Previous Article | Next Article 
Journal of Bacteriology, April 1999, p. 2492-2500, Vol. 181, No. 8
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Promoter Analysis of the cap8 Operon, Involved in Type
8 Capsular Polysaccharide Production in Staphylococcus
aureus
Shu
Ouyang,
Subrata
Sau,
and
Chia Y.
Lee*
Department of Microbiology, Molecular
Genetics and Immunology, University of Kansas Medical Center,
Kansas City, Kansas 66160
Received 30 October 1998/Accepted 1 February 1999
 |
ABSTRACT |
The production of type 8 capsular polysaccharide (CP8) in
Staphylococcus aureus is regulated in response to a variety
of environmental factors. The cap8 genes required for the
CP8 production in strain Becker are transcribed as a single large
transcript by a primary promoter located within a 0.45-kb region
upstream of the first gene of the cap8 gene cluster. In
this study, we analyzed the primary cap8 promoter region in
detail. We determined the transcription initiation site of the primary
transcript by primer extension and identified the potential promoter
sequences. We found several inverted and direct repeats upstream of the
promoter. Deletion analysis and site-directed mutagenesis showed that a
10-bp inverted repeat of one of the repeats was required for promoter
activity. We showed that the distance but not the specific sequences
between the inverted repeat and the promoter was critical to the
promoter activity. However, insertion of a DNA sequence with two or
four helix turns in this intervening region had a slight effect on promoter activity. To demonstrate the biological significance of the
10-bp inverted repeat, we constructed a strain with a mutation in the
repeat in the S. aureus Becker chromosome and showed that the repeat affected CP8 production mostly at the transcriptional level.
By gel mobility shift assay, we demonstrated that strain Becker
produced at least one protein capable of specific binding to the 10-bp
inverted repeat, indicating that the repeat serves as a positive
regulatory protein binding site. In addition, reporter gene fusion
analysis showed that the cap8 promoter activity was influenced by various growth media and affected most by yeast extract.
Our results suggest that yeast extract may exert its profound
inhibitory effect on cap8 gene expression through the 10-bp
inverted repeat element.
 |
INTRODUCTION |
Staphylococcus aureus is
a common human pathogen that causes a variety of diseases. The organism
has the ability to produce a number of virulence factors, including
capsular polysaccharide (CP). Although 11 serotypes of CP have been
identified in S. aureus strains, more than 80% of the
clinical isolates produce either type 5 CP (CP5) or type 8 CP (CP8)
(1, 3, 18, 20, 21, 39, 48). These strains produce a small
amount of CP and are hence referred to as microencapsulated
(52). In contrast, strains elaborating either type 1 CP
(CP1) or type 2 CP (CP2) produce a large amount of capsule and manifest
a mucoid phenotype on agar. While CP1 and CP2 have been shown to confer
virulence to S. aureus (26, 29, 32) by evading
phagocytes (38), the role of CP5 and CP8 in virulence has
been controversial (2, 4, 22, 35, 54). Recent reports,
however, showed that antibodies against CP5 and CP8 were protective
against S. aureus infections when immunized mice were
challenged intraperitoneally (11) and that CP5 was an
important virulence factor of S. aureus in a murine septic
arthritis model (36).
The cap8 and cap5 gene clusters, involved in the
synthesis of CP8 and CP5, respectively, have been cloned and sequenced
(28, 44-46). Each gene cluster consists of 16 genes which
are tightly clustered and transcribed in one direction. The two gene
clusters share 12 genes, while the remaining 4 genes in each cluster
are type specific. The two gene clusters have the same organization in
that the 4 type-specific genes in the central region are flanked by the
common genes. The fact that they have genes in common explains why CP5
and CP8 are almost identical trisaccharide-repeated polysaccharides that differ only in the location of O-acetylation and the position linking monosaccharides (12, 34). Molecular characterization of the cap8 locus showed that all 16 genes were transcribed
as a large transcript from a primary promoter upstream of the first gene, cap8A. However, several internal promoters within the
cap8 locus were also identified by genetic complementation
and reporter gene fusion studies (46). The cap1
gene cluster, required for CP1 synthesis, has also been cloned,
sequenced, and molecularly characterized in our laboratory (25,
29, 37). The cap1 locus consists of 13 closely linked
genes that are transcribed as one major transcript with several weak
internal promoters, similar to the cap8 gene cluster. The
cap5 and cap8 loci are allelic, whereas the
cap1 locus mapped at a different location
(44-46).
A number of studies have shown that the production of CP5 and CP8 is
influenced by various environmental factors. Lee et al. (27)
showed that low iron concentration, growth in vivo, or growth on solid
medium enhanced CP8 production. Similarly, production of CP5 was
affected by medium, pH, oxygen tension, carbon dioxide, and growth
phase (8, 17, 50). In the presence of milk, increased
production of microcapsules had been observed in mastitis isolates of
S. aureus (31, 51). Recently, a global regulatory locus, agr (41), was shown to positively regulate
CP5 production (9). Taken together, these studies suggest
that microcapsules are highly regulated. However, regulation of
staphylococcal capsule production has not been studied at the molecular
level. As a first step in such studies, we analyzed the primary
promoter region by deletion analysis and site-directed mutagenesis. We
showed that a cis-acting element was required for
cap8 promoter activity and CP8 production. The
cis-acting element may serve as a positive regulatory
protein binding site.
 |
MATERIALS AND METHODS |
Strains, plasmids, and growth conditions.
Escherichia
coli HB101 and XL1-Blue, which were used for plasmid constructions
and transformations, were cultivated in Luria broth or agar (Difco
Laboratories). Trypticase soy broth (TSB) and Columbia broth (CB) were
obtained from Difco Laboratories. Tryptone-glucose-NaCl broth (TDNB)
contains 1% Tryptone, 0.25% dextrose, and 0.5% NaCl. Low-phosphate
medium (LPM) was prepared as described by Wunschel et al.
(53) except it contains 0.32 mM phosphate (0.2 mM
K2HPO4 · H2O and 0.12 mM
KH2PO4) and 0.1 M Tris-HCl (pH 7.5).
High-phosphate medium (HPM) is the same as LPM except that the total
phosphate concentration is 50 mM (33.3 mM
K2HPO4 · H2O and 16.7 mM
KH2PO4). S. aureus RN4220
(24) was used as the recipient in electroporations of
plasmids. Electroporation was carried out by the procedure of Kraemer
and Iandolo (23). Transduction was carried out as described
by Shafer and Iandolo (47), using bacteriophage 52A
(25). Quantitation of CP8 was performed by rocket
immunoelectrophoresis (RIE) as described previously (44).
DNA manipulations.
Standard DNA manipulations were performed
as described by Sambrook et al. (43). Plasmid DNA was
purified by using a plasmid purification kit (Qiagen). Rapid
small-scale plasmid DNA purification from E. coli was done
by the method of Holmes and Quigley (19). Small-scale
plasmid DNA isolation from S. aureus was performed by using
a Wizard Plus Minipreps kit (Promega). Bulk chromosomal DNA from
S. aureus was purified as described by Dyer and Iandolo (10). Transfer of DNA to nitrocellulose membranes was done
by the method of Southern (49). Conditions used for
hybridization analysis have been described previously (44).
