Journal of Bacteriology, March 1999, p. 1953-1957, Vol. 181, No. 6
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.

Institute of Genetic Ecology,
Received 6 August 1998/Accepted 8 January 1999
Avirulent Erwinia carotovora subsp.
carotovora CGE234-M403 produces two types of bacteriocin.
For the purpose of cloning the bacteriocin genes of strain
CGE234M403, a spontaneous rifampin-resistant mutant of this strain,
M-rif-11-2, was isolated. By Tn5 insertional mutagenesis
using M-rif-11-2, a mutant, TM01A01, which produces the
high-molecular-weight bacteriocin but not the low-molecular-weight bacteriocin was obtained. By thermal asymmetric interlaced PCR, the DNA
sequence from the Tn5 insertion site and the DNA sequence of a contiguous 1,280-bp region were determined. One complete open
reading frame (ORF), designated ORF2, was identified within the
sequenced fragment. The 3' end of another ORF, ORF1, was located upstream of ORF2. A noncoding region and a putative promoter were located between ORF1 and ORF2. Downstream from ORF2, the 5' end of
another ORF (ORF3) was found. Deduction from the nucleotide sequence
indicated that ORF2 encodes a protein of 99 amino acids, which showed
high homology with Yersinia enterocolitica Yrp, a regulator of enterotoxin (Y-ST) production; Escherichia
coli host factor 1, required for Q Erwinia carotovora subsp.
carotovora is a phytopathogenic bacterium responsible for
the soft-rot disease of many plant species. Despite its economic
importance, no efficient method, either chemical or otherwise, has been
found to control this worldwide disease. Agrochemicals are generally
used for the control of this disease, but in a quest for a more
environmentally friendly control methods, biological control is under investigation.
Some bacterial species produce one or more antibacterial substances
called bacteriocins, which enhance their competitiveness with other
related bacterial species (27). According to the report of
Kikumoto et al. (13), the antibacterial activity of two
types of bacteriocin produced by biocontrol agents (avirulent E. carotovora subsp. carotovora) may
contribute to the suppression of soft-rot disease (18).
There is also strong evidence of the effectiveness of biological
control of the soft-rot disease of Chinese cabbage (14, 22).
A biological control agent with the trade name Biokeeper has therefore
been developed for the control of this disease in Japan. In view of
these reports, identification and cloning of the gene(s) controlling
bacteriocin production may facilitate its use in further control
methods, such as the development of resistant cultivars by the cloning
of such a gene(s) into Chinese cabbage and tobacco plants.
Gram-negative and gram-positive bacteria commonly harbor plasmid-borne
genetic determinants of bacteriocin production and of host cell
bacteriocin immunity, but new evidence (4) shows that these
genes are located on chromosomal DNA in E. carotovora subsp. carotovora strains.
To date, no genes encoding the low-molecular-weight bacteriocin of
E. carotovora subsp. carotovora have been
isolated or characterized. Here, we report the cloning and sequencing
of DNA containing the bacteriocin regulator gene (brg) from
E. carotovora subsp. carotovora CGE234M403's rifampin-resistant mutant, M-rif-11-2.
Bacterial strains, plasmids, and growth media.
The bacterial
strains and plasmids used in this study are listed in Table
1. The putative biocontrol agent produces
two types of bacteriocin, low- and high-molecular-weight
bacteriocins. E. carotovora subsp.
carotovora strains were propagated at 28°C in nutrient
agar (NA) containing 1.4% agar or with shaking in
Luria-Bertani (LB) medium with 5 g of NaCl per liter
substituted for 10 g. Escherichia coli strains were
propagated at 37°C in LB medium with shaking. Rifampin, kanamycin,
and ampicillin (all at 50 µg per ml) were added to NA and LB agar
when necessary.
