Previous Article | Next Article ![]()
Journal of Bacteriology, April 1999, p. 2236-2243, Vol. 181, No. 7
Department of Microbiology, Oregon State
University, Corvallis, Oregon 97331-3804
Received 2 September 1998/Accepted 25 January 1999
Lon protease of Escherichia coli regulates a diverse
set of physiological responses including cell division, capsule
production, plasmid stability, and phage replication. Little is known
about the mechanism of substrate recognition by Lon. To examine the interaction of Lon with two of its substrates, RcsA and SulA, we
generated point mutations in lon which affected its
substrate specificity. The most informative lon mutant
overproduced capsular polysaccharide (RcsA stabilized) yet was
resistant to DNA-damaging agents (SulA degraded). Immunoblots revealed
that RcsA protein persisted in this mutant whereas SulA protein was
rapidly degraded. The mutant contains a single-base change within
lon leading to a single amino acid change of glutamate 240 to lysine. E240 is conserved among all Lon isolates and resides in a
charged domain that has a high probability of adopting a coiled-coil
conformation. This conformation, implicated in mediating
protein-protein interactions, appears to confer substrate discriminator
activity on Lon. We propose a model suggesting that this coiled-coil
domain represents the discriminator site of Lon.
Energy-dependent Lon (La) protease,
first isolated from Escherichia coli (7, 9), has
been identified in every organism examined thus far, including
gram-positive and gram-negative bacteria, yeast, plants, and humans.
Lon consists of four identical subunits (63;
reviewed in references 19 and 20)
each having an N-terminal highly charged domain (spanning amino acids
[aa] 211 to 271), a centrally located ATP binding domain (aa 351 to
421), and a C-terminal proteolytically active domain (1, 8,
16). Mutations in serine 679 suggest that it is the catalytically
active residue (2). Mutations in residues H665, H667, and
D676, but not D743, also appear to be essential for Lon's proteolytic
activity, yet it is unclear whether these residues belong to a
catalytic triad (55). A K362A change in motif A of the
ATP-binding domain was found to affect the catalytic efficiency and
peptidase activity of Lon (14). To date no physiological
function has been defined for the conserved charged domain located at
the N terminus.
The characteristic phenotypes of Treatment of cells with DNA-damaging agents (e.g., UV light or methyl
methanesulfonate [MMS]) activates expression of SOS genes (reviewed
in reference 61) including that encoding SulA, a
cell division inhibitor (17, 35-37). UV or MMS treatment of lon+ cells gives rise to short filaments which
are eventually resolved into individual cells when normal cell division
resumes (25, 35). lon+ cells are
resistant to UV or MMS, and SulA is highly unstable in these cells
(46; reviewed in reference 26).
UV or MMS treatment of Lon's function and its substrates vary from organism to organism, and
for some Lon enzymes neither function nor substrates have been
identified. Very little is known as to how Lon discriminates its
substrates from among the hundreds of other nonsubstrate proteins in a
cell. In this study we provide genetic and biochemical evidence defining a potential discriminator activity for the conserved charged
domain located at the N terminus of Lon.
Bacterial strains, media, and growth conditions.
Bacterial
strains are described in Table 1. All
strains are derivatives of MC4100 unless otherwise indicated. Liquid
medium used in this study was LB broth except where noted, and solid media used were LB agar, TB agar, and MacConkey's lactose agar (Difco). Antibiotics were used at 25 (tetracycline) and 100 (ampicillin) µg/ml. P1vir transductions were performed as
described by Silhavy et al. (51).
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
A Conserved Domain in Escherichia coli
Lon Protease Is Involved in Substrate Discriminator Activity
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
lon mutant cells
(mucoidy, sensitivity to DNA-damaging agents, and defectiveness in
bacteriophage
and P1 lysogenization and in the degradation of
abnormal proteins) (3, 5, 34, 42, 44; reviewed in
references 24 and 26) can be
directly attributed to the stabilization of Lon substrates with
regulatory roles in these pathways. The mucoidy phenotype (overproduction of colanic acid capsular polysaccharide) of
lon cells is mediated through the stabilization of RcsA
(58; reviewed in references 23
and 26). RcsA is a transcriptional activator of the
capsular polysaccharide genes (cps): in
lon+ cells RcsA is highly unstable and
cps transcription is barely detectable, whereas in
lon cells RcsA stability increases, resulting in a high
level of cps transcription (28, 56, 58;
reviewed in references 23 and
26). Increasing the amount of RcsA by stabilization
of RcsA through the removal of Lon, overexpression of rcsA,
or better protection of RcsA by its partner, RcsB, results in
expression of the cps genes (27, 56;
reviewed in references 23 and
26).
lon cells gives rise to long,
nonseptated filaments.
lon cells are sensitive to UV or
MMS, and SulA is stabilized in these cells (46;
reviewed in reference 26).
lon cells
fail to recover after removal of the DNA-damaging agent because the
stabilization of SulA renders filamentation irreversible and cell death
inevitable. Analogous to the situation for RcsA, increasing the amount
of SulA by stabilization of SulA through the removal of Lon,
overexpression of sulA, or better protection of SulA by its
partner, SulB, results in the formation of lethal filaments (38,
41).
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
TABLE 1.
Bacterial strains and plasmid used in this study
Phenotypic assays.
Mucoidy was assayed on TB agar containing
ampicillin, MMS sensitivity on LB agar containing 0.05% MMS, and
mitomycin C sensitivity on LB agar containing 0.3 µg of mitomycin C
per ml. The UV phenotype was assessed as follows. Overnight cultures
were diluted in LB containing ampicillin, grown to an optical density
at 600 nm (OD600) of 0.3, pelleted, resuspended in 0.1 volume of 0.01 M MgSO4, and irradiated with UV light (
= 254) at a dose of 5 mJ/cm2. Cells were diluted, plated on
LB agar containing ampicillin, and incubated in the dark.