DNA sequencing was carried out with an automatic DNA sequencer (LICOR 4000L).
Primer extension and RNA manipulations.
S. aureus
Becker was grown on Trypticase soy agar overnight at 37°C, and total
RNA was isolated by the procedure of Cheung et al. (7),
using a FastRNA kit from BIO 101. RNA dot blot was carried out as
described by Sambrook et al. (43). Primer extension analysis
was performed by using an avian myeloblastosis virus reverse
transcriptase primer extension kit as recommended by the supplier
(Promega), with modifications. Briefly, about 30 µg of total RNA was
ethanol precipitated along with an end-labeled primer
(5'TTAATTCTAATGTACTTTCC3') complementary to the N-terminal coding sequence of cap8A. After washing with 70% ethanol,
the pellet was suspended in 7 µl of 250 mM KCl and incubated at
42°C for 3 h. The reaction mixture was then treated with avian
myeloblastosis virus reverse transcriptase. The reaction was stopped
with the addition of 10 µl of sequencing stop buffer, denatured, and
resolved in a 6% polyacrylamide gel. A sequencing reaction using the
same primer was run simultaneously as a molecular weight standard.
Construction of transcriptional fusion plasmids.
The
promoterless xylE gene from Pseudomonas putida
was used as the reporter gene for transcriptional fusions. All
plasmids, unless mentioned specifically, were constructed by ligating
various PCR-generated DNA fragments of the cap8 promoter
region to the EcoRI and HindIII sites of pLC4
(40). Plasmid pCL7816, with an 5.7-kb insert which contains
the cap8 promoter region, was used as the template in PCR
amplification for constructing mutations shown in Fig. 2 and 3 (except
for pCL8265). PCR amplifications were achieved by pairing various
forward primers containing appropriate changes and a reverse primer,
Pp8ar, listed in Table 1. The amplified fragments were first cloned in pGEM-T (Promega), verified by
sequencing, and then cloned into the reporter vector. Plasmids pCL8239
and pCL8240 were constructed by replacing the
SnaBI-HindIII fragment of pCL8218 with the
respective PCR fragments. Plasmids pCL8284, pCL8308, pCL8312, and
pCL8321 were constructed by ligating the phosphorylated annealed
complementary primers, P21merF (5'GCATATTAAGGATCCTAATCG3') and P21merR (5'CGATTAGGATCCTTAATATGC3') to the
SnaBI site of pCL8218 and verified by sequencing. Plasmid
pCL8265 contains an insert equivalent to that of plasmid pCL8074 except
that the insert was PCR amplified from plasmid pCL8226, described
below. All plasmids were first electroporated into S. aureus
RN4220 and then transduced into strain Becker by bacteriophage 52A. The
catechol 2,3-dioxygenase (the gene product of xylE)
activities of the strains containing various fusions were assayed as
previously described (55).
Mutagenesis of the inverted repeat on the chromosome.
A 2.4-kb EcoRI-HindIII DNA fragment
containing the upstream region of the cap8 locus, the
cap8A coding region, and the 5' portion of the
cap8B coding region was cloned into the EcoRI and HindIII sites of plasmid pALTER-1 (Promega). The
resulting plasmid was used for site-directed mutagenesis of the 10-bp
inverted repeat, using mutagenic primer
5'TTAAAAGTAATTAATGGATCCAACGATATGTAATATG3', which
contains a BamHI site (underlined) within the repeat,
according to the manufacturer's protocol. The
EcoRI-HindIII fragment containing the desired
mutation, verified by sequencing, was subsequently cloned into the
similarly digested temperature-sensitive plasmid vector pCL52.1
(29). The resultant plasmid, pCL8226, was electroporated into strain RN4220 and then transferred into strain Becker by phage 52A
transduction. An allelic exchange procedure described previously
(29) was used to generate mutant strain CYL6401. Southern
blotting using BamHI-digested DNAs was used to confirm the
construction (data not shown). Sequences of the promoter region in the
chromosome of CYL6401 were amplified by PCR and verified by sequencing.
No mutations other than the desired one were detected (data not shown).
DNA gel mobility shift assay.
S. aureus Becker
cultures were grown in broth media at 37°C overnight. Cell extracts
were made from lysostaphin-treated cells as described by Mahmood and
Khan (30). A 63-bp DNA fragment containing either the
wild-type 10-bp inverted repeat upstream of cap8A or the
mutated repeat in the corresponding region was obtained by PCR
amplification using a pair of primers, 5'GTATTTACATATTACATATC3' and 5'AATGCGAAAATAATGCGG3'. The amplified DNA
fragments were purified by a PCR purification kit (Qiagen) and end
labeled with [32P]ATP, using T4 polynucleotide kinase
(Gibco-BRL). The labeled DNA fragments were used in a gel mobility
shift assay performed as described by Cheung et al. (6),
with slight modifications. Briefly, 4 µl of Becker cell extracts was
mixed with end-labeled DNA fragments and 1 µg of poly(dI-dC) in the
assay buffer (10 mM Tris-HCl [pH 7.5], 1 mM EDTA, 50 mM NaCl, 5%
glycerol). The mixtures (20 µl, final volume) were incubated at room
temperature for 15 min, and the reaction was terminated by the addition
of the stop buffer containing 0.1% bovine serum albumin, 50%
glycerol, and 0.01% xylene cyanol. The samples were resolved in a 6%
polyacrylamide gel in Tris borate-EDTA buffer for 2 h at 200 V. After electrophoresis, the gels were dried and autoradiographed.
 |
RESULTS |
Mapping of the transcription initiation site.
Previously, we
reported that the 16 cap8 genes were organized as an operon
transcribed in a 17-kb transcript from the primary promoter upstream of
cap8A, the first gene of the cap8 operon (46). It is conceivable that the regulation of CP8
production in S. aureus is exerted at the primary promoter.
To locate the promoter more precisely, the 5' end of the 17-kb
transcript was determined by primer extension analysis. As shown in
Fig. 1, a major band corresponding to the
T residue located 17 nucleotides upstream of the ATG codon of the
cap8A gene was detected, though several smaller bands were
also found. This result was reproducible, suggesting that there may be
other starting sites near the major start site. The sequence
5'TTTAAT3', with five matches to the consensus
10 promoter
sequence of Bacillus and E. coli (16, 33), was found seven nucleotides upstream of the start site. However, no consensus
35 sequence was detected. Nevertheless, the
sequence 5'AATACT3', with only two matches to the consensus
35 promoter sequence, was found 17 nucleotides upstream of the
10
promoter sequence. For ease of discussion, we tentatively assigned this
sequence as the potential
35 sequence (Fig. 2).

View larger version (62K):
[in this window]
[in a new window]
|
FIG. 1.
Mapping of the 5' end of the cap8 primary
transcript by primer extension. The position of the major initiation
site is indicated by +1. The DNA sequence ladder was generated by using
the same primer.
|
|
Requirement for a 10-bp inverted repeat for cap8 gene
transcription.
