli and Salmonella typhimurium tyrosine
aminotransferases (tyrB gene products). The structural gene
for the tyrosine aminotransferase was cloned from K. pneumoniae and expressed in E. coli. The deduced
amino acid sequence displayed 83, 80, 38, and 34% identity to the
tyrosine aminotransferases from E. coli, S. typhimurium, Paracoccus denitrificans, and
Rhizobium meliloti, respectively, but it showed less than 13% identity to any characterized eukaryotic tyrosine
aminotransferase. Structural motifs around key invariant residues
placed the K. pneumoniae enzyme within the Ia subfamily of
aminotransferases. Kinetic analysis of the aminotransferase showed that
reactions of an aromatic amino acid with -ketomethiobutyrate and of
glutamate with -ketomethiobutyrate proceed as favorably as the
well-known reactions of tyrosine with -ketoglutarate and tyrosine
with oxaloacetate normally associated with tyrosine aminotransferases.
The aminotransferase was inhibited by the aminooxy compounds canaline
and carboxymethoxylamine but not by substrate analogues, such as
nitrotyrosine or nitrophenylalanine.
| |
INTRODUCTION |
The amino acid methionine (Met) is
required for a number of important cellular functions, including the
initiation of protein synthesis, the methylation of rRNA and
xenobiotics, and the biosynthesis of cysteine, phospholipids, and
polyamines. The last function is especially important in rapidly
growing cells, such as most parasites, bacteria, and cancer cells,
which synthesize large amounts of polyamines (30). The
production of spermidine from putrescine and of spermine from
spermidine consumes Met (in the form of decarboxylated
S-adenosylmethionine) in a one-to-one stoichiometry, with
methylthioadenosine as a by-product. As the availability of
Met is often limiting, a unique pathway to recycle the amino acid from
methylthioadenosine exists (Fig. 1). This
pathway has been partially characterized for a number of organisms,
including rat liver (2, 3, 46), plants (44),
yeast (29) and protozoal parasites (19, 38, 40).
However, the only organism for which all the steps have been delineated
is the gram-negative bacterium Klebsiella pneumoniae, where
a series of unusual enzymes have been found to be responsible for the
conversion of methylthioribose-phosphate to -ketomethiobutyrate
(KMTB) (17, 32, 43, 45, 46). To date, these enzymes have not
been well studied in any other system.
View larger version (20K):
[in this window]
[in a new window]
|
FIG. 1.
The Met regeneration pathway. The cycle functions to
recycle Met (top of figure) for use as an aminopropyl donor in
polyamine synthesis. The enzymes involved are as follows: 1, S-adenosylmethionine synthetase; 2, S-adenosylmethionine decarboxylase; 3, spermidine/spermine
synthetase; 4, methylthioadenosine phosphorylase; 4a,
methylthioadenosine nucleosidase; 4b, methylthioribose kinase; 5, undetermined isomerase; 6, undetermined dehydratase; 7a and 7b,
bifunctional E-1 enolase-phosphatase; and 8a, E-2 dioxygenase. The
reaction labelled 8 occurs nonenzymatically in K. pneumoniae
and via the E-3 dioxygenase in rat liver (46). The reaction
catalyzed by 4 occurs in eukaryotes, and those catalyzed by 4a and 4b
occur in prokaryotes. The final step, labelled KMAT (KMTB to Met
aminotransferase), is the subject of the present study.
|
|
The final step of this Met recycling pathway, the transaminative
conversion of KMTB to Met (KMAT activity), was originally discovered in
rat liver by Backlund et al. (2), but it has not been
thoroughly characterized in any system. In the original study, rat
liver homogenates were found to produce Met from KMTB using glutamine
or asparagine as the amino donor, and glutamate and aspartate were
found to be ineffective donors. No other amino acids were examined as
potential amino donors. These results were consistent with the findings
of Cooper and Meister (9), who found that purified rat liver
or kidney glutamine aminotransferase could utilize KMTB as a substrate.
Again, a wider examination of KMTB amino donor specificity was not
conducted. These early studies have led to the impression that
glutamine aminotransferase was responsible for Met recycling in all
organisms and that glutamine and asparagine were the primary amino
donors. Indeed, even in K. pneumoniae the final step has
been characterized no further than citation of the rat liver data
(10).
In previous studies examining Met recycling in the trypanosomatids
Crithidia fasciculata and Trypanosoma brucei
brucei, aromatic amino acids were found to be the preferred amino
donors for KMTB (4). Purification of this activity from
C. fasciculata uncovered three distinct aminotransferases
catalyzing the reaction, none of which effectively used glutamine or
asparagine, and one of which displayed a peptide sequence and
activities consistent with a cytosolic aspartate aminotransferase
(ASAT) (5). Due to the lack of comparative information
available on the conversion of KMTB to Met in other organisms, we are
interested in characterizing KMTB transamination in bacteria and
mammals. Using K. pneumoniae as a model system, due to the
large amount of existing information on the other steps in the Met
recycling pathway available in this organism, we have found that the
aromatic amino acids and glutamate are the most effective amino donors.
The aminotransferase responsible for this activity has been purified,
cloned, and expressed as a recombinant enzyme and has been found to be
a tyrosine aminotransferase (TyrAT).
| |
MATERIALS AND METHODS |
Bacteria and culture conditions.
K. pneumoniae ATCC
13883 (type strain) was obtained from the Public Health Laboratory
Service (London, United Kingdom) and was grown in a defined minimal
medium (20) consisting of 25 mM NH4Cl, 35 mM
glucose, 1.5 mM KCl, 0.4 mM MgSO4, 0.045 mM NaCl, 0.025 mM
FeSO4, 0.025 µg of thiamine per ml, 66.6 mM sodium
phosphate (pH 7.4), and Ca, Co, Mn, BO3, Zn, Cu, and Mo as
micronutrients. All cell cultures were grown at 37°C with agitation
for 18 h before harvesting by centrifugation.
Enzyme preparation and purification.
Pelleted cells were
resuspended in 2 to 3 volumes of isolation buffer (25 mM potassium
phosphate [pH 7.8], 120 mM KCl, 1 mM dithiothreitol [DTT], 2.5 mM
-ketoglutarate, 0.2 mM pyridoxal phosphate) and disrupted by
sonication on ice or by passage through a French Press (American
Instrument Co., Silver Spring, Md.) at 1,500 lb/in2. The
homogenate was then centrifuged at 25,000 × g for 30 min at 4°C, and the resulting supernatant was dialyzed against 25 mM
potassium phosphate (pH 7.4)-1 mM DTT-1 mM EDTA. The dialysate was
either used directly to assay KMAT activity by using a variety of amino
acid amino donors, as outlined below, or used as the starting material
for enzyme purification.