Mutagenesis. E. coli CAG12017, which carries a Tn10Tetr 98% linked to the lon+ gene, was mutagenized with nitrosoguanidine (51). P1vir was grown on the mutagenized culture and used to infect a wild-type, nonmucoid lon+ strain (SG20250). Tetr transductants were selected and then screened for acquisition of a mucoid phenotype. These potential lon mutants were moved by P1 into a lon+ cpsB10::lacZ indicator strain (SG20781). Tetr transductants were again selected and screened for lactose utilization as an indication of cps expression. Lac+ transductants, indicating expression of cpsB10::lacZ, were saved.
-Galactosidase assay.
Three independent candidates of all
strains examined were assayed.
-Galactosidase activities were
determined by the method of Miller (45). Values reported
represent the mean of three assays.
Assessment of filament formation.
Cells were grown to
OD600 of 0.2. Nonirradiated cell samples were removed at
0-, 2-, 4-, and 8-h time points, sonicated, pelleted, resuspended in
phosphate-buffered saline containing 1% formaldehyde, incubated for 30 min on ice, and then evaluated in light microscopy. Remaining cells in
the original 0-h culture were pelleted, resuspended in 0.1 volume of 10 mM MgSO4, and irradiated with UV light (
= 254) at a
dose of 5 mJ/cm2. Irradiated cell samples were removed at
0, 2, 4, and 8 h, fixed in formaldehyde, and evaluated by light microscopy.
RcsA and SulA protein detection.
To examine RcsA, cells were
grown to an OD600 of 0.6 and processed as described below.
To examine SulA, cells were grown to an OD600 of 0.3, pelleted, resuspended in 0.1 volume of 10 mM MgSO4, and
irradiated with UV light (
= 254) at a dose of 5 mJ/cm2.
Cells were diluted and incubated 30 min in foil-lined flasks. Samples
were removed, washed twice in 10 mM MgSO4, resuspended in
sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) sample buffer (49), and boiled. Protein concentrations were determined by the bicinchoninic acid protein assay method (Pierce). Equal amounts of total cellular protein, resuspended and boiled in
SDS-PAGE sample buffer, were fractionated by tricine-SDS-PAGE (50) (16.5% gel for SulA; 14% gel for RcsA). Fractionated
samples for SulA analysis were transferred to a polyvinylidene
difluoride (PVDF) membrane (Dupont) in 20 mM Tris (pH 8.3)-20%
methanol-150 mM glycine. Fractionated samples for RcsA analysis were
transferred to a PVDF membrane in 10 mM
3-(cyclohexylamino)-1-propanesulfonic acid (CAPS) buffer (pH 11) with
20% methanol (12, 57). After transfer, all PVDF membranes
were blocked in Tris-buffered saline (20 mM Tris [pH 7.4], 125 mM
NaCl) containing 0.1% Tween 20, incubated with preabsorded antiserum
specific to E. coli RcsA or SulA protein, washed in
Tris-buffered saline containing 0.1% Tween 20, and incubated with an
appropriate dilution of goat anti-rabbit immunoglobulin conjugated to
horseradish peroxidase. Immunoreactive protein bands were visualized on
autoradiography film (Hyperfilm; Amersham) by using enhanced
chemiluminescence (Amersham).
Ots stability assessment.
Stability of the bacteriophage
O temperature-sensitive mutant protein (
Ots) was measured as
previously reported (11, 30). Briefly, E. coli
cells were grown in LB medium, wild-type
and
Ots phages were
diluted, and the dilutions were spotted on TB agar plates containing
the E. coli cells to be examined in an overlay. Duplicate
plates were prepared; one set was incubated at the permissive
temperature (32°C), and the other set was incubated at the
nonpermissive temperature (39°C). At the nonpermissive temperature in
the E. coli lon+ strain,
O is unstable and
thus no plaques form. At either the nonpermissive or permissive
temperature in the E. coli
lon strain,
Ots is stable
and thus plaques form.
DNA sequencing and analysis. PCR was used to amplify two overlapping fragments of each lon mutant, encompassing the complete open reading frame (ORF) and regulatory region. DNA from this region was amplified directly from the chromosome as previously described (13), the DNA was purified on Qiagen columns, and both strands were sequenced with appropriate primers on an ABI 377 automated sequencer (Center for Gene Research and Biotechnology, Central Services Laboratory, Oregon State University). All oligonucleotide primers used for PCR and DNA sequencing were provided by the Biopolymer Unit of the University of Maryland Medical School, Baltimore County. PCR oligonucleotide primers used were 5' AGCCTGCCAGCCCTGTTT 3', 5' AGTATCTTGCGGTTCAAA 3', 5' GGCGTGAAGCACCGTCGTGT 3', and 5' GCATAGAACCGATGTAAGTA 3'. Mutations were identified by comparing the newly generated lon mutant sequences to the wild-type lon sequence (GenBank accession no. 146642, 146644, 1773123, and 1786643), using the Genetics Computer Group program Bestfit.
| |
RESULTS |
|---|
|
|
|---|
Lon-substrate interactions.