Interestingly, just upstream of the tentative
35
sequence we found several direct repeats and inverted repeats which
could serve as potential protein binding sites for regulators. To
determine whether any of these repeats can act as a
cis-acting regulatory element for cap8 gene
expression, DNA fragments containing the primary cap8
promoter with various 5'-end deletions were constructed by PCR and
transcriptionally fused to a promoterless xylE reporter gene
in pLC4. The resultant plasmids were electroporated into strain RN4220
and moved into strain Becker by phage 52A transduction. The results in
Fig. 2 showed that deletions up to
nucleotide
65 did not affect promoter activity, whereas deletions
beyond nucleotide
52 reduced promoter activity to the basal level.
These results indicate that the 14-bp inverted repeat with sequence
5'ATTGTTTAAACGAT3' may be required for cap8 genes
transcription, while other repeats may not play a regulatory role under
our experimental conditions.

View larger version (10K):
[in this window]
[in a new window]
|
FIG. 2.
Deletion analysis of the region upstream of the
cap8 promoter. The relevant DNA sequence is shown at the
top; arrows indicate direct and inverted repeats. The numbers at the
end of the sequence indicate the endpoints of the fragments with
respect to the transcription start site, +1; the 10 sequence and the
tentative 35 sequence of the promoter are also shown. XylE activities
of the fusion plasmids are expressed in milliunits per milligram of
protein as means ± standard deviations of three independent
tests.
|
|
To confirm that the 14-bp inverted repeat described above is required
for promoter activity, site-directed mutations within
the repeat were
constructed by PCR using primers containing various
changes (see
Materials and Methods). The resultant fragments containing
the
mutations were again fused with the
xylE reporter gene to
assess promoter activities. The results (Fig.
3) showed that changing
the first two
nucleotides of the inverted repeat (pCL8116) as
well as replacing
nucleotide A located next to the last nucleotide
of the repeat
(pCL8264) did not affect promoter activity. These
results suggest that
the four nucleotides at the periphery of
the inverted repeat are
dispensable. However, mutations with one-
or two-nucleotide replacement
in the central eight nucleotides
within the 14-bp inverted repeat
decreased promoter activity to
the basal level (pCL8160, pCL8117,
pCL8161, pCL8204, pCL8195,
and pCL8263), indicating that the central
eight nucleotides are
critical for transcription. The 14-bp repeat is
an imperfect one,
with two noncomplementary nucleotides, A and C,
located at the
third positions from the ends of the repeat. To
determine whether
mutations converting the repeat to a perfect match
would affect
promoter activity, we changed these two nucleotides to
ones that
are complementary to each other. Our results showed that
while
changing the left repeat to match the right repeat reduced
promoter
activity to the basal level (pCL8118), changing the right
repeat
to match the left repeat (pCL8162) reduced the activity only
about
threefold compared to the wild type. Taken together, these
results
indicate that the inner 10 nucleotides of the inverted repeat
are crucial for enhancing
cap8 promoter activity.

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 3.
Site-directed mutagenesis of the region upstream of the
cap8 promoter. The altered nucleotides are outlined. Other
symbols and descriptions are as described in the legend to Fig. 2.
|
|
The intervening region and the tentative
35 sequence.
The
fact that plasmid pCL8264, which contains a mutation between the 10-bp
inverted repeat and the tentative
35 sequence, exhibits about the
same XylE activity as plasmid pCL8097, which contains no mutation,
suggests that specific sequences in the 14-bp intervening region may
not play a role in cap8 gene activation. To test this
notion, two plasmids containing mutations within the 14-bp intervening
sequence (pCL8218 and pCL8279) were constructed. The results in Fig. 3
strongly suggest that specific sequences between the 10-bp inverted
repeat and the tentative
35 sequence are not critical. Furthermore,
these results indicate that the direct repeat found in the intervening
region (Fig. 3) is not involved in cap8 gene expression.
Interestingly, deletion of two nucleotides within the intervening
sequence resulted in the abrogation of promoter activity (pCL8219).
Taken together, these results imply that the distance between the
inverted repeat and the tentative
35 sequence is crucial for promoter
activation, though the exact sequences are not important. These results
also suggest that maintaining the inverted repeat and the
cap8 promoter in the same face of the DNA helix may be
important for promoter activity. To test this hypothesis, we
constructed insertions in the intervening region. Since plasmid
pCL8218, which contains a SnaBI site, showed promoter
activity similar to that of the control plasmid pCL8097, we took
advantage of the SnaBI site and inserted sequences at this
site. As shown in Fig. 3, plasmids with insertions of 21 bp (pCL8331)
and 42 bp (pCL8308), which represent about two and four multiples of
helix turn of 10.5 bp per turn, respectively, still exhibited
significant promoter activity. On the other hand, an insertion of 17 bp
(pCL8321), 20 bp (pCL8312), or 39 bp (pCL8284), which shifted the
inverted repeat out of phase with respect to the promoter, reduced
promoter activity to the basal level.
As stated above, upstream of the transcriptional start site we found no
good match to the canonical

35 sequence. To define
the promoter
sequence more precisely, plasmid pCL8239, which contains
three
nucleotide changes in the tentative

35 region (Fig.
3),
was
constructed from pCL8218. The mutation resulted in no promoter
activity, indicating that the tentative

35 sequence is crucial
for
promoter activity. Surprisingly, changing the tentative

35
sequence
to match the canonical

35 sequence, 5'TTGACA3', still
resulted in no promoter activity (pCL8240). These results indicate
that
the tentative

35 sequence is likely a bona fide promoter
element
equivalent to the

35
sequence.
The 10-bp inverted repeat is required for CP8 production.
The
above analyses were all performed by cloning the inserts into a
multiple-copy plasmid vector and therefore were somewhat artificial. We
wished to determine whether the inverted repeat has biological
relevance with respect to capsule production in its native environment.
To this end, we constructed plasmid pCL8226, with a 2.4-kb insert
containing a mutation in the inverted repeat which changed the sequence
to a BamHI recognition site. A PCR fragment containing this
mutation site was recloned into pLC4 (pCL8265) and assayed for XylE
activity. The result (Fig. 3) confirmed that the mutation abolished
promoter activity. Plasmid pCL8226 was then used to construct a mutant
strain (CYL6401) with a chromosomal mutation in the inverted repeat by
allele replacement. The introduction of a BamHI recognition
site allowed us to conveniently screen the desired mutant by Southern
hybridization (not shown). The production of CP8 from strain CYL6401
was then quantitated and compared with that of the wild-type strain
Becker, using RIE. The results in Fig. 4
show that the mutant strain CYL6401 produced undetectable CP8 even in
undiluted samples, whereas the wild-type strain Becker produced
approximately 100 ng at a 10-fold dilution. These results support the
notion that the 10-bp inverted repeat is a cis-acting
element for cap8 gene expression and thus required for the
capsule production in S. aureus Becker.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 4.