All purification steps were performed at 4°C by using a Beckman model
510 biocompatible high-performance liquid chromatograph (HPLC) (Beckman
Instruments, High Wycombe, United Kingdom) equipped with an
ultraviolet/visible spectrophotometric detector. The crude, dialyzed
supernatant was loaded onto a 2.6 cm by 13 cm DEAE-Sepharose-FF (Pharmacia, St. Albans, United Kingdom) column which had been previously equilibrated with 10 mM potassium phosphate (pH 7.4)-1 mM
DTT-1 mM EDTA (buffer A). Following a wash with buffer A, protein was
eluted with a linear gradient to buffer B (buffer A plus 1.75 M KCl).
The column eluate was monitored by measuring absorbance at 280 nm, and
fractions were assayed as described below.
The active fractions from the DEAE column were pooled, dialyzed against
buffer A, and applied to either a 1.6 cm by 13 cm
Reactive Red
120-Sepharose-FF (Pharmacia) column or a 1.6 cm by
11 cm
hydroxylapatite (Merck, Poole, United Kingdom) column. For
the former,
the column was equilibrated with buffer A and was
eluted with a linear
gradient to buffer C (buffer A plus 250 mM
KCl) followed by a step
gradient to buffer B. For the latter,
the column was equilibrated with
buffer A and eluted with a linear
gradient to buffer D (same as buffer
A, except that 750 mM (pH
7.4) rather than 10 mM potassium phosphate
was
used).
The active fractions were pooled and applied to a 1.0 cm by 10 cm
Mono-Q column (Pharmacia) which had been equilibrated with
buffer A. Proteins were eluted with a linear gradient to 50% buffer
B. The
active fractions were pooled and concentrated to less than
2.0 ml by
using 30-kDa-cutoff centrifugal filters (Flowgen, Lichfield,
United
Kingdom) before being loaded onto a 1.6 cm by 54 cm Sephacryl
S200
(Pharmacia) column. The column was equilibrated and eluted
with buffer
A and was calibrated by using a mixture of blue dextran,
aldehyde
dehydrogenase, and carbonic anhydrase. The active fractions
were pooled
and concentrated to 1.0 ml, and an equal volume of
buffer A-4 M
ammonium sulfate was added. This sample was then
applied to a 4.2 mm by
100 mm Poros phenylethyl column (Perseptive
Biosystems, Warrington,
United Kingdom) equilibrated with buffer
E (buffer A plus 2 M ammonium
sulfate). Proteins were then eluted
with a linear gradient to buffer
A.
The active fractions were pooled, concentrated to 0.3 ml, and utilized
for native gel electrophoresis carried out by a modified
method of
Geleherter et al. (
18). Proteins were separated at
4°C on
5% acrylamide gels (without sodium dodecyl sulfate) with
a 2.8%
acrylamide stacking region by using 5 mM Tris-38 mM glycine-2
mM
-ketoglutarate-0.1 mM pyridoxal phosphate as the tank buffer.
Upon
completion of electrophoresis, half of the gel was stained
with
Coomassie brilliant blue R-250, and the other half was stained
for KMAT
activity. For the latter stain, the gel was soaked in
3 mM potassium
ferricyanide for 3 min at room temperature, rinsed
in distilled water,
and stained in the dark at 37°C with 100 mM
potassium phosphate (pH
7.4)-10 mM iodotyrosine-5 mM KMTB-40 µM
pyridoxal phosphate-5
µg of phenazine methosulfonate/ml-0.2 mg
of
3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide/ml.
After development of the dark purple bands, the gel was washed
in
distilled water and fixed with 5% acetic
acid.
To determine the N-terminal amino acid sequence of the active protein,
the native gel electrophoresis was repeated, the product
was
electroblotted onto polyvinylidene difluoride membrane (Bio-Rad,
Hemel
Hempstead, United Kingdom) and stained with Amido Black,
and the band
was excised. N-terminal amino acid sequencing was
performed by the MRC
Protein Phosphorylation Unit, University
of Dundee, Dundee, United
Kingdom.
Enzyme assays.
All column fractions were screened for KMAT
activity by a modified method of Diamondstone (12). Test
fraction (5 or 10 µl) was added to 1.0 ml of 10 mM potassium
phosphate (pH 7.4)-2 mM tyrosine-0.5 mM KMTB-50 µM pyridoxal
phosphate. The sample was then mixed and incubated for 30 min at 37°C
before the addition of 70 µl of 10 M NaOH and further incubation at
37°C for 30 min. The absorbance of the
p-hydroxybenzaldehyde generated was measured at 331 nm.
For quantitative measurement of KMAT activity, Met production was
determined by HPLC. A volume of enzyme sample (1 to 10 µl)
was added
to 100 µl of reaction mixture containing 10 mM phosphate
buffer (pH
7.4)-2 mM amino acid-1 mM KMTB-50 µM pyridoxal phosphate
and
incubated for 30 min at 37°C. Reaction mixtures contained
either
individual amino acids (2 mM) or a mixture of certain amino
acids
(ADEFGHIKNQRSTWY) at 2 mM each. At the end of the incubation,
the
samples were frozen at
20°C until assayed. After thawing
of the
samples, 1 µl of 100 mM norleucine was added as an internal
standard.
Ten microliters of sample was mixed with 50 µl of 0.4
M borate (pH
10.5) and then with 10 µl of 10 mg of
o-phthalaldehyde/ml-12
µl of 3-mercaptopropionate/ml-0.4
M borate (pH 10.5). Seven microliters
of this mixture was then injected
onto a 2.1 mm by 200 mm Amino-Quant
column (Hewlett-Packard, Stockport,
United Kingdom) run on a Beckman
HPLC system consisting of a model 126 binary pump, 166 photodiode
array ultraviolet/visible light
spectrophotometer, 507e autosampler,
and System Gold operating
software. The column was run at ambient
temperature with an initial
flow rate of 0.45 ml/min, and 2.72
mg of sodium acetate/ml-0.018%
(vol/vol) triethylamine-0.3% (vol/vol)
tetrahydrofuran (pH 7.2) was
used as solvent A and 2.72 mg of
sodium acetate/ml-40% (vol/vol)
methanol-40% (vol/vol) acetonitrile
(pH 7.2) was used as solvent B. Elution was effected with a linear
solvent gradient of 0 to 60%
solvent B over 17 min followed by
60 to 100% solvent B over 1 min and
100% solvent B for a further
6 min; a flow rate of 0.45 ml/min was
used for the first 18 min
followed by 0.8 ml/min for the next 6 min.