In an attempt to define the
substrate specificity of Lon, Dervyn et al. in the laboratory of O. Huisman overexpressed sulA in lon+
cells and observed that the cells became mucoid, suggesting that high
levels of SulA protected RcsA from Lon-dependent degradation (11). Mutations in SulA which abolished this ability to
saturate Lon, evident by the loss of the mucoid phenotype, could be
identified; however, the mutant SulA protein was still degraded in a
Lon-dependent fashion. These observations led them to hypothesize that
Lon protease contains different substrate recognition sites: a
high-affinity site for specific substrates such as SulA and RcsA, and a
low-affinity site for nonspecific substrates such as abnormal or mutant
proteins (11, 22, 26). Presumably, both RcsA and SulA are
recognized by the high-affinity site, while the mutant SulA is no
longer recognized by this high-affinity site but rather interacts with the low-affinity site. We extended these studies by overexpressing RcsA
in lon+ cells and then examining their response
to UV light, MMS, and mitomycin C (Table
2). We predicted that if RcsA and SulA
had equivalent affinities for Lon, then by overexpressing RcsA to such
a level that lon+ cells were mucoid, SulA should
be protected from Lon-dependent degradation. This protection would be
observed phenotypically as sensitivity to UV, MMS, and mitomycin C. We
observed that under conditions of high levels of RcsA,
lon+ cells were very mucoid yet still resistant
to UV, MMS, and mitomycin C, suggesting that SulA was not protected
from Lon-dependent degradation (Table 2, line 2). Failure to express
high enough levels of RcsA to protect SulA was ruled out because enough
intact and functional RcsA was available to activate cps
expression (mucoid phenotype), the level of cps activation
(as monitored by a cpsB10::lacZ fusion) was higher than that observed in
lon cells (data not
shown), and RcsA was readily detected by immunoblot analysis (data not shown). Several possibilities exist to explain these results, including
that specific substrates, although presumably acting at a high-affinity
site, may have different affinities for Lon, thus creating a
hierarchical order with respect to substrate selection.
|
phenotype, mucoidy, indicating accumulating
RcsA. Of the 100,000 Tetr transductants screened in this
approach, 0.05% were mucoid. The increase in RcsA levels was verified
by transducing the lon mutations in to a strain containing
cpsB10::lacZ (SG20781). This fusion reports the expression of the cps genes as a function of the
available RcsA protein (4). High-level expression of
cpsB10::lacZ fusion correlates with
high levels of RcsA protein (26, 56). All lon
mutants examined showed an increase in cps expression
compared to lon+, indicating an increased
availability of intact and functional RcsA. The mucoid mutants were
screened for sensitivity to the DNA-damaging agents UV light, MMS, and
mitomycin C and assayed for filament formation. As shown in Table
3, three distinct classes of
lon mutants were identified. Class I mutants were mucoid,
had high-level cpsB10::lacZ expression,
were completely sensitive to DNA-damaging agents, and had extremely
long filaments 8 h after UV exposure. Class II mutants were
mucoid, had low-level cpsB10::lacZ expression, were partially sensitive to DNA-damaging agents, and had
medium-length filaments 8 h after UV exposure. Class III mutants were mucoid, had medium- to high-level
cpsB10::lacZ expression, were
completely resistant to DNA-damaging agents, and exhibited no
filaments.
|
lon mutant cells than in
lon+ cells (13). In these studies,
expression of rcsA was measured by using a
rcsA::lacZ fusion at the
att site (54), creating partial diploid
strains (rcsA90::lacZ at the
att site and rcsA at its normal position in
the chromosome). The 100-fold increase in rcsA expression in
a
lon strain was due to both an accumulation of
functional RcsA protein in the absence of Lon protease and rcsA expression activated by RcsA protein (13).
We predicted that if RcsA activated its own expression, then a
difference in the level of rcsA activation would be observed
between the three lon mutant classes. As shown in Table
4, expression of the
rcsA90::lacZ fusion was highest in the
class I and class III lon mutants and was approximately 380- to 420-fold higher than in lon+ cells.
Expression of the rcsA90::lacZ fusion
in the class II lon mutant was somewhat less than in
lon cells and in the class I and class III lon
mutants, yet rcsA expression in the class II lon
mutant was still 100-fold higher than in the
lon+ strain. These results provide further
support that functional and intact RcsA is available to activate
rcsA expression in all three classes of lon
mutants, with functional RcsA levels highest in the class I and III
mutants.
|
lon mutant (44), and class II lon
mutants behave phenotypically as if protease activity toward RcsA and
SulA has been impaired. The most interesting class, the class III
lon mutants, behave phenotypically as if they are
lon with respect to RcsA (mucoid) yet
lon+ with respect to SulA (resistant to
DNA-damaging agents). To determine if the phenotypes were a result of
decreased levels of Lon protein or truncated Lon, immunoblot analyses
of whole-cell extracts of the lon mutants were performed.
Intact Lon protein was expressed at normal levels in the three classes
of lon mutants (data not shown), indicating that the
observed phenotypes were not due to an absent or truncated Lon. A
representative from each mutant class was chosen for further analysis.
RcsA and SulA protein levels correspond to the lon
mutant phenotypes.
Changes in the level of cps and
rcsA expression and in the response to DNA-damaging agents
is consistent with changes in RcsA and SulA protein levels. To
determine if the protein levels vary as predicted, levels of RcsA (Fig.
1) and SulA (Fig.