![]()
ABSTRACT
Top
Abstract
Text
References
-replicase; and
Azorhizobium caulinodans NrfA, required for the
expression of nifA. ORF2 was designated brg,
bacteriocin regulator gene. A fragment containing ORF2 and its promoter
was amplified and cloned into pBR322 and pHSG415r, and the recombinant
plasmids, pBYL1 and pHYL1, were transferred into E. coli
DH5. Plasmid pBYL1 was reisolated and transferred into the insertion
mutant TM01A01. Transformants carrying the plasmid, which was
reisolated and designated pBYL1, re-produced the low-molecular-weight bacteriocin.
![]()
TEXT
Top
Abstract
Text
References
TABLE 1.
Bacteria and plasmids used in this study
Bacterial mating. Bacterial mating was carried out on NA by the membrane-filter mating method (8), by using 0.22-µm-pore-size membrane filters (Millipore, Inc. Bedford, Mass.). The filters were placed on NA and incubated overnight at 28°C. Appropriate dilutions of the suspension of the progeny of the mating were spread on modified Drigalski's agar plates (26) containing 50 ppm each of rifampin and kanamycin and were incubated at 28°C for 24 to 48 h before the colonies were counted.
Bacteriocin assays. Bacteriocin production was examined by the double-layer method of Fredericq (7), but hard and soft IFO-802 media containing, respectively, 1.4 and 0.65% agar were used. Growth inhibition zones around the colonies were considered an indication of bacteriocin production.
Genetic engineering technique. Plasmids of E. carotovora subsp. carotovora were isolated according to the method of Kado and Liu (11), and E. coli plasmids were isolated by the method of Sambrook et al. (20). Total DNA was isolated as previously described (16).
Oligonucleotide DNA primers were synthesized by the Gibco BRL Co. and Takara Co. (Tokyo, Japan). Reagents were purchased from the Takara Co. The general PCR procedure has been described by Sambrook et al. (20). Thermal asymmetric interlaced PCR (TAIL-PCR) was performed according to the method of Liu and Whittier (15), but the annealing temperature for specific primers was increased from 63 to 65°C for this study. For TAIL-PCR, specific primers that are complementary to the respective sequences of Tn5 were synthesized: AGAGAACACAGATTTAGCCCAGTCGG (PF-1), CCGCACGATGAAGAGCAGAAGTTAT (PF-2), GATCCTGGAAAACGGGAAAGGTTC (PF-3), GCCGAAGAGAACACAGATTTAGCCCA (PR-1), CCGCACGATGAAGAGCAGAAGTT (PR-2), and CAGATCTCTGGAAAACGGGAAAGG (PR-3). In addition, two arbitrary degenerate primers, GTNCGA(C/G)(A/T)CANA(A/T)GTT (N-2) and (A/T)GTGNAG(A/T)ANCANAGA (N-3), were used. For sequencing of TAIL-PCR products, the ABI PRISM Dye Terminator Cycle Sequencing Ready Reactions Kit was used. Cycle sequencing was carried out on a GeneAmp System 9600 thermocycler. Sequencing using an automated DNA sequencer 373A (ABI) was carried out according to the manufacturer's protocol. Southern and colony hybridizations, probe labeling, and detection were performed by using the DIG DNA Labeling and Detection Kit (Boehringer GmbH, Mannheim, Germany) as described by the manufacturer. Hybridization was performed overnight, and the membrane was washed according to the recommendation of the manufacturer. DNA electrophoresis, restriction digestion, ligation, and transformation for E. coli were carried out as described by Sambrook et al. (20). Plasmid DNA transformation for E. carotovora subsp. carotovora was performed by the methods of Hinton et al. (10) and Hanahan (9).Computer analysis of sequence data. The nucleotide sequence and deduced amino acid sequence of Brg were compared by the BLAST and FASTA programs of the National Center for Biotechnology Information server. Sequence data were compiled with DNASIS-Mac software (Hitachi, Tokyo, Japan).