Met eluted at 14.2
min, and norleucine eluted at 16.2 min. Detection
was by spectrophotometric
detection at 338 nm. Peak area ratios of Met
to norleucine were
utilized to calculate the amount of Met in a given
sample.
Alanine aminotransferase activity was assayed by HPLC for the
production of alanine from pyruvate, and ASAT activity was assayed
by
measuring the production of aspartate from oxaloacetate. The
enzyme
source (1 to 10 µl) was added to 100 µl of reaction mixture
containing 10 mM phosphate buffer (pH 7.4)-2 mM glutamate-1 mM
pyruvate or oxaloacetate-50 µM pyridoxal phosphate and incubated
for
30 min at 37°C. The samples were then treated as described
above for
the HPLC detection of KMAT activity. Aspartate eluted
at 2.0 min and
alanine eluted at 10.3 min on the chromatographic
system. HPLC
detection of TyrAT activity was accomplished by incubating
samples as
described above except that the reaction mixture contained
2 mM
tyrosine and 1 mM
-ketoglutarate and glutamate production
was
determined.
For inhibition studies, 5 µl of purified enzyme was preincubated with
100 µM or 1 mM malic acid, carboxymethoxylamine, canaline,
nitrophenylalanine, nitrotyrosine, or serine-
O-sulfate at
37°C
for 5 min before the addition of 100 µl of reaction mixture
containing
10 mM potassium phosphate (pH 7.4)-1 mM KMTB-50 µM
pyridoxal phosphate-2
mM each amino acid (ADEFGHIKNQRSTWY). The
samples were incubated
at 37°C for 30 min and analyzed by HPLC for
Met production as
described
above.
Cloning and expression of K. pneumoniae tyrosine
aminotransferase.
The tyrosine aminotransferase gene was amplified
from K. pneumoniae genomic DNA by using
GCCATATGATGTTTCAAAAAGTTGACGCCTAC and
CGGATCCTTACATCACCGCAGCAAACGCCTT as the 5' sense and 3'
antisense primers (incorporating NdeI and BamHI
restriction sites, respectively). Amplified product of the expected
length was purified from a 1% agarose gel and ligated into the
PCRScript vector (Stratagene, Cambridge, United Kingdom) and
transformed into Escherichia coli XL1-Blue MRF' Kan cells
(Stratagene). Plasmid DNA was isolated from positive clones, the insert
was sequenced by using the ABI cycle-sequencing kit (ABI, Warrington,
United Kingdom), and the NdeI-BamHI fragment
containing the tyrosine aminotransferase gene was subcloned into the
pET-16b expression vector, which contains a sequence for an N-terminal
poly-His tag (Novagen, Cambridge, United Kingdom). After confirmation
of ligation, the plasmid was transformed into E. coli BL21
(DE3)pLysS cells (Stratagene).
The transformed cells were grown in liquid Luria-Bertani medium
supplemented with ampicillin and chloramphenicol and were
induced with
1 mM isopropyl-
-
D-thiogalactopyranoside (IPTG) at
27°C
for 6 h. The cells were then pelleted, resuspended in 10
mM HEPES
(pH 7.4) (buffer F), and disrupted by sonication on ice.
After
centrifugation, the supernatant was loaded onto a 1.6 cm
by 10 cm
iminodiacetate Sepharose-FF (Pharmacia) column which
had been charged
with NiSO
4 and was equilibrated with buffer F.
The column
was then washed with buffer F plus 80 mM imidazole,
and the recombinant
protein was eluted with buffer F plus 800
mM imidazole. The eluted
aminotransferase was concentrated and
dialyzed against buffer F before
use.
Nucleotide sequence accession number.
The TyrAT sequence has
been deposited with GenBank under the accession no. AF074934.
| |
RESULTS |
KMAT activity in K. pneumoniae homogenates.
In
order to study the amino donor range for the conversion of KMTB to Met,
K. pneumoniae homogenates were incubated with 1 mM KMTB, a
single amino acid at 2 mM, and 50 µM pyridoxal phosphate. HPLC
analysis then allowed quantitation of the Met produced. A wide range of
amino acids were found to be effective donors, with Asp, Glu, Phe, His,
Ile, Leu, Asn, Gln, Trp, and Tyr all producing >0.5 nmol of Met/min/mg
of protein (Fig. 2A). As with C. fasciculata and T. brucei brucei homogenates (4,
5), Glu, Phe, Trp, and Tyr were the best amino donors, with >1.5
nmol of Met/min/mg of protein produced.
View larger version (23K):
[in this window]
[in a new window]
|
FIG. 2.
The amino donor range for KMAT activity in K. pneumoniae. The enzyme source was incubated with 1 mM KMTB, 2 mM
amino acid, and 50 µM pyridoxal phosphate for 30 min at 37°C before
the Met produced was quantified by HPLC. Met production for each amino
acid is shown as a relative percentage of activity for all amino acids.
The enzyme sources were supernatants of cellular homogenates collected
after centrifugation at 25,000 × g (A), purified
aminotransferase from supernatants collected after centrifugation at
25,000 × g (B), and recombinant TyrAT (C).
|
|
Purification and characterization of an aminotransferase catalyzing
KMAT activity.
Due to the ease of utilizing a modified
Diamondstone reaction when assaying large numbers of fractions,
tyrosine was used as the amino donor for KMAT activity in the initial
screening during protein purification. Fractions containing KMAT
activity with tyrosine were pooled and then assayed by HPLC by using a mixture of amino acids as amino donors (Table
1). From the first, DEAE-Sepharose,
column, only one peak of activity was found (eluting with 0.5 M KCL)
which utilized tyrosine for Met regeneration. The enzyme was then
passaged over a Red-120 Sepharose column, where it was not retained,
and a Mono-Q column, where it eluted with 0.2 M KCl. After further
separation by size exclusion, the enzyme was brought to 2 M of ammonium
sulfate, loaded onto a phenylethyl column, and eluted at 0.2 M ammonium
sulfate. At this point, the enzyme had been enriched over 700-fold for
KMAT activity, and it gave a 45,000-Da band on a sodium dodecyl
sulfate-polyacrylamide gel and a 90,000-Da peak on an S200-Sephacryl
column (data not shown). Like most aminotransferases, the purified
enzyme is a homodimer.