2) were evaluated by immunoblotting. RcsA
protein was detected in representative extracts from each
lon mutant class (Fig. 1, lanes 3 to 5). The level of RcsA
in the class I and class III lon mutants (lanes 3 and 5) was
comparable to the level detected in the
lon mutant (lane
2), whereas the level of RcsA in the class II lon mutant was
reduced (lane 4). RcsA half-life was measured in the three classes of
lon mutants in vivo (data not shown); RcsA half-life in the
class I and class III lon mutants was similar to that
reported for
lon cells (greater than 30 min
[56]), whereas RcsA half-life in the class II
lon mutant appeared to be less than 10 min.
|
|
lon cells (lane 4). SulA protein was not detected in the class III lon mutant (lane 5) and was
detected at a reduced level in the class II lon mutant (lane
6). Analysis of filament formation (Table 3) corresponds with SulA
levels observed by immunoblotting. SulA half-life was measured in the three classes of mutants in vivo (data not shown); SulA half-life in
the class I lon mutant was similar to that reported for
lon cells (20 to 30 min [44, 46, 59]),
whereas SulA half-life in the class II lon mutant appeared
to be only 10 to 15 min. SulA half-life in the class III lon
mutant was similar to that reported for lon+
cells (less than 3 min) (46, 59).
Ots, an abnormal protein, is not affected by the lon
mutations.
RcsA and SulA proteins are normal physiological
proteins degraded in a Lon-dependent fashion in E. coli and
thus are considered specific Lon substrates. Abnormal proteins such as
nonsense peptides, protein fragments, missense proteins, and damaged
proteins also are substrates for Lon (5, 18, 30, 31, 44).
Thus, it seemed reasonable to test the activity of the lon
mutants against an abnormal protein. Wild-type
O protein, involved
in the replication of phage
, is not a substrate for Lon, and a
phage expressing wild-type O protein forms plaques on
lon+ (SG21020) and
lon (SG21155)
cells with equal efficiency (1010 plaques/ml). A
temperature-sensitive mutation in
Ots causes the protein to be
abnormal at high temperatures and makes it a substrate for Lon. The
degradation of
Ots in a Lon-dependent fashion prevents
phage
replication, and thus no plaques form on lon+
(SG21020) cells. In
lon (SG21155) cells, however, the
abnormal
Ots protein is stabilized and thus can function, allowing
phage to replicate and form plaques (efficiency of 1010
plaques/ml). Plaquing efficiencies on the lon mutants JT2036 (class III), JT2037 (class II), and JT2038 (class I) were similar to
that seen in the lon+ strain, indicating that
Ots protein was still a substrate for these mutant Lons.
Sequence analysis reveals changes at highly conserved residues. Sequencing the full lon ORF and its regulatory region from the three classes of lon mutants revealed unique changes in each class. In the class I lon mutant, there were two nucleotide changes: a G-to-A transition resulting in a glycine-to-arginine change at position 374 (G374R), and a G-to-A transition resulting in an aspartate-to-asparagine change at position 483 (D483N). In the class II lon mutant there was a single-nucleotide G-to-A transition, resulting in a glycine-to-aspartate change at position 384 (G384D). In the class III lon mutant there was a single-nucleotide G-to-A transition, resulting in a glutamate-to-lysine change at position 240 (E240K).
Amino acid substitutions G374 and G384 are located in the region between the A and B motifs comprising the ATP binding domain (Fig. 3). Both amino acid substitutions represent a change of a small aliphatic residue to a charged residue. Comparison of Lon sequences from other organisms revealed that glycine 374 is conserved in Lon sequences from gram-positive and gram-negative bacteria and Arabidopsis. In Saccharomyces cerevisiae and Homo sapiens, an asparagine residue is found at this position. A G384D substitution (class II) resulted in reduced catalytic behavior toward both RcsA and SulA. The G384 residue is conserved in all known Lon sequences; it is positioned 15 residues downstream from the last residue comprising motif A of the ATP binding domain. The sequence surrounding the G384 residue (boldface) of Lon is highly conserved among bacterial species: X(S/A)GGVRDE (where X = M, I, or L). Lon sequences from Arabidopsis, S. cerevisiae, and H. sapiens also have similar residues in this region, with residues G383, G384, and D387 being identical.
|
Coiled-coil analysis. Coiled-coil regions are frequently solvent-exposed regions believed to be involved in protein-protein interactions (39, 40, 48). The COILS program (39, 40, 48), which is specific for solvent-exposed, left-handed coiled coils, was used to analyze the primary amino acid sequence of Lon and to subsequently make a prediction as to the likelihood of a particular domain adopting a coiled-coil conformation. Analysis of the E. coli Lon sequence identified a region spanning residues 185 to 228 and 237 to 280 at the N terminus (Fig. 3) as a region with a high probability (ca. 95%) of adopting coiled-coil structures. In this region, approximately 50% of the residues are charged, with an equal distribution of acidic and basic residues. The residues comprising the A and B motifs of the ATP binding domain and the residues surrounding the proposed catalytic active residue (S679) had little probability of forming coiled coils (Fig. 3). Interestingly, the region spanning residues 538 to 558 (approximately 120 residues upstream of the active site S679 residue) is predicted to adopt a coiled-coil structure but at a much lower probability than the N-terminal region. Approximately 48% of residues 538 through 558 are charged, with two-thirds of the charged residues basic. Because the prediction of coiled-coil regions is biased toward hydrophilic, highly charged sequences, the analysis was performed with a weighted and an unweighted matrix, which did not reveal any differences between the two types of analysis. A similar analysis was performed on all known Lon sequences, revealing very similar coiled-coil profiles for all Lon isolates.
| |
DISCUSSION |
|---|
|
|
|---|
Goldberg and Waxman (21, 62-64) proposed a model for Lon proteolysis which accounted for the energy requirements and the processive nature of this enzyme (reviewed in references 19, 26, and 43). In this model, ATP hydrolysis manipulates the conformation of Lon, controlling the accessibility of Lon's active site. In an expansion of this model (26), a substrate capture function that has two binding sites, one for nonspecific substrates (initiator site) and one for specific substrates (discriminator site), was proposed. If a putative substrate had a low affinity, it would bind the initiator site and be partially degraded; if it had no affinity, it would be released from the initiator site without being cleaved. On the other hand, the discriminator site would bind specific substrates (those with very high affinity) and hold them long enough to activate ATP hydrolysis, resulting in a conformational change and accessibility of Lon's active site. The substrate would be retained under these conditions and subsequently cleaved.