Isolation of transposon insertion mutants. For the Tn5 mutagenesis, the transmissible plasmid pJB4JI was used. By mating E. coli 1830 with E. carotovora subsp. carotovora M-rif-11-2, 5,500 insertion mutants that could grow on a selective medium containing 50 ppm each of rifampin and kanamycin were isolated. In order to ascertain their antibiotic resistance, their growth on the selective medium was rechecked and found to be a stable property of the isolates. Of these 5,500 isolated mutants, only 1 was defective in the production of low-molecular-weight bacteriocin. This defective mutant was further purified on modified Drigalski's medium containing 50 ppm each of rifampin and kanamycin. All the mutants defective in low-molecular-weight bacteriocin production were therefore siblings isolated from the same purification plates.
Bacteriocin assay of mutants. The bacteriocin activity of the test isolates was examined. The parental strain produces two types of bacteriocins: the high-molecular-weight bacteriocin, which is restricted to the immediate surroundings of the colony, and the low-molecular-weight bacteriocin, which diffuses relatively further away from the colony. It was therefore expected that a mutant deficient in the low-molecular-weight bacteriocin would produce a restricted inhibition zone. The inhibition zones of the putative isolates (insertion mutants), typical of the high-molecular-weight bacteriocin, were restricted compared to those of the parent strain (Fig. 1). This indicates the possibility that transposon Tn5 has been successfully inserted into the genes of the low-molecular-weight bacteriocin. The mutants therefore produced only the high-molecular-weight bacteriocin. It was also observed that the insertion mutants were sensitive to UV light, and the duration of the UV light induction (irradiation) in the course of the bacteriocin assay had to be shortened in order to avoid complete killing of the cells. This is also an indication that the gene that is defective in the insertion mutants may not only control low-molecular-weight bacteriocin but also influence the degree of tolerance of this bacterium to UV light.
|
Detection of Tn5 in the mutants. To ascertain whether Tn5 had actually been inserted into the putative isolates, nested PCR was used to amplify the nptII gene (25), and two oligo-nucleotides, CTCGACGTTGTCACTGAAGCGGGAAG (P-3) and AAAGCACGAGGAAGCGGTCAGCCCAT (P-4), were synthesized. Almost all the test isolates except M-rif-11-2, which does not harbor the Tn5 gene, produced a short DNA fragment of 500 bp, indicating the presence of the Tn5 insert in the mutants. Southern blot hybridization also confirmed the above results (data not shown).
Amplification of Tn5 insertion junction DNA and sequencing. After TAIL-PCR was performed three times, two to three bands of different sizes were obtained for each sample. All the fragment products were isolated by electrophoresis and purified, and the sequences of the recovered products were analyzed. Analysis of the respective bands showed a high homology of about 95% or more, indicating a possible similarity in origin. A nucleotide sequence of 1,280 bp was obtained. All the Tn5 insertions characterized were at the same position in the brg gene, as they are all siblings.
Sequence analysis and homology. The gene structure of the 1,280 bp was determined (GenBank accession no. AF039142). In the direction of transcription indicated by the complementation studies, one complete ORF (ORF2) was present, and Tn5 was located in the same ORF between bp 878 and 879. The 3' end of another ORF, ORF1, was located upstream of ORF2. A noncoding region and a putative promoter were located between ORF1 and ORF2. Downstream from ORF2, the 5' end of another ORF (ORF3) was found.
The predicted amino acid sequence of ORF2 was compared with the SwissProt protein sequence data bank. Significant similarities were found between Brg and Yrp (the yrp gene product, regulator of enterotoxin [Y-ST] production in Yersinia enterocolitica [17]), HF-1 (the hfq gene product, a host factor protein required for Q
-replicase in E. coli K-12 [5,
6]), and NrfA of Azorhizobium caulinodans, which is
required for the expression of the nifA gene (12)
(Fig. 2). The hfq gene is
known to influence the expression of diverse genes in E. coli and other bacteria, including rpoS, hns, and mutS, resulting in pleiotropic
phenotypes (3, 21, 24). It was therefore proposed that ORF2
is the bacteriocin regulator gene, and it was subsequently designated
brg. Hfq-defective mutants are known to be sensitive to UV
light (23). This indirectly supports our earlier assumption
that the inactivation of the brg gene may be responsible for
the sensitivity of the insertion mutants to UV light.