The purified aminotransferase was found to be responsible for all of
the KMAT activities observed in the bacterial homogenates
with the
exception of that generated with Ile and Gln and part
of that generated
with Asn and Leu (Fig.
2B). Again, Glu, Phe,
Trp, and Tyr were the
preferred amino donors, catalyzing the formation
of >1,100 nmol/min/mg
of protein. The purified enzyme was also
able to catalyze tyrosine to
-ketoglutarate aminotransfer but
was unable to effectively utilize
systems containing glutamate
and oxaloacetate, glutamate and pyruvate,
or alanine and
-ketoglutarate
(data not
shown).
A series of potential aminotransferase inhibitors (
47) were
screened against the purified aminotransferase in order to determine
their effects on KMAT activity. Using a mixture of amino acids
(ADEFGHIKLNQRSTWY) at 2 mM each, 1 mM KMTB, and 50 µM pyridoxal
phosphate as the substrate, each inhibitor was tested at 0.1 or
1.0 mM
(Fig.
3). Serine-
O-sulfate and
nitrophenylalanine were
found to have no inhibitory activity at either
concentration,
while malate and nitrotyrosine gave approximately 20%
inhibition
at the higher concentration. Only canaline and
carboxymethoxylamine,
both compounds which interact with the functional
aldehyde on
the pyridoxal phosphate cofactor, had any appreciable
effect.
At 100 µM, these two compounds inhibited KMAT activity by 35 and
70%, respectively. Addition of 1.0 mM carboxymethoxylamine led
to
a complete inhibition of KMAT activity. These results suggest
that KMAT
activity can be inhibited but that agents which bind
to the prosthetic
group, such as the aminooxy compounds, are more
likely to be potent
inhibitors.
View larger version (69K):
[in this window]
[in a new window]
|
FIG. 3.
The inhibition of Met production by the purified
aminotransferase. The purified enzyme from K. pneumoniae was
preincubated for 5 min with a single inhibitor at 0.1 mM (left column)
or 1.0 mM (right column) before the addition of a reaction mixture
containing 1 mM KMTB, certain amino acids (ADEFGHIKLNQRSTWY) at 2 mM
each as amino donors, and 50 µM pyridoxal phosphate. After incubation
at 37°C for 30 min, Met production was quantified by HPLC analysis.
All inhibition is presented relative to a control value of 100%, which
was determined by preincubating the enzyme with distilled water prior
to adding the reagent mixture.
|
|
Amino-terminal sequence of the purified aminotransferase.
The
purified aminotransferase was separated by native polyacrylamide gel
electrophoresis and transblotted, and the active band was excised and
subjected to automated Edman degradation. The amino-terminal sequence
was found to be MFQKVDAYAGDPILXLMERFXE. This sequence
is 86% identical to the N terminus of the E. coli TyrAT
(tyrB gene product) (28), 81% identical to the
Salmonella typhimurium TyrAT (33), 36% identical
to the Paracoccus denitrificans TyrAT (34), and
36% identical to the Rhizobium meliloti TyrAT (36), but it is less than 18% identical to any eukaryotic
TyrAT (6, 21, 22, 37) (Fig.
4A). Therefore, the purified K. pneumoniae aminotransferase, which catalyzes KMAT activity,
appears to be a TyrAT.
View larger version (55K):
[in this window]
[in a new window]
|
FIG. 4.
Alignment of the K. pneumoniae TyrAT with
prokaryotic and eukaryotic analogues. In all cases, the boxed residues
are identical to those found in the K. pneumoniae sequence.
(A) A direct comparison of the N-terminal amino acid sequence obtained
from the purified K. pneumoniae KMAT with known TyrATs. (B)
Clustal alignment of the deduced amino acid sequence from the product
of the K. pneumoniae tyrB gene with other known TyrATs.
Regions around key residues which are conserved across the class I
aminotransferase family are shown. In the top sequence, N-194, P-195,
and G-197 have been marked with asterisks, in the middle sequence D-222
and Y-225 have been marked, and in the bottom sequence, K-258, R-266,
and G-268 have been marked. K-258 (marked with a double asterisk) is
the pyridoxal phosphate binding site. All conserved residues are
numbered according to the nomenclature of Mehta et al. (31).
Alignment was performed using the Megalign program of the DNAStar
package (DNAStar, Madison, Wis.).
|
|
Cloning of the K. pneumoniae TyrAT.
Given the high
identity of the N terminus of the K. pneumoniae enzyme to
the E. coli tyrB gene product, oligonucleotide primers were
designed which matched the 5' and 3' ends of the coding sequence for
the E. coli enzyme. These primers, when utilized in PCR on K. pneumoniae genomic DNA, successfully amplified the
expected 1,200-bp product (data not shown), which was cloned and sequenced.
The amino acid sequence of the predicted product was found to have
close identity to the TyrATs from
E. coli and
S. typhimurium (83 and 80% identity, respectively), when compared by
clustal
analysis. In addition, the sequence identities to other known
TyrATs were 38% to
P. denitrificans, 34% to
R. meliloti, 13% to
Caenorhabditis elegans, 12% to
Trypanosoma cruzi, 12% to
Saccharomyces cerevisiae ARO8, 13% to
S. cerevisiae ARO9, 12% to
Schizosaccharomyces pombe ARO8, 12% to rat, and 12% to
human. Aside from residues
completely conserved in class I
aminotransferases (
23,
31),
there was little sequence
identity between the prokaryotic and
eukaryotic TyrATs. The presence of
the motifs LLHXCXHNPTGXDXXXXXW,
PXXDXAYQGFXXGXXXD, and
SKXXXLYXERXG around key invariant residues
(Fig.
4B)
confirmed that the
K. pneumoniae TyrAT belongs to the
Ia
subfamily of aminotransferases (
23). Clustal analysis of
many class I aminotransferases showed, as previously suggested
(
23), that all bacterial TyrATs sequenced to date (including
the
K. pneumoniae enzyme) are related to eukaryotic and
gram-negative
bacterial ASATs in subfamily Ia (Fig.
5). The yeast TyrATs (ARO8
and ARO9 gene products) formed a unique Ih subfamily
(
22), while
all other eukaryotic TyrATs sequenced to date
are related to gram-positive
bacterial and archaeal ASATs in subfamily
If (
23).
View larger version (34K):
[in this window]
[in a new window]
|
FIG. 5.