If Lon protease has two binding sites, a discriminator site for specific substrates, such as RcsA and SulA, and an initiator site for nonspecific substrates, such as abnormal proteins, then where do these sites reside? Dervyn et al. in the laboratory of O. Huisman demonstrated that saturating Lon with SulA protects RcsA from degradation (11), suggesting that these two substrates compete for the same binding site. In contrast, we observed that overexpressing RcsA did not appear to protect SulA from degradation, possibly indicating a hierarchy among these substrates. We propose that if RcsA and SulA interact with different affinities at the same site, then this site would be identifiable by mutations which discriminated between these two substrates. In this study, we provide evidence supporting the hypothesis that discriminator activity can be assigned to a domain located at the N terminus. An E240K substitution in this domain abolished Lon's activity on RcsA but had no affect on Lon's activity on SulA. This E240 residue resides in a domain that has a high probability of adopting a coiled-coil conformation conducive to protein-protein interactions, and this conformation and its location are highly conserved among all Lons reported to date. Furthermore, this domain is a strong candidate for protein-protein interactions by virtue of its highly charged, thus potentially sticky, "velcro" behavior. Clearly, these studies provide direct support for the interaction of RcsA with Lon at the velcro domain. Observations made in overexpression studies with both RcsA and SulA provide indirect support for interaction of SulA with this domain. Direct evidence supporting SulA's interaction with Lon's velcro domain will come from mutations in this region that impede Lon-SulA interaction. Further studies are under way to identify this class of mutation.
Our study also uncovered other novel mutations, for example, G384D
(class II), which resides between motifs A and B of the ATP binding
domain and which affects the catalytic behavior of Lon toward both RcsA
and SulA but not
Ots. In support of this, RcsA and SulA levels of
detection and half-life were between the values obtained for
lon+ and
lon cells. Furthermore,
rcsA::lacZ expression was not as high
in this mutant as in the other lon mutants, indicating that reduced amounts of functional RcsA were available to activate the
expression of rcsA. These results suggest that Lon with a G384D substitution can still affect the stability of RcsA and SulA but
not as efficiently as wild-type Lon activity. The combination of G374R
and D483N substitutions (class I) completely abolishes proteolytic
activity toward RcsA and SulA but, like the G384 substitution, does not
affect degradation of
Ots. Possibly, proteolytic activity toward
certain nonspecific abnormal proteins is retained with the G384 or
G374R and D483N substitutions, yet Lon-dependent degradation of
specific substrates such as RcsA and SulA is abolished due to an
inability of Lon to hydrolyze ATP or to assemble into a functional
multimeric enzyme, suggesting that catalytic-proteolytic efficiency
rather than discriminator activity has been impaired.
If discriminator activity resides in the N-terminal velcro domain of
Lon, then where does the initiator site, or the site for nonspecific
substrate binding, reside? Functional analysis of the abnormal protein
Ots demonstrated that an E240K, a G384D, or a D483N in combination
with a G374R substitution in Lon had no effect on
Ots stability.
These results suggest that Lon's interaction with
Ots protein was
at a site distinct from that of specific substrates and that reducing
the catalytic behavior toward specific substrates had no apparent
affect on
Ots stability. While these studies were not designed to
identify the binding site for abnormal proteins, they have provided a
testable hypothesis for where this domain may reside, namely, the
highly conserved residues 538 to 558 predicted to adopt a coiled-coil
structure, to which no function has been assigned.
Goldberg and coworkers (8, 10) proposed that the basic regions (aa 211 to 219 and aa 262 to 271) of the velcro domain might be involved in Lon's ability to bind DNA (6, 65) whereas the acidic region (aa 240 to 253) of this domain might be involved in its activation by polybasic peptides (8). Sequence specific binding of E. coli Lon protease to the peri-Ets site of the human immunodeficiency virus type 2 enhancer was recently reported (15). This information has led several investigators to hypothesize that DNA binding of Lon protease might be involved in its substrate recognition. The velcro domain of Lon does not display characteristics common to DNA binding proteins. Whether DNA binding is specific or nonspecific and whether DNA binding is involved in substrate recognition remain to be determined.
Interestingly, the E240K substitution does not significantly alter the predicted coiled-coil conformation of the velcro domain. However, this substitution was sufficient to abolish Lon's ability to recognize and degrade RcsA, without affecting the Lon-SulA interaction. Numerous possibilities exist to account for this observation. The velcro domain, a region which spans approximately 100 residues, may have multiple binding sites for different specific substrates, and only the site which interacts with RcsA was affected by the E240K substitution. Alternatively, both substrates may bind at the same site, and thus a more drastic substitution at position 240 is needed to impede SulA binding. In support of this, overexpression studies suggest that RcsA and SulA bind at the same site, yet there may be a hierarchy defining these interactions. Furthermore, coiled-coil analysis of RcsA and SulA revealed a striking difference between these two substrates. SulA has a high probability (60%) of adopting a coiled-coil at the C terminus (residues 124 to 137), and residues in this region are predominately acidic (85%). In contrast, RcsA has a low (10%) probability of adopting a coiled-coil structure (C-terminally located, residues 172 to 188), and the residues in this region are predominately basic. Are the residues comprising the predicted coiled-coils of SulA and RcsA involved in Lon-substrate interactions? If protease-substrate discriminator activity can be assigned to residues involved in coiled-coil conformations, then it remains to be determined if substrate affinity is a reflection of the overall charge of the coiled-coil region of these proteins.