|
Subcloning of brg DNA. The brg DNA was amplified by PCR from M-rif-11-2 and subcloned into plasmids pBR322 and pHSG415r by using T4 ligase after PCR amplification of two oligonucleotide primers, DY-R1 (TTCAAGCTTGTGGTGAATTGACAATACGC) and DY-F1 (GGTAGGATCCGTTGTTAGTGCATAGGTTGG), after purification and digestion by restriction enzymes BamHI and HindIII. The new plasmids, designated pHYL1 and pBYL1, used vectors pHSG415r and pBR322, respectively. One hundred colonies were isolated for each plasmid by using a selective LB agar medium containing 50 ppm of ampicillin after the transfer of pHYL1 and pBYL1 into E. coli DH5. The presence of the brg DNA was detected by colony hybridization using brg DNA probes and by electrophoresis after digestion with BamHI and HindIII. The brg band size was certified to be 400 bp (data not shown). The DNA of plasmid pBYL1 was isolated from DH5/pBYL1 and transferred into the insertion mutant TM01A01. One hundred colonies were isolated by selection on modified Drigalski's medium containing 50 ppm each of kanamycin, rifampin, and ampicillin, and the brg DNA was detected as previously described. The new plasmid was designated pBYL1 after reisolation from the transformed colonies.
Recovery of bacteriocin production and characteristics of the
transformed mutants.
The bacteriocin assay for the insertion
mutants after transformation indicates a successful recovery of their
ability to produce the low-molecular-weight bacteriocin. Their
larger inhibition zones were therefore comparable to those of the
parent strain, M-rif-11-2 (Table 2). This
proves that production of the low-molecular-weight bacteriocin was
actually regulated by brg DNA.
|
) exhibited defects in osmosensitivity,
cell growth, cell shape and size, plasmid supercoiling, and sensitivity
to UV light (23). We also observed that on modified
Drigalski's medium, colonies transformed with pBYL1, containing the
brg gene, were green and were larger in diameter
(about 13 mm) than the parents and the insertion mutants, which
were only 5 mm in diameter and yellow. Further incubation of the
brg-defective mutant under this condition results in the
death of the cells. The transformed colonies were also found to have a
very strong smell compared to those of the parents and the insertion
mutants. A possible explanation of this observation is that the
utilization of the lactose present in modified Drigalski's medium
results in the formation of lactic acid (lowering the pH),
indicated by the yellowish color, which is further utilized as a sole
carbon source, leading to an increase in the pH around the colony and
the green color of the colony. The differences in color and colony size
are therefore due to the differences in the efficiency with which
the respective colonies utilize lactic acid and tolerate a low pH.
The relative tolerance of the reduced pH and efficiency of
lactic-acid utilization by the brg transformant points to a
possible control by this gene. The observed sensitivity of the
brg-defective mutant to UV light is similar to that
previously observed for the E. coli hfq::
mutant (23).
It was also observed that among the insertion mutants, most of the
cells, formed a precipitate at the bottom of the test tube when
cultured in LB medium with shaking for 24 or 48 h. Further examination showed that, as observed for the
hfq::
mutant (23), the
brg-defective mutants were larger and more elongated than the parent and the transformed cells (Fig.
3). However, among the 160 cells measured
for each strain (parent, mutant, and transformant), it was observed
that the data for the mutant strain were the least uniform. The
nonuniformity seems to stem from impaired or delayed cell division.