The class I family of aminotransferases. The
dendrogram was constructed based on the clustal analysis of most
aminotransferase members of the class I family, with
nonaminotransferase members (subfamilies Ic and Id) and single member
subfamilies (subfamily Ig) omitted. The K. pneumoniae TyrAT
is shown capitalized, and subfamily groupings are presented according
to the Iraqui et al. (22) revision of the nomenclature of
Jensen and Gu (23). Enzyme abbreviations are as follows:
ASAT, cytosolic aspartate aminotransferase; mASAT, mitochondrial
aspartate aminotransferase; chASAT, chloroplast aspartate
aminotransferase; TyrAT, tyrosine aminotransferase; ALAT, alanine
aminotransferase; KynAT, kynurenine aminotransferase; and HisPAT,
histidinol-phosphate aminotransferase. Putative aminotransferases
identified from published whole genome sequences (7, 8, 11,
14-16, 24, 25, 27, 39, 42) are shown with the appropriate
identification code and with the annotation given in parentheses.
|
|
Properties of the recombinant tyrosine aminotransferase.
The
full-length coding sequence of the K. pneumoniae TyrAT was
subcloned into an E. coli expression vector, and the
resulting recombinant protein was purified. This enzyme was then
utilized in the single amino acid screen for Met regeneration and was
found to produce Met from KMTB with the same amino donor preference as
was seen with the purified native enzyme (Fig. 2C). This result confirmed that a single aminotransferase was responsible for all the
activity in the purified material and also demonstrated that the
recombinant material was fully active.
A number of substrates were examined with the recombinant enzyme in
order to determine the kinetic parameters of the
K. pneumoniae TyrAT (Table
2). While
glutamate was found to be capable of producing
the highest maximum
initial velocity (
Vmax) for Met production
from
KMTB, it was found to be 5- to 10-fold poorer in terms of
substrate
specificity when compared with tyrosine, tryptophan,
and phenylalanine.
Examination of other substrate combinations
showed that the
"classic" TyrAT substrate combinations of tyrosine
with
-ketoglutarate and tyrosine with oxaloacetate were not significantly
more active than the combination of tyrosine and KMTB, while that
of
tyrosine and pyruvate was a poor substrate combination. These
results
demonstrated that the
K. pneumoniae enzyme is capable
of
performing methionine regeneration equally as well as the classic
TyrAT
reactions.
| |
DISCUSSION |
K. pneumoniae is a common cause of urinary tract,
respiratory tract, and bloodstream infections and has been found, like
many other common bacterial pathogens, to be increasingly resistant to
antibiotics. The recent SENTRY study on bloodstream infections found
that the percentage of K. pneumoniae isolates that were resistant was 87% for penicillins, 14% for cephalosporins, 4% for
penems, 5% for aminoglycosides, 4% for fluoroquinolones, 15% for
tetracycline, and 15% for trimethoprim-sulfamethoxazole
(35). In addition, hospital outbreaks of
multiple-drug-resistant K. pneumoniae have been reported
(26). As with other pathogens, the spread of resistance in
K. pneumoniae requires the discovery and development of
novel drug targets. In the past, work on the inhibition of
methylthioribose kinase (enzyme 4b in Fig. 1) has shown that
interference with the Met recycling pathway led to K. pneumoniae cell death (20). Similar studies have also
demonstrated that inhibition of methylthioadenosine phosphorylase
(enzyme 4 in Fig. 1) has a similar effect on the causative organisms of malaria and African trypanosomiasis (1, 40). Many of the enzymes in the Met recycling pathway have been poorly characterized and
could constitute additional points for chemotherapeutic intervention in
the cycle.
We have found that the final step in the pathway, the conversion of
KMTB to Met, is catalyzed in K. pneumoniae by a TyrAT (TyrB
homologue) and that this enzyme can be inhibited by aminooxy compounds
(such as canaline or carboxymethoxylamine) which interact with the
pyridoxal phosphate cofactor. Analogues of the substrate, such as
nitrotyrosine or nitrophenylalanine, were found to be poor inhibitors.
However, it is interesting that nitrotyrosine does not act as a
substrate for the K. pneumoniae TyrAT, as was seen with the
aminotransferase which catalyzes KMAT using tyrosine in C. fasciculata (5). In addition, while
carboxymethoxylamine was equally efficient in inhibiting the K. pneumoniae and C. fasciculata aminotransferases,
canaline was 20% less effective in inhibiting the K. pneumoniae enzyme than in inhibiting the C. fasciculata enzyme under identical conditions. This result suggests that the structure of the compound carrying the aminooxy group may play a
significant role in obtaining access to the pyridoxal phosphate and
thus may provide scope for the design of more-specific inhibitors of
this class.
The primary structure of the K. pneumoniae TyrAT was found
to be almost identical to those of the homologous enzymes from E. coli and S. typhimurium. While it is tempting to assume
that TyrAT performs the same function in Met recycling in these latter two organisms, it has been previously suggested that E. coli
cannot recycle methylthioadenosine due to a lack of methylthioribose kinase (10). We have expressed the E. coli TyrAT
and have found that it is capable of catalyzing KMAT to the same extent
and by using the same amino group donors as the K. pneumoniae enzyme (data not shown). Thus, E. coli
retains the ability to produce Met should it encounter or produce KMTB.
The status of Met recycling in S. typhimurium or, indeed,
other bacteria is completely unknown. However, it is interesting that
obvious homologues to the tyrB gene are absent from the
genomes of Haemophilus influenzae, Mycoplasma genitalium, Methanococcus jannaschii,
Synechocystis sp., Helicobacter pylori,
Archaeoglobus fulgidus, Borrelia burgdorferi,
Methanobacterium thermoautotrophicum, Bacillus
subtilis, Aquifex aeolicus, Treponema pallidum, and Mycobacterium tuberculosis (7, 8,
11, 13-16, 24, 25, 27, 39, 42).
The observation that the purified and recombinant TyrAT is unable to
catalyze KMAT to the same extent as seen in K. pneumoniae cell homogenates when using Ile, Gln, Asn, or Leu as an amino donor
clearly suggests that another aminotransferase(s) is responsible for
this activity. While the relative amounts of individual amino acids
free to act as amino donors in K. pneumoniae are unknown, and probably vary considerably, the range of KMAT activity catalyzed by
TyrAT suggests that it is the main enzyme for this reaction. Certainly,
the kinetic parameters determined for the TyrAT show that KMAT
reactions proceed equally as well as the reaction involving tyrosine
and -ketoglutarate and that involving tyrosine and oxaloacetate. The
structures of the amino donors other than TyrAT suggested that the
K. pneumoniae homologue of the E. coli ilvE gene
product (branched-chain amino acid aminotransferase) could be involved. However, we have expressed the E. coli enzyme and have found
no detectable activity for systems containing isoleucine and KMTB, leucine and KMTB, or glutamine and KMTB (data not shown).