(A) RIE analysis of CP8 production. Each well contains 5 µl of the extract. Strains used to prepare the extracts are shown
below the wells. The samples were prepared from cultures standardized
by optical density measurement. The samples were run either undiluted
or in 1:10 dilution. Various amounts of purified CP8 were run as
standards. (B) Plasmids used for complementing CYL6401. The
cap8 genes are indicated by arrows and capital letters.
Abbreviations for restriction sites: E, EcoRI; F,
FspI; H, HindIII; N, NcoI; Sm,
SmaI; Ss, SstI.
|
|
To determine whether the inverted repeat is required for the
transcription of the
cap8 genes, we compared, by RNA dot
blot
analysis, the amounts of RNA produced from wild-type strain
Becker,
strain CYL6401, and a negative control strain, CYL5972, a
Becker
derivative with a chromosomal deletion of most of the
cap8 genes,
including
cap8D (
15). The
result (Fig.
5) showed that CYL6401
produced about 24-fold less mRNA than the wild-type strain, as
determined by densitometric estimation of the messages, whereas
CYL5972
produced no detectable message. This result indicates
that the 10-bp
inverted repeat affects CP8 production mostly at
the transcriptional
level and that the mutation in the inverted
repeat greatly reduced the
transcription.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 5.
RNA dot blot analysis. Total RNAs from strains indicated
at the top were blotted to a nitrocellulose membrane and hybridized
with a gene probe specific to cap8D. As a loading control,
the RNAs were also hybridized with a probe specific to the 16S rRNA
gene.
|
|
Internal promoters within the cap8 locus are
functional.
Previously, we showed by genetic complementation tests
that there were numerous internal promoters within the cap8
locus (46). We found that all cap8 genes except
cap8D and possibly cap8L were transcribed by
promoters upstream of the respective genes. These internal promoters
were much weaker than the primary promoter located upstream of the
cap8A gene, as determined by xylE reporter gene
fusion analysis. To determine whether these internal promoters have any
biological relevance, strain CYL6401 was complemented by various
plasmids with inserts containing intact primary promoter but lacking
different number of downstream genes in the cap8 operon. These plasmids were transduced by phage 52A into strain CYL6401, and
the resultant strains were assayed for CP8 production by RIE. As shown
in Fig. 4A, no CP8 was detected when CYL6401 was complemented either
with pCL8046, which contains intact cap8A and
cap8B, or with pCL8148, which contains only intact
cap8A. On the other hand, CP8 production of CYL6401 could be
partially complemented by pCL7639, which contains intact
cap8A through cap8J, and by pCL7708, which contains intact cap8A through cap8D. The partial
complementation results suggest that there are significantly active
internal promoters downstream of the primary promoter that can
transcribe, from the chromosome of CYL6401, the cap8 genes
not present in pCL7639 or pCL7708. The fact that only very small
amounts of CP8 could be detected in the transductants is consistent
with our previous data showing that these internal promoters are very
weak promoters and that the primary promoter is required for the full
capsule production (46). Since we showed that there were
also weak promoters just upstream of cap8B and
cap8C and that their strengths were similar to those of
other internal promoters, we were somewhat surprised that no CP8 was
detected from CYL6401(pCL8046) and CYL6401(pCL8148). However, it is
possible that RIE is not sensitive enough to detect small amounts of CP8.
An alternative to the above explanation of active internal promoters is
to assume that at least a key gene required for the
limiting step in
CP8 synthesis is present in both pCL7639 and
pCL7708 but not in pCL8046
and pCL8148. The overexpression of
this plasmid-located key gene plus a
low level of transcription
from the mutated primary promoter would also
result in a small
amount of CP8 production. Because
cap8D is
the only gene present
in both pCL7639 and pCL7708 and absent in pCL8046
and pCL8148,
cap8D should be the limiting key gene. However,
in our previous
genetic study (
44), derivatives of strain
Becker with an intact
primary promoter containing pCL7639 produced the
same amount of
CP8 as the wild-type Becker strain, indicating that
cap8D, which
is present in pCL7639, is not likely a limiting
gene in CP8 synthesis.
Furthermore, we detected no activity from the
mutated primary
promoter whereas activities from the internal promoters
were readily
detected (
46), indicating that transcription
from CYL6401 is
most likely due to the internal
promoters.
The inverted repeat serves as a protein binding site.
Since
the 10-bp inverted repeat is required for cap8 promoter
activity and for CP8 production, it likely serves as the binding site
for a positive regulatory protein. To test this possibility, we
performed gel mobility shift assays. A 32P-labeled 63-bp
fragment containing the inverted repeat from
31 to
93 bp upstream
of the promoter region was reacted with the cell extract prepared from
the wild-type Becker strain grown in TSB. As shown in lane 3 of Fig.
6A, a prominent shifted band and a higher
but much weaker band were detected. The intensity of the prominent
shifted band was dramatically reduced (lane 4) when the DNA fragment
containing a mutation in the inverted repeat (same mutation as in
pCL8265 [Fig. 3]) was used in the reaction. In addition, the
prominent shifted band could be competed away by the 63-bp nonlabeled
wild-type DNA fragment but not by the 63-bp nonlabeled mutated fragment
(lanes 5 and 6, respectively). These results indicate that there is at
least one protein which can specifically bind to the 10-bp inverted
repeat, thus activating the cap8 promoter.

View larger version (66K):
[in this window]
[in a new window]
|
FIG. 6.
(A) Results of a gel mobility shift assay performed with
a 63-bp fragment ( 93 to 31) upstream of cap8A containing
the 10-bp inverted repeat. Lanes: 1, labeled fragment amplified from
pCL8074 containing the wild-type inverted repeat; 2, labeled fragment
amplified from pCL8265 containing a mutation in the inverted repeat; 3, labeled fragment with the wild-type inverted repeat reacted with the
crude extract prepared from TSB-grown Becker cells; 4, labeled fragment
with a mutation in the inverted repeat reacted with the crude extract
prepared from TSB-grown Becker cells; 5, reaction in lane 3 with
100-fold excess of cold fragment containing the wild-type inverted
repeat amplified from pCL8074 as competitor DNA; 6, reaction in lane 3 with 100-fold excess of cold fragment containing a mutation in the
inverted repeat amplified from pCL8265 as competitor DNA. (B) Effect of
YE on results of a gel mobility assay using the 63-bp fragment. Lanes:
1, labeled fragment with a mutation in the 10-bp inverted repeat
amplified from pCL8265 reacted with the crude extract prepared from
Becker cells grown in TSB; 2, labeled fragment with the wild-type 10-bp
inverted repeat amplified from pCL8074 reacted with the crude extract
prepared from Becker cells grown in TSB; 3, same as in lane 2 except
that the crude extract was prepared from cells grown in TSB-0.5%
YE.
|
|
Regulation by environmental factors.