We propose that the simplest way Lon recognizes and prioritizes its interactions with specific physiological substrates would be through the discriminator activity of the velcro domain. The charge interactions occurring here would define the substrate's affinity for Lon and thus dictate a hierarchy for substrates as they were being positioned for cleavage at the proteolytic active site located at the C terminus. Proteolysis of nonspecific substrates, such as abnormal proteins, would not require the discriminator activity of the velcro domain. Correspondingly, specific inhibitors, such as T4 PinA (32, 33, 53), may interact at the velcro domain, thus preventing the capture of specific substrates. Many more intriguing questions as to how Lon selects its substrates from among other nonsubstrate proteins in the cell remain unanswered. Answering these questions may provide a means by which to identify new biological pathways controlled by Lon-dependent degradation in organisms other than E. coli.
| |
ACKNOWLEDGMENTS |
|---|
W.E., M.M.S., K.P.D., and J.M.S. contributed equally to this work.
W.E. and K.P.D. were partially supported by a predoctoral fellowship from the N. L. Tartar Foundation, and K.P.D. was supported by a predoctoral fellowship from the Eckleman Foundation. We are grateful to N. Ambulos of the Biopolymer Unit of University of Maryland Medical School, Baltimore County, for the oligonucleotides used in this study. This work was supported by grants from the Medical Research Foundation of Oregon, the Dr. Harry B. and Ralph H. Levey Philanthropic Fund, and the National Science Foundation to J.E.T.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Microbiology, Oregon State University, Nash Hall 220, Corvallis, OR 97331-3804. Phone: (541) 737-4441. Fax: (541) 737-0496. E-mail: trempyj{at}bcc.orst.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Amerik, A., V. K. Antonov, N. I. Ostroumova, T. V. Rotanova, and L. G. Chistiakova. 1990. Cloning, structure and expression of the full-size lon gene in Escherichia coli coding for ATP-dependent La-proteinase. Bioorg. Khim. 16:869-880[Medline]. |
| 2. | Amerik, A. Y., V. K. Antonov, A. E. Gorbalenya, S. A. Kotova, T. V. Rotanova, and E. V. Shimbarevich. 1991. Site-directed mutagenesis of La protease. A catalytically active serine residue. FEBS Lett. 287:211-214[Medline]. |
| 3. | Apte, B. N., H. Rhodes, and D. Zipser. 1975. Mutation blocking the specific degradation of reinitiation polypeptides in E. coli. Nature 257:329-331[Medline]. |
| 4. |
Brill, J. A.,
C. Quinlan-Walshe, and S. Gottesman.
1988.
Fine-structure mapping and identification of two regulators of capsule synthesis in Escherichia coli K-12.
J. Bacteriol.
170:2599-2611 |
| 5. | Bukhari, A. I., and D. Zipser. 1973. Mutants of Escherichia coli with a defect in the degradation of nonsense fragments. Nature 243:238-241[Medline]. |
| 6. |
Charette, M. F.,
G. W. Henderson,
L. L. Doane, and A. Markovitz.
1984.
DNA-stimulated ATPase activity on the lon (CapR) protein.
J. Bacteriol.
158:195-201 |
| 7. |
Charette, M. F.,
G. W. Henderson, and A. Markovitz.
1981.
ATP hydrolysis-dependent protease activity of the lon (capR) protein of Escherichia coli K-12.
Proc. Natl. Acad. Sci. USA
78:4728-4732 |
| 8. |
Chin, D. T.,
S. A. Goff,
T. Webster,
T. Smith, and A. L. Goldberg.
1988.
Sequence of the lon gene in Escherichia coli. A heat-shock gene which encodes the ATP-dependent protease La.
J. Biol. Chem.
263:11718-11728 |
| 9. |
Chung, C. H., and A. L. Goldberg.
1981.
The product of the lon (capR) gene in Escherichia coli is the ATP-dependent protease, protease La.
Proc. Natl. Acad. Sci. USA
78:4931-4935 |
| 10. |
Chung, C. H., and A. L. Goldberg.
1982.
DNA stimulates ATP-dependent proteolysis and protein-dependent ATPase activity of protease La from Escherichia coli.
Proc. Natl. Acad. Sci. USA
79:795-799 |
| 11. |
Dervyn, E.,
D. Canceill, and O. Huisman.
1990.
Saturation and specificity of the Lon protease of Escherichia coli.
J. Bacteriol.
172:7098-7103 |
| 12. |
Dierksen, K. P., and J. E. Trempy.
1996.
Identification of a second RcsA protein, a positive regulator of colanic acid capsular polysaccharide genes, in Escherichia coli.
J. Bacteriol.
178:5053-5056 |
| 13. |
Ebel, W., and J. E. Trempy.
1999.
Escherichia coli RcsA, a positive activator of colanic acid capsular polysaccharide synthesis, functions to activate its own expression.
J. Bacteriol.
181:577-584 |
| 14. | Fischer, H., and R. Glockshuber. 1994. A point mutation within the ATP-binding site inactivates both catalytic functions of the ATP-dependent protease La (Lon) from Escherichia coli. FEBS Lett. 356:101-103[Medline]. |
| 15. |
Fu, G. K.,
M. J. Smith, and D. M. Markovitz.
1997.