Our previous work with the trypanosomatid C. fasciculata had
disclosed that aromatic amino acids and glutamate were also favored as
amino donors in that system (5). However, unlike in K. pneumoniae, the aminotransferase that utilized aromatic amino
acids and glutamate for catalyzing the reaction of KMAT in C. fasciculata had a peptide sequence consistent with an ASAT. Since
that time, we have successfully cloned approximately 40% of the gene
for this C. fasciculata aminotransferase, which clearly has
close homology to eukaryotic ASATs and not to TyrATs (data not shown).
This difference in enzyme specificity for Met recycling is intriguing.
As mentioned above, eukaryotic and gram-negative bacterial ASATs and
bacterial TyrATs have a common ancestor and form the Ia subfamily of
aminotransferases (Fig. 5 and reference 23). Jensen
and Gu (23) have suggested that a "gradient" exists
within the Ia subfamily with respect to specificity for reactions of
aspartate with -ketoglutarate and of tyrosine with
-ketoglutarate, with higher eukaryote ASATs specific for the former
reaction, lower eukaryotic and gram-negative bacterial ASATs catalyzing
both reactions but with a preference for the former, and the bacterial
TyrATs catalyzing both reactions almost equally. Our work with Met
recycling may well support this idea, since a bacterial TyrAT and a
lower eukaryotic ASAT are able to catalyze the reaction resulting in
KMAT activity with aromatic amino acids and glutamate as the amino
donor but mammalian ASAT is unable to catalyze the reaction with any
amino donor (5). As mammalian tissues contain substances
that can clearly catalyze Met recycling (data not shown; reference
46), it appears that subfamily Ia aminotransferases
are definitely not involved in this reaction in the host. Indeed, it
appears unlikely that any class I aminotransferases are involved in
mammalian Met metabolism. The exact aminotransferase(s) performing Met
recycling in host tissues is unclear and is the focus of our current investigations.
| |
ACKNOWLEDGMENTS |
We thank Nick Morrice for his assistance in N-terminal
sequencing, Emmanuel Tetaud for assistance in the cloning and
expression of the tyrB gene, and Alan H. Fairlamb for
helpful discussions.
This work was funded by the Wellcome Trust (B.J.B.).
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Div. of
Molecular Parasitology & Biological Chemistry, Wellcome Trust
Bldg., Dept. of Biochemistry, University of Dundee, Dundee, United
Kingdom DD1 5EH. Phone: 44-(0)1382-345761. Fax:
44-(0)1382-345893. E-mail: bjberger{at}bad.dundee.ac.uk.
| |
REFERENCES |
| 1.
|
Bacchi, C. J.,
J. R. Sufrin,
H. C. Nathan,
A. J. Spiess,
T. Hannan,
J. Garafolo,
K. Alecia,
L. Katz, and N. Yarlett.
1991.
5'-Alkyl-substituted analogs of 5'-methylthioadenosine as trypanocides.
Antimicrob. Agents Chemother.
35:1315-1320[Abstract/Free Full Text].
|
| 2.
|
Backlund, P. S.,
C. P. Chang, and R. A. Smith.
1982.
Identification of 2-keto-4-methylthiobutyrate as an intermediate compound in methionine synthesis from 5'-methylthioadenosine.
J. Biol. Chem.
257:4196-4202[Abstract/Free Full Text].
|
| 3.
|
Backlund, P. S., and R. A. Smith.
1980.
Methionine synthesis from 5'-methylthioadenosine in rat liver.
J. Biol. Chem.
256:1533-1535[Abstract/Free Full Text].
|
| 4.
|
Berger, B. J.,
W. W. Dai,
H. Wang,
R. E. Stark, and A. Cerami.
1996.
Aromatic amino acid transamination and methionine recycling in trypanosomatids.
Proc. Natl. Acad. Sci. USA
93:4126-4130[Abstract/Free Full Text].
|
| 5.
|
Berger, B. J.,
W. W. Dai, and J. Wilson.
1998.
Methionine formation from -ketomethiobutyrate in the trypanosomatid Crithidia fasciculata.
FEMS Microbiol. Lett.
165:305-312[Medline].
|
| 6.
|
Bontempi, E. J.,
J. Bua,
L. Aslund,
B. Porcel,
E. L. Segura,
J. Henriksson,
A. Orn,
U. Pettersson, and A. M. Ruiz.
1993.
Isolation and characterization of a gene from Trypanosoma cruzi encoding a 46-kilodalton protein with homology to human and rat tyrosine aminotransferase.
Mol. Biochem. Parasitol.
59:253-262[Medline].
|
| 7.
|
Bult, C. J.,
O. White,
G. J. Olsen,
L. X. Zhou,
R. D. Fleishmann, et al.
1996.
Complete genome sequence of the methanogenic archaeon, Methanococcus jannaschii.
Science
273:1058-1073[Abstract].
|
| 8.
|
Cole, S. T.,
R. Brosch,
J. Parkhill,
T. Garnier,
C. Churcher, et al.
1998.
Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
Nature
393:537-544[Medline].
|
| 9.
|
Cooper, A. J. L., and A. Meister.
1972.
Isolation and properties of highly purified glutamine aminotransferase.
Biochemistry
11:661-671[Medline].
|
| 10.
|
Cornell, K. A.,
R. W. Winter,
P. A. Tower, and M. K. Riscoe.
1996.
Affinity purification of 5-methylthioadenosine kinase and 5-methylthioribose/S-adenosylmethionine nucleosidase from Klebsiella pneumoniae.
Biochem. J.
317:285-290.
|
| 11.
|
Deckert, G.,
P. V. Warren,
T. Gaasterland,
W. G. Young,
A. L. Lenox,
D. E. Graham,
R. Overbeek,
M. A. Snead,
M. Keller,
M. Aujay,
R. Huber,
R. A. Feldman,
J. M. Short,
G. J. Olsen, and R. V. Swansen.
1998.
The complete genome of the hyperthermophilic bacterium Aquifex aeolicus.
Nature
392:353-358[Medline].
|
| 12.
|
Diamondstone, T. I.
1966.
Assay of tyrosine aminotransferase by conversion of p-hydroxyphenylpyruvate to p-hydroxybenzaldehyde.
Anal. Biochem.