This could be supported by larger cell size during the 4th and 11th h,
followed by a marked reduction in cell size at the 24th h, with a
subsequent reduction in standard deviation. It therefore stands to
reason that the brg gene affects not only the size of the
cells but also, either directly or indirectly, the process of cell
division. This may be the reason for the increase in the doubling time
observed for the hfq-defective mutant (23).
|
Nucleotide sequence accession number. The GenBank accession no. of the sequence of the brg genes is AF039142.
| |
ACKNOWLEDGMENTS |
|---|
We thank M. Sato, National Institute of Sericultural and Entomological Science, Tsukuba, Japan, for donating E. coli 1830 containing pJB4JI, and S. Annda, National Institute of Genetics, Shizuoka, Japan, for donating plasmids pBR322 and pHSG415r. We are also grateful to A. Higashitani, Institute of Genetic Ecology, Tohoku University, Sendai, Japan, for donating E. coli DH5 and for insightful discussion and guidance.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Institute of Genetic Ecology, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai 980-8577, Japan. Phone: (022) 217-5682. Fax: (022) 263-9845. E-mail: kikumoto{at}bansui.ige.tohoku.ac.jp.
Present address: Kantounousan Co. Ltd., Nasu-machi, Nasu-gun
325-0001, Japan.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Bolivar, F., R. L. Rodriguez, P. J. Greene, M. C. Betlach, H. L. Heyneker, and H. W. Boyer. 1977. Construction and characterization of new cloning vehicles. II. A multipurpose cloning system. Gene 2:95-113[Medline]. |
| 2. | Brady, G., H. M. Jantzen, H. U. Bernard, R. Brown, G. Schutz, and T. Hashimoto-Gotoh. 1984. New cosmid vectors developed for eukaryotic DNA cloning. Gene 27:223-232[Medline]. |
| 3. |
Brown, L., and T. Elliott.
1996.
Efficient translation of the RpoS sigma factor in Salmonella typhimurium requires host factor I, an RNA-binding protein encoded by the hfq gene.
J. Bacteriol.
178:3763-3770 |
| 4. | Chuang, D.-Y. 1997. M.A. thesis. Tohoku University, Sendai, Japan. |
| 5. |
Franze de Fernandez, M. T.,
L. Eoyang, and J. T. August.
1968.
Factor fraction required for the synthesis of bacteriophage Q RNA.
Nature
219:588-590[Medline].
|
| 6. |
Franze de Fernandez, M. T.,
W. S. Hayward, and J. T. August.
1972.
Bacterial proteins required for replication of phage Q ribonucleic acid. Purification and properties of host factor 1, a ribonucleic acid-binding protein.
J. Biol. Chem.
247:824-831 |
| 7. | Fredericq, P. 1957. Colicins. Annu. Rev. Microbiol. 11:7-22[Medline]. |
| 8. | Gantotti, B. V., K. L. Kindle, and S. V. Beer. 1981. Transfer of the drug-resistance transposon Tn5 to Erwinia herbicola and the induction of insertion mutations. Curr. Microbiol. 6:417-425. |
| 9. | Hanahan, D. 1983. Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166:557-580[Medline]. |
| 10. |
Hinton, J. C. D.,
M. C. M. Perombelon, and G. P. C. Salmond.
1985.
Efficient transformation of Erwinia carotovora subsp. carotovora and E. carotovora subsp. atroseptica.
J. Bacteriol.
161:786-788 |
| 11. |
Kado, C. I., and S.-T. Liu.
1981.
Rapid procedure for detection and isolation of the large and small plasmid.
J. Bacteriol.
145:1365-1375 |
| 12. |
Kaminski, P. A.,
N. Desnoues, and C. Elmerich.
1994.
The expression of nifA in Azorhizobium caulinodans requires a gene product homologous to Escherichia coli HF-1, and RNA-binding protein involved in the replication of phage Q RNA.