To study the effects of
some of the environmental factors on CP8 production, we measured the
XylE activity of Becker(pCL7957) under various growth media. XylE
activities, expressed as mean milliunits per milligram of protein ± standard deviations of three independent tests, were as follows:
TSB, 5.49 ± 1.64; TSB-0.5% yeast extract (YE), <0.25; CB,
0.53 ± 0.10; TDNB, 12.93 ± 1.40; TDNB-0.5% YE, <0.25;
LPM, 6.69 ± 0.82; LPM-0.5% YE, <0.25; HPM, 3.02 ± 0.69;
and HPM-0.5% YE, <0.25. The finding that cap8 promoter activity varied in different media suggests that these growth conditions affect cap8 gene transcription. Of special note
is that the addition of YE to all media drastically suppressed
cap8 promoter activity. The strong inhibition by YE prompted
us to further study its effect on cap8 gene transcription.
Becker strains containing pCL8089 or pCL8097 (Fig. 2) were grown in TSB
in the presence of 0.5% YE and tested for xylE reporter
gene expression. Both strains showed no detectable promoter activity.
Since plasmid pCL8097 contains a deletion just upstream of the 10-bp
inverted repeat, we speculate that YE may exert its effect through the 10-bp inverted repeat. To test this, we performed a gel mobility shift
experiment. The 32P-labeled 63-bp fragment containing the
wild-type 10-bp inverted repeat described above was reacted with the
extract prepared from cells grown in TSB with or without 0.5% YE. The
results (Fig. 6B) showed that the intensity of the prominent shifted
band detected in the reaction containing extract from TSB-grown cells
(lane 2) was much lower than that in the reaction containing extract from cells grown in TSB with YE (lane 3). This inhibition of the shifted band by YE was also observed when the labeled DNA fragment containing a mutation in the 10-bp inverted repeat was reacted with
extract from TSB-grown cells (lane 1). These results suggest that YE
may inhibit cap8 transcription through the 10-bp inverted repeat.
 |
DISCUSSION |
Staphylococcal microcapsules are highly regulated. Our previous
characterization of the cap8 genes has located a primary
promoter within a DNA fragment of 0.45 kb upstream of the first
cap8 gene (46). In this work, we further studied
the primary cap8 promoter at the molecular level. We first
mapped the transcription start site by a primer extension experiment.
By examining the sequence upstream of the transcription start site, we
found a consensus
10 sequence but not a consensus
35 sequence.
Based on the distance from
10, we tentatively assigned a 6-bp
sequence with only two matches to the canonical sequence as the
putative
35 sequence. Mutagenesis within this 6-bp sequence markedly
reduced promoter activity. However, changing the 6-bp sequence to the
canonical
35 sequence also decreased promoter activity to the basal
level, suggesting that the original sequence in the
35 region is
critical for promoter activity. The lack of a consensus
35 sequence
has been found for a number of bacterial promoters that require
additional activators for transcription and suggests to us that the
primary cap8 promoter may require a regulator for
transcription. The fact that there are several inverted repeats and
direct repeats upstream of the promoter prompted us to test these
repeats for possible cis-acting activity. Our data from
deletion analysis and site-directed mutagenesis confirmed that a 10-bp
inverted repeat located 14 bp upstream of the tentative
35 sequence
was indeed required for cap8 promoter activity.
The 10-bp inverted repeat likely serves as a regulatory protein binding
site. Indeed, our gel mobility shift assay results indicate that there
exists at least one protein factor capable of binding to the repeat.
This protein factor is most likely a positive regulator since mutations
in the 10-bp inverted repeat abolished promoter activity. The fact that
the sequence required for promoter activity is palindromic suggests
that the regulatory protein may function as a dimer. However, the
inverted repeat is imperfect, and changing either half site to make it
a perfect inverted repeat did not increase promoter activity over the
wild-type level. In comparison, lacI repressor binds about
10-fold more tightly when the right-half repeat is changed to match the
left-half repeat (42). Thus, our results indicate that the
regulator may not simply bind symmetrically as a homodimer or tetramer;
instead, the binding of the regulator to each half site may be
asymmetrical. Alternatively, the protein may bind as a monomer. Further
studies by cloning and characterizing the regulatory gene, which are
now under way, are required to elucidate the mechanism.
Although we have not replaced all of the sequences between the 10-bp
inverted repeat and the tentative
35 sequence, our finding of several
changes within the intervening sequences suggests that the specific
sequences in this region are not important for cap8 promoter
activity. On the other hand, the distance between the two sites is
critical. Deletions or insertions of a nonintegral helical turn between
the two sites reduced promoter activity drastically, whereas promoter
activity was affected only slightly when the two sites were separated
by two or four full turns of helix. Thus, the two DNA sites are
required to be at the same face of the DNA helix for activation,
suggesting that protein-protein interaction is required. These results
are consistent with the hypothesis that the positive regulator binding
at the 10-bp inverted repeat causes bending or looping of the DNA so
that it can interact with the RNA polymerase as in the case of
catabolite activator protein (CAP)-dependent promoters in E. coli (5). However, it is interesting that while
insertions of 10, 21, and 31 bp in the spacer region of the E. coli melR promoter caused only reduced CAP-dependent activation,
insertion of a 42-bp sequence totally abolished the activation. This is
possibly due to the 42-bp insertion creating too great a distance
between the CAP binding site and the RNA polymerase binding site
(14). In contrast, we showed that a 42-bp insertion between
the tentative
35 promoter sequence and the 10-bp inverted repeat
resulted in only twofold reduction of cap8 promoter
activity. This result indicates that a long intervening sequence has
little effect on cap8 promoter activity, suggesting that
binding of the regulator may induce extensive looping so that the
regulator can still interact with the RNA polymerase properly.
The finding that a mutation within the 10-bp inverted repeat upstream
of the cap8 promoter in the Becker chromosome abolished CP8
synthesis suggests strongly that the repeat is biologically significant
in stimulating CP8 production. It supports the data obtained from the
reporter gene study and therefore rules out the possibility that the
reporter gene data are mere artifacts due to cloning in a multiple-copy
plasmid vector. The effect of the inverted repeat on CP8 production is
largely at the transcriptional level, since only about 4% of the
cap8 message could be detected in the mutant by RNA dot blot
analysis. However, RIE analysis showed that the mutation in the
inverted repeat reduced CP8 synthesis to an undetectable level. It is
possible that the discrepancy is due to different sensitivities of the
two methods. Alternatively, we cannot rule out the possibility that
cap8 gene expression is also controlled through the 10-bp
inverted repeat at the translational level.
The mechanism by which environmental factors regulate S. aureus microcapsules has not been investigated. In this study, we found cap8 transcription was influenced by different growth
media. Most strikingly, the addition of YE to several media greatly
inhibited cap8 transcription. Results of the gel mobility
shift assay (Fig. 6B) suggest that YE could inhibit transcription by
preventing binding of a potential positive regulator to the 10-bp
inverted repeat identified in this study, or YE may affect production
of the regulatory protein. However, definitive proof requires cloning and characterization of the positive regulatory gene. The inhibitory effect of YE on CP5, a microcapsule similar to CP8, has been reported earlier (8). This similarity in regulation is consistent
with the fact that the promoter regions of cap8 and
cap5 are almost identical, with only one difference between
positions
108 and +1 (45). However, in the earlier study,
YE diffusate was used, which may explain why inhibition was observed at
2% YE, compared to 0.5% in this study. Recently, Fox et al.