16:395-401.
|
| 13.
|
Fleischmann, R. D.,
M. D. Adams,
O. White,
R. A. Clayton,
E. F. Kirkness, et al.
1995.
Whole-genome random sequencing and assembly of Haemophilus influenzae.
Science
269:496-512[Abstract/Free Full Text].
|
| 14.
|
Fraser, C. M.,
S. Casjens,
W. M. Wang,
G. G. Sutton,
R. Clayton, et al.
1997.
Genomic sequence of a Lyme disease spirochaete, Borrelia burgdorferi.
Nature
390:580-586[Medline].
|
| 15.
|
Fraser, C. M.,
J. D. Gocayne,
O. White,
M. D. Adams,
R. A. Clayton, et al.
1995.
The minimal gene complement of Mycoplasma genitalium.
Science
270:397-403[Abstract/Free Full Text].
|
| 16.
|
Fraser, C. M.,
S. J. Norris,
G. M. Weinstock,
O. White,
G. G. Sutton, et al.
1998.
Complete genome sequence of Treponema pallidum, the syphilis spirochete.
Science
281:375-388[Abstract/Free Full Text].
|
| 17.
|
Furfine, E. S., and R. H. Abeles.
1988.
Intermediates in the conversion of 5'-methylthioadenosine to methionine in Klebsiella pneumoniae.
J. Biol. Chem.
263:9596-9606.
|
| 18.
|
Geleherter, T. D.,
J. R. Emanuel, and C. J. Spencer.
1972.
Induction of tyrosine aminotransferase by dexamethasone, insulin, and serum: characterization of the induced enzyme.
J. Biol. Chem.
247:6197-6203[Abstract/Free Full Text].
|
| 19.
|
Ghoda, L. Y.,
T. M. Savarese,
C. H. Northrup,
R. E. Parks,
J. Garafolo,
L. Katz,
B. B. Ellenbogen, and C. J. Bacchi.
1988.
Substrate specificities of 5'-deoxy-5'-methylthioadenosine phosphorylase from Trypanosoma brucei brucei and mammalian cells.
Mol. Biochem. Parasitol.
27:109-118[Medline].
|
| 20.
|
Gianotti, A. J.,
P. A. Tower,
J. H. Sheley,
P. A. Conte,
C. Spiro,
A. J. Ferro,
J. H. Fitchen, and M. K. Riscoe.
1990.
Selective killing of Klebsiella pneumoniae by 5-trifluoromethylthioribose. Chemotherapeutic exploitation of the enzyme 5-methylthioribose kinase.
J. Biol. Chem.
265:831-837[Abstract/Free Full Text].
|
| 21.
|
Grange, T.,
C. Guenet,
J. B. Dietrich,
S. Chasserot,
M. Fromont,
N. Befort,
J. Jami,
G. Beck, and R. Pictet.
1985.
Complete complementary DNA of rat tyrosine aminotransferase messenger RNA. Deduction of the primary structure of the enzyme.
J. Mol. Biol.
184:347-350[Medline].
|
| 22.
|
Iraqui, I.,
S. Vissers,
M. Cartiaux, and A. Urrestarazu.
1998.
Characterisation of Saccharomyces cerevisiae ARO8 and ARO9 genes encoding aromatic aminotransferases I and II reveals a new aminotransferase subfamily.
Mol. Gen. Genet.
257:238-248[Medline].
|
| 23.
|
Jensen, R. A., and W. Gu.
1996.
Evolutionary recruitment of biochemically specialized subdivisions of family I within the protein superfamily of aminotransferases.
J. Bacteriol.
178:2161-2171[Free Full Text].
|
| 24.
|
Kaneko, T.,
T. Matsubayashi,
M. Sugita, and M. Sugiura.
1996.
Physical and gene maps of the unicellular cyanobacterium Synechocystis sp. strain PCC6301 genome.
Plant Mol. Biol.
31:193-201[Medline].
|
| 25.
|
Klenk, H. P.,
R. A. Clayton,
J. F. Tomb,
O. White,
K. E. Nelson, et al.
1997.
The complete sequence of the hyperthermophilic, sulphate-reducing archaeon Archaeoglobus fulgidus.
Nature
390:364[Medline].
|
| 26.
|
Kumarasinghe, G.,
C. Chow,
B. L. Koh,
K. L. Chiang,
H. Y. Liew, and T. Y. Ti.
1995.
Antimicrobial resistance problem in a university hospital.
Pathology
27:67-70[Medline].
|
| 27.
|
Kunst, F.,
N. Ogasawara,
I. Moszer,
A. M. Albertini,
G. Alloni, et al.
1997.
The complete genome sequence of the Gram-positive bacterium Bacillus subtilis.
Nature
390:249-256[Medline].
|
| 28.
|
Kuramitsu, S.,
K. Inoue,
T. Ogawa,
H. Ogawa, and H. Kagamiyama.
1985.
Aromatic amino acid aminotransferase of Escherichia coli: nucleotide sequence of the tyrB gene.
Biochem. Biophys. Res. Commun.
133:134-139[Medline].
|
| 29.
|
Marchitto, K. S., and A. J. Ferro.
1985.
The metabolism of 5-methylthioadenosine and 5-methylthioribose-1-phosphate in Saccharomyces cerevisiae.
J. Gen. Microbiol.
131:2153-2164[Abstract/Free Full Text].
|
| 30.
|
Marston, L. J., and A. E. Pegg.
1995.
Polyamines as targets for therapeutic intervention.
Annu. Rev. Pharmacol. Toxicol.
35:55-91[Medline].
|
| 31.
|
Mehta, P. K.,
T. I. Hale, and P. Christen.
1993.
Aminotransferases: demonstration of homology and division into evolutionary subgroups.
Eur. J. Biochem.
214:549-561[Medline].
|
| 32.
|
Myers, R. W., and R. H. Abeles.
1993.
Purification and characterization of an enzyme involved in oxidative carbon-carbon bond-cleavage reactions in the methionine salvage pathway of Klebsiella pneumoniae.
J. Biol. Chem.
268:24785-24791[Abstract/Free Full Text].
|
| 33.
|
Nakai, Y.,
H. Hayashi, and H. Kagamiyama.
1996.
Cloning and characterization of the tyrB gene from Salmonella typhimurium.
Biochim. Biophys. Acta
1308:189-192[Medline].
|
| 34.
|
Oue, S.,
A. Okamoto,
Y. Nakai,
M. Nakahira,
T. Shibatani,
H. Hayashi, and H. Kagamiyama.
1997.
Paracoccus denitrificans aromatic amino acid aminotransferase: a model enzyme for the study of dual substrate recognition mechanism.