Bacterial protease Lon is a site-specific DNA-binding protein.
J. Biol. Chem.
272:534-538 |
| 16. |
Gayda, R. C.,
P. E. Stephens,
R. Hewick,
J. M. Schoemaker,
W. J. Dreyer, and A. Markovitz.
1985.
Regulatory region of the heat shock-inducible capR (lon) gene: DNA and protein sequences.
J. Bacteriol.
162:271-275 |
| 17. | George, J., M. Castellazzi, and G. Buttin. 1975. Prophage induction and cell division in E. coli. III. Mutations in sfiA and sfiB restore division in tif and lon strains and permit the mutator properties of tif. Mol. Gen. Genet. 140:309-332[Medline]. |
| 18. |
Goff, S. A., and A. L. Goldberg.
1987.
An increased content of protease La, the lon gene product, increases protein degradation and blocks growth in Escherichia coli.
J. Biol. Chem.
262:4508-4515 |
| 19. | Goldberg, A. L. 1992. The mechanism and functions of ATP-dependent proteases in bacterial and animal cells. Eur. J. Biochem. 203:9-23[Medline]. |
| 20. | Goldberg, A. L., K. H. Sreedhara Swamy, C. H. Chung, and F. S. Larimore. 1983. Proteases of Escherichia coli. Methods Enzymol. 80:680-702. |
| 21. |
Goldberg, A. L., and L. Waxman.
1985.
The role of ATP hydrolysis in the breakdown of proteins and peptides by protease La from Escherichia coli.
J. Biol. Chem.
260:12029-12034 |
| 22. | Gottesman, S. 1989. Genetics of proteolysis in Escherichia coli. Annu. Rev. Genet. 23:163-198[Medline]. |
| 23. | Gottesman, S. 1995. Regulation of capsule synthesis: modification of the two-component paradigm by an accessory unstable regulator, p. 253-262. In J. A. Hoch, and T. J. Silhavy (ed.), Two-component signal transduction. American Society for Microbiology, Washington, D.C. |
| 24. | Gottesman, S. 1996. Proteases and their targets in Escherichia coli. Annu. Rev. Genet. 30:465-506[Medline]. |
| 25. |
Gottesman, S.,
E. Halpern, and P. Trisler.
1981.
Role of sulA and sulB in filamentation by lon mutants of Escherichia coli K-12.
J. Bacteriol.
148:265-273 |
| 26. |
Gottesman, S., and M. R. Maurizi.
1992.
Regulation by proteolysis: energy-dependent proteases and their targets.
Microbiol. Rev.
56:592-621 |
| 27. | Gottesman, S., and V. Stout. 1991. Regulation of capsular polysaccharide synthesis in Escherichia coli K12. Mol. Microbiol. 5:1599-1606[Medline]. |
| 28. |
Gottesman, S.,
P. Trisler, and A. Torres-Cabassa.
1985.
Regulation of capsular polysaccharide synthesis in Escherichia coli K-12: characterization of three regulatory genes.
J. Bacteriol.
162:1111-1119 |
| 29. | Gottesman, S., P. Trisler, and A. Torres-Cabassa. 1985. Regulation of capsular polysaccharide synthesis in Escherichia coli K-12: characterization of three regulatory genes. J. Bacteriol. 162:1111-1119. |
| 30. |
Gottesman, S., and D. Zipser.
1978.
Deg phenotype of Escherichia coli lon mutants.
J. Bacteriol.
133:844-851 |
| 31. | Grossman, A. D., R. R. Burgess, W. Walter, and C. A. Gross. 1983. Mutations in the lon gene of E. coli K-12 phenotypically suppress a mutation in the sigma subunit of RNA polymerase. Cell 32:151-159[Medline]. |
| 32. |
Hilliard, J. J.,
M. R. Maurizi, and L. D. Simon.
1998.
Isolation and characterization of the phage T4 PinA protein, an inhibitor of the ATP-dependent Lon protease of Escherichia coli.
J. Biol. Chem.
273:518-523 |
| 33. |
Hilliard, J. J.,
L. D. Simon,
L. Van Melderen, and M. R. Maurizi.
1998.
PinA inhibits ATP hydrolysis and energy-dependent protein degradation by Lon protease.
J. Biol. Chem.
273:524-527 |
| 34. |
Howard-Flanders, P.,
E. Simson, and L. Theriot.
1964.
A locus that controls filament formation and sensitivity to radiation in Escherichia coli K12.
Genetics
49:237-246 |
| 35. |
Huisman, O.,
R. D'Ari, and J. George.
1980.
Further characterization of sfiA and sfiB mutation in Escherichia coli.
J. Bacteriol.
144:185-191 |
| 36. |
Huisman, O.,
R. D'Ari, and S. Gottesman.
1984.
Cell-division control in Escherichia coli: specific induction of the SOS function SfiA protein is sufficient to block septation.
Proc. Natl. Acad. Sci. USA
81:4490-4494 |
| 37. | Huisman, O., and R. D'Ari. 1981. An inducible DNA-replication-cell division coupling mechanism in E. coli. Nature 290:797-799[Medline]. |
| 38. |
Jones, C., and I. B. Holland.
1985.
Role of the SulB (FtsZ) protein in division inhibition during the SOS response in Escherichia coli: FtsZ stabilizes the inhibitor SulA in maxicells.
Proc. Natl. Acad. Sci. USA
82:6045-6049 |
| 39. | Lupas, A. 1996. Prediction and analysis of coiled-coil structures. Methods Enzymol. 266:513-525[Medline]. |
| 40. |
Lupas, A.,
M. V. Dyke, and J. Stock.
1991.