(13) reported that CP8 production in S. aureus
was not affected by phosphate concentration. Their report is
inconsistent with our finding that high phosphate concentration
inhibited cap8 promoter activity by about 50% (see Results). However, it is not known whether the effect of phosphate detected at the transcriptional level in our study would reflect the
level of CP8 production.
It is interesting that the weak internal promoters that we have
previously identified by genetic complementation and reporter gene
fusion (46) are biologically active (Fig. 4). These results are similar to those for the cap1 gene cluster in which the
weak internal promoters are also biologically active (37).
Since both the cap1 and cap8 gene clusters are
transcribed by a primary promoter to form long transcripts, the distal
gene may not be adequately expressed due to unstable long transcripts.
Thus, active internal promoters, though weak, can ensure that the
distal genes are expressed in amounts sufficient for optimum biogenesis
of capsule.
Although transcription of the cap8 locus is similar to that
of the cap1 locus, these two loci are apparently regulated
differently. While an inverted repeat is required for activation of the
cap8 genes, no requirement of such an inverted repeat was
identified upstream of the cap1 gene cluster. In fact,
5'-end deletion up to the upstream boundary of the
35 sequence did
not affect cap1 promoter activity as assayed by
xylE fusion, suggesting that the cap1 genes may
be constitutively expressed (37). Furthermore, the
cap1 promoter is much stronger than the cap8
promoter, indicating that it is intrinsically a very strong promoter
that requires no accessory factor for its transcription. These
differences further support the notion that CP1 and CP8, representing
mucoid capsule and microcapsule, respectively, contribute differently
to the biology and the pathogenesis of S. aureus.
 |
ACKNOWLEDGMENT |
This work was supported by grant R01AI37027 from the National
Institute of Allergy and Infectious Diseases.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology, Molecular Genetics and Immunology, Room 3025 WHW,
University of Kansas Medical Center, 3901 Rainbow Blvd., Kansas City,
KS 66160. Phone: (913) 588-7156. Fax: (913) 588-7295. E-mail:
clee{at}kumc.edu.
Present address: Bangalore Genei Pvt. Ltd., Peenya, Bangalore
560058, India.
 |
REFERENCES |
| 1.
|
Albus, A.,
J. M. Fournier,
C. Wolz,
A. Boutonnier,
M. Ranke,
N. Høiby,
H. Hochkeppel, and G. Döring.
1988.
Staphylococcus aureus capsular types and antibody response to lung infection in patients with cystic fibrosis.
J. Clin. Microbiol.
26:2205-2209.
|
| 2.
|
Albus, A.,
R. D. Arbeit, and J. C. Lee.
1991.
Virulence of Staphylococcus aureus mutants altered in type 5 capsule production.
Infect. Immun.
59:1008-1014[Abstract/Free Full Text].
|
| 3.
|
Arbeit, R. D.,
W. W. Karakawa,
W. F. Vann, and J. B. Robbins.
1984.
Predominance of two newly described capsular polysaccharide types among clinical isolates of Staphylococcus aureus.
Diagn. Microbiol. Infect. Dis.
2:85-91[Medline].
|
| 4.
|
Baddour, L. M.,
C. Lowrance,
A. Albus,
J. H. Lowrance,
S. K. Anderson, and J. C. Lee.
1992.
Staphylococcus aureus microcapsule expression attenuates bacterial virulence in a rat model of experimental endocarditis.
J. Infect. Dis.
165:749-753[Medline].
|
| 5.
|
Busby, S., and R. H. Ebright.
1994.
Promoter structure, promoter recognition, and transcription activation in prokaryotes.
Cell
79:743-746[Medline].
|
| 6.
|
Cheung, A. L.,
M. G. Bayer, and J. H. Heindrichs.
1997.
sar genetic determinants necessary for transcription of RNAII and RNAIII in the agr locus of Staphylococcus aureus.
J. Bacteriol.
179:3963-3971[Abstract/Free Full Text].
|
| 7.
|
Cheung, A. L.,
K. J. Eberhardt, and V. A. Fischetti.
1994.
A method to isolate RNA from Gram-positive bacteria and mycobacteria.
Anal. Biochem.
222:511-514[Medline].
|
| 8.
|
Dassy, B.,
W. T. Stringfellow,
M. Lieb, and J. M. Fournier.
1991.
Production of type 5 capsular polysaccharide by Staphylococcus aureus grown in a semi-synthetic medium.
J. Gen. Microbiol.
137:1155-1162[Abstract/Free Full Text].
|
| 9.
|
Dassy, B.,
T. Hogan,
T. J. Foster, and J. M. Fournier.
1993.
Involvement of the accessory gene regulator (agr) in expression of type 5 capsular polysaccharide by Staphylococcus aureus.
J. Gen. Microbiol.
139:1301-1306.
|
| 10.
|
Dyer, D. W., and J. J. Iandolo.
1983.
Rapid isolation of DNA from Staphylococcus aureus.
Appl. Environ. Microbiol.
46:283-285[Abstract/Free Full Text].
|
| 11.
|
Fattom, A. I.,
J. Sarwar,
A. Ortiz, and R. Naso.
1996.
A Staphylococcus aureus capsular polysaccharide (CP) vaccine and CP-specific antibodies protect mice against bacterial challenge.
Infect. Immun.
64:1659-1665[Abstract/Free Full Text].
|
| 12.
|
Fournier, J. M.,
W. F. Vann, and W. W. Karakawa.
1984.
Purification and characterization of Staphylococcus aureus type 8 capsular polysaccharide.
Infect. Immun.
45:87-93[Abstract/Free Full Text].
|
| 13.
|
Fox, K. F.,
G. C. Stewart, and A. Fox.
1998.
Synthesis of microcapsule by Staphylococcus aureus is not responsive to environmental phosphate concentrations.
Infect. Immun.
66:4004-4007[Abstract/Free Full Text].
|
| 14.
|
Gaston, K.,
A. Bell,
A. Kolb,
H. Buc, and S. Busby.
1990.
Stringent spacing requirements for transcription activation by CRP.
Cell
62:733-743[Medline].
|
| 15.
|
Gillaspy, A. F.,
C. Y. Lee,
S. Sau,
A. L. Cheung, and M. S. Smeltzer.
1998.
Factors affecting the collagen capacity of Staphylococcus aureus.
Infect. Immun.
66:3170-3178[Abstract/Free Full Text].
|
| 16.
|
Hawley, D. K., and W. R. McClure.
1983.
Compilation and analysis of Escherichia coli promoter DNA sequence.
Nucleic Acids Res.
11:2237-2255[Abstract/Free Full Text].
|
| 17.
|
Herbert, S.,
D. Worlitzsch,
B. Dassy,
A. Boutonnier,
J. M. Fournier,
G. Bellon,
A. Dalhoff, and G. Doring.
1997.
Regulation of Staphylococcus aureus capsular polysaccharide type 5: CO2 inhibition in vitro and in vivo.