J. Biochem.
121:161-171[Abstract/Free Full Text].
|
| 35.
|
Pfaller, M. A.,
R. N. Jones,
G. V. Doern,
K. Kugler, and the SENTRY Participants Group.
1998.
Bacterial pathogens isolated from patients with bloodstream infection: frequencies of occurrence and antimicrobial susceptibility patterns from the SENTRY antimicrobial surveillance program (United States and Canada, 1997).
Antimicrob. Agents Chemother.
42:1762-1770[Abstract/Free Full Text].
|
| 36.
|
Rastogi, V. K., and R. J. Watson.
1991.
Aspartate aminotransferase activity is required for aspartate catabolism and symbiotic nitrogen fixation in Rhizobium meliloti.
J. Bacteriol.
173:2879-2887[Abstract/Free Full Text].
|
| 37.
|
Rettenheimer, R.,
E. Natt,
H. Zentgraf, and G. Scherer.
1990.
Isolation and characterization of the human tyrosine aminotransferase gene.
Nucleic Acids Res.
18:3853-3861[Abstract/Free Full Text].
|
| 38.
|
Riscoe, M. K.,
P. A. Tower,
D. H. Peyton,
A. J. Ferro, and J. H. Fitchen.
1991.
Methionine recycling as a target for antiprotozoal drug development, p. 450-457.
In
G. Coombs, and M. North (ed.), Biochemical protozoology. Taylor and Francis, London, United Kingdom.
|
| 39.
|
Smith, D. R.,
L. A. Doucette-Stamm,
C. Deloughery,
H. Lee,
J. Dubois, et al.
1997.
Complete genome sequence of Methanobacterium thermoautotrophicum  H: functional analysis and comparative genetics.
J. Bacteriol.
179:7135-7155[Abstract/Free Full Text].
|
| 40.
|
Sufrin, J. R.,
S. R. Meshnik,
A. J. Spiess,
J. Garafolo-Hannon,
X. Q. Pan, and C. J. Bacchi.
1995.
Methionine recycling pathways and antimalarial drug design.
Antimicrob. Agents Chemother.
39:2511-2515[Abstract].
|
| 41.
|
The C. elegans Sequencing Consortium.
1998.
Genome sequencing of the nematode C. elegans: a platform for investigating biology.
Science
282:2012-2018[Abstract/Free Full Text].
|
| 42.
|
Tomb, J. F.,
O. White,
A. R. Kerlavage,
R. A. Clayton,
G. G. Sutton, et al.
1997.
The complete genome sequence of the gastric pathogen Helicobacter pylori.
Nature
388:539-547[Medline].
|
| 43.
|
Trackman, P. C., and R. H. Abeles.
1983.
Methionine synthesis from 5'-S-methylthioadenosine. Resolution of enzyme activities and identification of 1-phospho-5-S-methlthioribulose.
J. Biol. Chem.
258:6717-6720[Abstract/Free Full Text].
|
| 44.
|
Wang, S. Y.,
D. O. Adams, and M. Lieberman.
1982.
Recycling of 5'-methylthioadenosine-ribose carbon atoms into methionine in tomato tissue in relation to ethylene production.
Plant Physiol. (Rockville)
70:117-121[Abstract/Free Full Text].
|
| 45.
|
Wray, J. W., and R. H. Abeles.
1993.
A bacterial enzyme that catalyzes formation of carbon monoxide.
J. Biol. Chem.
268:21466-21469[Abstract/Free Full Text].
|
| 46.
|
Wray, J. W., and R. H. Abeles.
1995.
The methionine salvage pathway in Klebsiella pneumoniae and rat liver. Identification and characterization of two novel dioxygenases.
J. Biol. Chem.
270:3147-3152[Abstract/Free Full Text].
|
| 47.
|
Zollner, H.
1993.
Handbook of enzyme inhibitors, 2nd ed.
VCH Publishers, New York, N.Y.
|
Journal of Bacteriology, March 1999, p. 1739-1747, Vol. 181, No. 6
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Lartey, F. M., Austic, R. E.
(2009). Phenylalanine hydroxylase activity and expression in chicks subjected to phenylalanine imbalance or phenylalanine toxicity. Poult. Sci.
88: 774-783
[Abstract]
[Full Text]
-
Schuster, J., Knill, T., Reichelt, M., Gershenzon, J., Binder, S.
(2006). BRANCHED-CHAIN AMINOTRANSFERASE4 Is Part of the Chain Elongation Pathway in the Biosynthesis of Methionine-Derived Glucosinolates in Arabidopsis. Plant Cell
18: 2664-2679
[Abstract]
[Full Text]
-
Carre-Mlouka, A., Mejean, A., Quillardet, P., Ashida, H., Saito, Y., Yokota, A., Callebaut, I., Sekowska, A., Dittmann, E., Bouchier, C., de Marsac, N. T.
(2006). A New Rubisco-like Protein Coexists with a Photosynthetic Rubisco in the Planktonic Cyanobacteria Microcystis. J. Biol. Chem.
281: 24462-24471
[Abstract]
[Full Text]
-
Hosono, A., Mizuguchi, H., Hayashi, H., Goto, M., Miyahara, I., Hirotsu, K., Kagamiyama, H.
(2003). Glutamine:phenylpyruvate Aminotransferase from an Extremely Thermophilic Bacterium, Thermus thermophilus HB8. J Biochem
134: 843-851
[Abstract]
[Full Text]
-
Ashida, H., Saito, Y., Kojima, C., Kobayashi, K., Ogasawara, N., Yokota, A.
(2003). A Functional Link Between RuBisCO-like Protein of Bacillus and Photosynthetic RuBisCO. Science
302: 286-290
[Abstract]
[Full Text]
-
Berger, B. J., English, S., Chan, G., Knodel, M. H.
(2003). Methionine Regeneration and Aminotransferases in Bacillus subtilis, Bacillus cereus, and Bacillus anthracis. J. Bacteriol.
185: 2418-2431
[Abstract]
[Full Text]
-
Berger, L. C., Wilson, J., Wood, P., Berger, B. J.
(2001). Methionine Regeneration and Aspartate Aminotransferase in Parasitic Protozoa. J. Bacteriol.
183: 4421-4434
[Abstract]
[Full Text]
-
Berger, B. J.
(2000). Antimalarial Activities of Aminooxy Compounds. Antimicrob. Agents Chemother.
44: 2540-2542
[Abstract]
[Full Text]
Top
Abstract
Introduction