Predicting coiled-coils from protein sequences.
Science
252:1162-1164 |
| 41. |
Lutkenhaus, J.,
B. Sanjanwala, and M. Lowe.
1986.
Overproduction of FtsZ suppresses sensitivity of lon mutants to division inhibition.
J. Bacteriol.
166:756-762 |
| 42. |
Markovitz, A.
1964.
Regulatory mechanisms for the synthesis of capsular polysaccharide in mucoid mutants of Escherichia coli K-12.
Proc. Natl. Acad. Sci. USA
51:239-246 |
| 43. | Maurizi, M. R. 1992. Proteases and protein degradation in Escherichia coli. Experientia 48:178-201[Medline]. |
| 44. |
Maurizi, M. R.,
P. Trisler, and S. Gottesman.
1985.
Insertional mutagenesis of the lon gene in Escherichia coli: lon is dispensable.
J. Bacteriol.
164:1124-1135 |
| 45. | Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 46. |
Mizusawa, S., and S. Gottesman.
1983.
Protein degradation in Escherichia coli: the lon gene controls the stability of SulA protein.
Proc. Natl. Acad. Sci. USA
80:358-362 |
| 47. | Painbeni, E., E. Mouray, S. Gottesman, and J. Rouviere-Yaniv. 1993. An imbalance of HU synthesis induces mucoidy in Escherichia coli. J. Mol. Biol. 234:1021-1037[Medline]. |
| 48. | Parry, D. A. D. 1982. Coiled-coils in alpha-helix-containing proteins: analysis of the residue types within the heptad repeat and the use of these data in the prediction of coiled-coils in other proteins. Biosci. Rep. 2:1017-1024[Medline]. |
| 49. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 50. | Schägger, H., and G. von Jagow. 1987. Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa. Anal. Biochem. 166:368-379[Medline]. |
| 51. | Silhavy, T. J., M. L. Berman, and L. W. Enquist. 1984. Experiments with gene fusions. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 52. |
Singer, M.,
T. A. Baker,
G. Schnitzler,
S. M. Deischel,
M. Goel,
W. Dove,
K. J. Jaacks,
A. D. Grossman,
J. W. Erickson, and C. A. Gross.
1989.
A collection of strains containing genetically linked alternating antibiotic resistance elements for genetic mapping of Escherichia coli.
Microbiol. Rev.
53:1-24 |
| 53. |
Skorupski, K.,
J. Tomaschewski,
W. Ruger, and L. D. Simon.
1988.
A bacteriophage T4 gene which functions to inhibit Escherichia coli Lon protease.
J. Bacteriol.
170:3016-3024 |
| 54. |
Sledjeski, D., and S. Gottesman.
1995.
A small RNA acts as an antisilencer of the H-NS-silenced rcsA gene of Escherichia coli.
Proc. Natl. Acad. Sci. USA
92:2003-2007 |
| 55. | Starkova, N. N., E. P. Koroleva, L. D. Runsh, L. M. Ginodman, and T. V. Rotanova. 1998. Mutations in the proteolytic domain of Escherichia coli protease Lon impair the ATPase activity of the enzyme. FEBS Lett. 422:218-220[Medline]. |
| 56. |
Stout, V.,
A. Torres-Cabassa,
M. R. Maurizi,
D. Gutnick, and S. Gottesman.
1991.
RcsA, an unstable positive regulator of capsular polysaccharide synthesis.
J. Bacteriol.
173:1738-1747 |
| 57. | Szewczyk, B., and L. M. Kozloff. 1985. A method for the efficient blotting of strongly basic proteins from sodium dodecyl sulfate-polyacrylamide gels to nitrocellulose. Anal. Biochem. 150:403-407[Medline]. |
| 58. |
Torres-Cabassa, A. S., and S. Gottesman.
1987.
Capsule synthesis in Escherichia coli K-12 is regulated by proteolysis.
J. Bacteriol.
169:981-989 |
| 59. |
Trempy, J. E., and S. Gottesman.
1989.
Alp, a suppressor of lon protease mutants in Escherichia coli.
J. Bacteriol.
171:3348-3353 |
| 60. |
Trisler, P., and S. Gottesman.
1984.
lon transcriptional regulation of genes necessary for capsular polysaccharide synthesis in Escherichia coli K-12.
J. Bacteriol.
160:184-191 |
| 61. | Walker, G. C. 1987. The SOS response of Escherichia coli, p. 1346-1357. In F. C. Neidhardt, J. L. Ingraham, K. B. Low, B. Magasanik, M. Schaecter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella typhimurium: cellular and molecular Biology. American Society for Microbiology, Washington, D.C. |
| 62. |
Waxman, L., and A. L. Goldberg.
1982.
Protease La from Escherichia coli hydrolyzes ATP and proteins in a linked fashion.
Proc. Natl. Acad. Sci. USA
79:4883-4887 |
| 63. |
Waxman, L., and A. L. Goldberg.
1985.
Protease La, the lon gene product, cleaves specific fluorogenic peptides in an ATP-dependent reaction.
J. Biol. Chem.
260:12022-12028 |
| 64. |
Waxman, L., and A. L. Goldberg.
1986.
Selectivity of intracellular proteolysis: protein substrates activate the ATP-dependent protease (La).
Science
232:500-503 |
| 65. |
Zehnbauer, B. A.,
E. C. Foley,
G. W. Henderson, and A. Markovitz.
1981.
Identification and purification of the lon+ (capR+) gene product, a DNA-binding protein.
Proc. Natl. Acad. Sci. USA
78:2043-2047 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»