J. Infect. Dis.
176:431-438[Medline].
|
| 18.
|
Hochkeppel, H. K.,
D. G. Braun,
W. Vischer,
A. Imm,
S. Sutter,
U. Staeubli,
R. Guggenheim,
E. L. Kaplan,
A. Boutonnier, and J. M. Fournier.
1987.
Serotyping and electron microscopy studies of Staphylococcus aureus clinical isolates with monoclonal antibodies to capsular polysaccharide type 5 and type 8.
J. Clin. Microbiol.
25:526-530[Abstract/Free Full Text].
|
| 19.
|
Holmes, D. S., and M. Quigley.
1981.
A rapid boiling method for the preparation of bacterial plasmids.
Anal. Biochem.
114:193-197[Medline].
|
| 20.
|
Karakawa, W. W., and W. F. Vann.
1982.
Capsular polysaccharides of S. aureus.
Semin. Infect. Dis.
4:285-293.
|
| 21.
|
Karakawa, W. W.,
J. M. Fournier,
W. F. Vann,
R. Arbeit,
R. Schneerson, and J. B. Robbins.
1985.
Method for the serological typing of the capsular polysaccharides of Staphylococcus aureus.
J. Clin. Microbiol.
22:445-447[Abstract/Free Full Text].
|
| 22.
|
Karakawa, W. W.,
A. Sutton,
R. Schneerson,
A. Karpas, and W. F. Vann.
1988.
Capsular antibodies induce type-specific phagocytosis of Staphylococcus aureus by human polymorphonuclear leukocytes.
Infect. Immun.
56:1090-1095[Abstract/Free Full Text].
|
| 23.
|
Kraemer, G. R., and J. J. Iandolo.
1990.
High-frequency transformation of Staphylococcus aureus by electroporation.
Curr. Microbiol.
21:373-376.
|
| 24.
|
Kreiswirth, B. N.,
S. Lofdahl,
M. J. Betley,
M. O'Reilly,
P. M. Shlievert,
M. S. Bergdoll, and R. P. Novick.
1983.
The toxic shock syndrome exotoxin structural gene is not detectably transmitted by a prophage.
Nature (London)
305:709-712[Medline].
|
| 25.
|
Lee, C. Y.
1992.
Cloning of genes affecting capsule expression in Staphylococcus aureus strain M.
Mol. Microbiol.
6:1515-1522[Medline].
|
| 26.
|
Lee, J. C.,
M. J. Betley,
C. A. Hopkins,
N. E. Perez, and G. B. Pier.
1987.
Virulence studies, in mice, of transposon-induced mutants of Staphylococcus aureus differing in capsule size.
J. Infect. Dis.
156:741-750[Medline].
|
| 27.
|
Lee, J. C.,
S. Takeda,
P. Livolsi, and L. C. Paoletti.
1993.
Effects of in vitro and in vivo growth conditions on expression of type 8 capsular polysaccharide by Staphylococcus aureus.
Infect. Immun.
61:1853-1858[Abstract/Free Full Text].
|
| 28.
|
Lee, J. C.,
S. Xu,
A. Albus, and P. J. Livolsi.
1994.
Genetic analysis of type 5 capsular polysaccharide expression by Staphylococcus aureus.
J. Bacteriol.
176:4883-4889[Abstract/Free Full Text].
|
| 29.
|
Lin, W. S.,
T. Cunneen, and C. Y. Lee.
1994.
Sequence analysis and molecular characterization of genes required for the biosynthesis of type 1 capsular polysaccharide in Staphylococcus aureus.
J. Bacteriol.
176:7005-7016[Abstract/Free Full Text].
|
| 30.
|
Mahmood, R., and S. A. Khan.
1990.
Role of upstream sequences in the expression of the staphylococcal enterotoxin B gene.
J. Biol. Chem.
265:4652-4656[Abstract/Free Full Text].
|
| 31.
|
Mamo, W.,
F. Rozgonyi,
S. Hjertén, and T. Wadström.
1987.
Effect of milk on surface properties of Staphylococcus aureus from bovine mastitis.
FEMS Microbiol. Lett.
48:195-200.
|
| 32.
|
Melly, M. A.,
L. J. Duke,
D. F. Liau, and J. H. Hash.
1974.
Biological properties of the encapsulated Staphylococcus aureus M.
Infect. Immun.
10:389-397[Abstract/Free Full Text].
|
| 33.
|
Moran, C. P., Jr.,
N. Lang,
S. F. J. LeGrice,
G. Lee,
M. Stephens,
A. L. Sonenshein,
J. Pero, and R. Losick.
1982.
Nucleotide sequences that signal the initiation of transcription and translation in Bacillus subtilis.
Mol. Gen. Genet.
186:339-346[Medline].
|
| 34.
|
Moreau, M.,
J. C. Richards,
J. M. Fournier,
R. A. Byrd,
W. W. Karakawa, and W. F. Vann.
1990.
Structure of the type-5 capsular polysaccharide of Staphylococcus aureus.
Carbohydr. Res.
201:285-297[Medline].
|
| 35.
|
Nemeth, J., and J. C. Lee.
1995.
Antibodies to capsular polysaccharides are not protective against experimental Staphylococcus aureus endocarditis.
Infect. Immun.
63:375-380[Abstract/Free Full Text].
|
| 36.
|
Nilsson, I.-M.,
J. C. Lee,
T. Bremell,
C. Rydén, and A. Tarkowski.
1997.
The role of staphylococcal polysaccharide microcapsule expression in septicemia and septic arthritis.
Infect. Immun.
65:4216-4221[Abstract/Free Full Text].
|
| 37.
|
Ouyang, S., and C. Y. Lee.
1997.
Transcriptional analysis of type 1 capsule genes in Staphylococcus aureus.
Mol. Microbiol.
23:473-482[Medline].
|
| 38.
|
Peterson, P. K.,
B. J. Wilkinson,
Y. Kim,
D. Schmeling, and P. G. Quie.
1978.
Influence of encapsulation on staphylococcal opsonization and phagocytosis by human polymorphonuclear leukocytes.
Infect. Immun.
19:943-949[Abstract/Free Full Text].
|
| 39.
|
Poutrel, B.,
A. Boutonnier,
L. Sutra, and J. M. Fournier.
1988.
Prevalence of capsular polysaccharide types 5 and 8 among Staphylococcus aureus isolates from cow, goat, and ewe milk.
J. Clin. Microbiol.
26:38-40[Abstract/Free Full Text].
|
| 40.
|
Ray, C.,
R. E. Hay,
H. J. Carter, and C. P. Moran, Jr.
1985.
Mutations that affect utilization of a promoter in stationary-phase Bacillus subtilis.
J. Bacteriol.
163:610-612[Abstract/Free Full Text].
|
| 41.
|
Recsei, P.,
B. Kreiswirth,
M. O'Reilly,
P. Schlievert,
A. Gruss, and R. Novick.
1986.
Regulation of exoprotein gene expression by agr.
Mol. Gen. Genet.
202:58-61[Medline].
|
| 42.
|
Sadler, J. R.,
H. Sasmor, and J. L. Betz.
1983.