Proc. Natl. Acad. Sci. USA
91:4663-4667 |
| 13. | Kikumoto, T., S. Ma, and Y. Takahara. 1993. Biological control of the soft rot disease of Chinese cabbage. 3. Interactions of avirulent and virulent strains of Erwinia carotovora subsp. carotovora on the petiole of Chinese cabbage, abstr. 195, p. 315-316. In Abstracts of the papers presented at the Annual Meeting of the Society, 1993. The Phytopathological Society of Japan, Nara, Japan. (In Japanese.). |
| 14. | Kikumoto, T., A. G. Kyeremeh, D. Y. Chuang, and Y. Gunji. 1997. Biological control of the soft rot disease of Chinese cabbage with avirulent mutant strains of Erwinia carotovora subsp. carotovora, p. 118-119. In A. Ogoshi, K. Kobayashi, Y. Homma, F. Kodama, N. Kondo, and S. Akino (ed.), Proceedings of the Fourth International Workshop on Plant Growth-Promoting Rhizobacteria. Japan-OECD Joint Workshop. |
| 15. | Liu, Y.-G., and R. F. Whittier. 1995. Thermal asymmetric interlaced PCR: automatable amplification and sequencing of insert end fragments from P1 and YAC clones for chromosome walking. Genomics 25:674-681[Medline]. |
| 16. | Miyashita, K. 1992. DNA probes, p. 163-172. In Experimental methods in soil microbiology. Soil Microbiological Society of Japan. Youkendou Publishing Co., Tokyo, Japan. (In Japanese.). |
| 17. | Nakao, H., H. Watanabe, S.-I. Nakayama, and T. Takeda. 1995. yst gene expression in Yersinia enterocolitica is positively regulated by a chromosomal region that is highly homologous to Escherichia coli host factor 1 gene (hfq). Mol. Microbiol. 18:859-865[Medline]. |
| 18. | Nakatani, F., and H. Tsuyama. 1973. Production of two kinds of antibacterial agents by isolates of Erwinia carotovora. J. Fac. Agric. Iwate Univ. 11:245-253. |
| 19. |
Reusch, R. N.,
T. W. Hiske, and H. L. Sadoff.
1986.
Poly-beta-hydroybutyrate membrane structure and its relationship to genetic transformability in Escherichia coli.
J. Bacteriol.
168:553-562 |
| 20. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 21. |
Shi, X., and G. N. Bennett.
1994.
Plasmids bearing hfq and the hns-like gene stpA complement hns mutants in modulating arginine decarboxylase gene expression in Escherichia coli.
J. Bacteriol.
176:6769-6775 |
| 22. | Takahara, Y. 1994. Development of the microbial pesticide for soft-rot disease. PSJ Biocontrol Rep. 4:1-7. (In Japanese.) |
| 23. | Tsui, H. C., H. C. Leung, and M. E. Winkler. 1994. Characterization of broadly pleiotropic phenotypes caused by an hfq insertion mutation in Escherichia coli K-12. Mol. Microbiol. 13:35-49[Medline]. |
| 24. |
Tsui, H. C.,
G. Feng, and M. E. Winkler.
1997.
Negative regulation of mutS and mutH repair gene expression by the Hfq and RpoS global regulators of Escherichia coli K-12.
J. Bacteriol.
179:7476-7487 |
| 25. | Tsushima, S., A. Hasebe, Y. Komoto, J. P. Charter, K. Miyashita, K. Yokoyama, and R. W. Pickup. 1995. Detection of genetically engineered microorganisms in paddy soil using a simple and rapid "nested" polymerase chain reaction method. Soil Biol. Biochem. 27:219-227. |
| 26. | Tsuyama, H., and M. Sakamoto. 1952. Isolation methods of the soft-rot causing bacteria from the soil. Sci. Rep. Res. Inst. Tohoku Univ. Ser. D 3:29-34. |
| 27. | Yasunaka, K., and K. Amako. 1979. Morphology of bacteriocins. Protein Nucleic Acid Enzyme 24:719-726. (In Japanese.) |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Appl. Environ. Microbiol. | Infect. Immun. | Eukaryot. Cell |
|---|---|---|
| Mol. Cell. Biol. | J. Virol. | Microbiol. Mol. Biol. Rev. |
| ALL ASM JOURNALS |