A perfectly symmetric lac operator binds the lac repressor very tightly.
Proc. Natl. Acad. Sci. USA
80:6785-6789[Abstract/Free Full Text].
|
| 43.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 44.
|
Sau, S., and C. Y. Lee.
1996.
Cloning of type 8 capsule genes and analysis of gene clusters for the production of different capsular polysaccharides in Staphylococcus aureus.
J. Bacteriol.
178:2118-2126[Abstract/Free Full Text].
|
| 45.
|
Sau, S.,
N. Bhasin,
E. R. Wann,
J. C. Lee,
T. J. Foster, and C. Y. Lee.
1997.
The Staphylococcus aureus allelic genetic loci for serotype 5 and 8 capsule expression contain the type-specific genes flanked by common genes.
Microbiology
143:2395-2405[Abstract/Free Full Text].
|
| 46.
|
Sau, S.,
J. Sun, and C. Y. Lee.
1997.
Molecular characterization and transcriptional analysis of type 8 genes in Staphylococcus aureus.
J. Bacteriol.
179:1614-1621[Abstract/Free Full Text].
|
| 47.
|
Shafer, M. W., and J. J. Iandolo.
1979.
Genetics of staphylococcal enterotoxin B in methicillin-resistant isolates of Staphylococcus aureus.
Infect. Immun.
25:902-911[Abstract/Free Full Text].
|
| 48.
|
Sompolinsky, E.,
Z. Samra,
W. W. Karakawa,
W. F. Vann,
R. Schneerson, and Z. Malik.
1985.
Encapsulation and capsular types in isolates of Staphylococcus aureus from different sources and relationship to phage types.
J. Clin. Microbiol.
22:828-834[Abstract/Free Full Text].
|
| 49.
|
Southern, E. M.
1975.
Detection of specific sequences among DNA fragments separated by gel electrophoresis.
J. Mol. Biol.
98:503-517[Medline].
|
| 50.
|
Stringfellow, W. T.,
B. Dassy,
M. Lieb, and J. M. Fournier.
1991.
Staphylococcus aureus growth and type 5 capsular polysaccharide production in synthetic media.
Appl. Environ. Microbiol.
57:618-621[Abstract/Free Full Text].
|
| 51.
|
Sutra, L.,
C. Rainard, and B. Poutrel.
1990.
Phagocytosis of mastitis isolates of Staphylococcus aureus and expression of type 5 capsular polysaccharide are influenced by growth in the presence of milk.
J. Clin. Microbiol.
28:2253-2258[Abstract/Free Full Text].
|
| 52.
|
Wilkinson, B. J.
1983.
Staphylococcal capsules and slime, p. 481-523.
In
C. S. G. Easmon, and G. Adlam (ed.), Staphylococci and staphylococcal infections. Academic Press, New York, N.Y.
|
| 53.
|
Wunschel, D. S.,
K. F. Fox,
M. L. Nagpal,
K. K. Kim,
G. C. Stewart, and M. Shagholi.
1997.
Quantitative analysis of neutral and acidic sugars in whole bacterial cell hydrolysates using high performance anion exchange liquid chromatography elecrospray ionization tandem mass spectrometry.
J. Chromatogr. A
776:205-219[Medline].
|
| 54.
|
Xu, S.,
R. D. Arbeit, and J. C. Lee.
1992.
Phagocytic killing of encapsulated and microencapsulated Staphylococcus aureus by human polymorphonuclear leukocytes.
Infect. Immun.
60:1358-1362[Abstract/Free Full Text].
|
| 55.
|
Zukowski, M. M.,
D. F. Gaffney,
D. Speck,
M. Kauffmann,
A. Findeli,
A. Wisecup, and J. P. Lecocq.
1983.
Chromogenic identification of genetic regulatory signals in Bacillus subtilis based on expression of a cloned Pseudomonas gene.
Proc. Natl. Acad. Sci. USA
80:1101-1105[Abstract/Free Full Text].
|
Journal of Bacteriology, April 1999, p. 2492-2500, Vol. 181, No. 8
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Pohl, K., Francois, P., Stenz, L., Schlink, F., Geiger, T., Herbert, S., Goerke, C., Schrenzel, J., Wolz, C.
(2009). CodY in Staphylococcus aureus: a Regulatory Link between Metabolism and Virulence Gene Expression. J. Bacteriol.
191: 2953-2963
[Abstract]
[Full Text]
-
Chen, Z., Luong, T. T., Lee, C. Y.
(2007). The sbcDC Locus Mediates Repression of Type 5 Capsule Production as Part of the SOS Response in Staphylococcus aureus. J. Bacteriol.
189: 7343-7350
[Abstract]
[Full Text]
-
Meier, S., Goerke, C., Wolz, C., Seidl, K., Homerova, D., Schulthess, B., Kormanec, J., Berger-Bachi, B., Bischoff, M.
(2007). {sigma}B and the {sigma}B-Dependent arlRS and yabJ-spoVG Loci Affect Capsule Formation in Staphylococcus aureus. Infect. Immun.
75: 4562-4571
[Abstract]
[Full Text]
-
Luong, T. T., Lee, C. Y.
(2006). The arl locus positively regulates Staphylococcus aureus type 5 capsule via an mgrA-dependent pathway.. Microbiology
152: 3123-3131
[Abstract]
[Full Text]
-
Wang, L., Trawick, J. D., Yamamoto, R., Zamudio, C.
(2004). Genome-wide operon prediction in Staphylococcus aureus. Nucleic Acids Res
32: 3689-3702
[Abstract]
[Full Text]
-
O'Riordan, K., Lee, J. C.
(2004). Staphylococcus aureus Capsular Polysaccharides. Clin. Microbiol. Rev.
17: 218-234
[Abstract]
[Full Text]
-
Trindade, M. I., Abratt, V. R., Reid, S. J.
(2003). Induction of Sucrose Utilization Genes from Bifidobacterium lactis by Sucrose and Raffinose. Appl. Environ. Microbiol.
69: 24-32
[Abstract]
[Full Text]
-
McAleese, F. M., Foster, T. J.
(2003). Analysis of mutations in the Staphylococcus aureus clfB promoter leading to increased expression. Microbiology
149: 99-109
[Abstract]
[Full Text]
-
O'Brien, F. G., Price, C., Grubb, W. B., Gustafson, J. E.
(2002). Genetic characterization of the fusidic acid and cadmium resistance determinants of Staphylococcus aureus plasmid pUB101. J Antimicrob Chemother
50: 313-321
[Abstract]
[Full Text]
-
Luong, T. T., Lee, C. Y.
(2002). Overproduction of Type 8 Capsular Polysaccharide Augments Staphylococcus aureus Virulence. Infect. Immun.
70: 3389-3395
[Abstract]
[Full Text]
-
Luong, T., Sau, S., Gomez, M., Lee, J. C., Lee, C. Y.
(2002). Regulation of Staphylococcus aureus Capsular Polysaccharide Expression by agr and sarA. Infect. Immun.
70: 444-450
[Abstract]
[Full Text]