Previous Article | Next Article 
Journal of Bacteriology, May 1999, p. 2697-2702, Vol. 181, No. 9
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
The Global Nitrogen Regulator NtcA Regulates Transcription of the
Signal Transducer PII (GlnB) and Influences Its
Phosphorylation Level in Response to Nitrogen and Carbon Supplies
in the Cyanobacterium Synechococcus sp. Strain PCC
7942
Hyun-Mi
Lee,1
María Félix
Vázquez-Bermúdez,2 and
Nicole Tandeau
de
Marsac1,*
Département de Biochimie et
Génétique Moléculaire, Unité de Physiologie
Microbienne, Institut Pasteur, 75724 Paris Cedex 15, France,1 and Instituto de
Bioquímica Vegetal y Fotosíntesis, CSIC-Universidad de
Sevilla, Centro de Investigaciones Científicas Isla de la
Cartuja, E-41092, Seville, Spain2
Received 3 December 1998/Accepted 12 February 1999
 |
ABSTRACT |
The PII protein is encoded by a unique glnB
gene in Synechococcus sp. strain PCC 7942. Its expression
has been analyzed in the wild type and in NtcA-null mutant cells grown
under different conditions of nitrogen and carbon supply. RNA-DNA
hybridization experiments revealed the presence of one transcript
species 680 nucleotides long, whatever the nutrient conditions
tested. A second transcript species, 620 nucleotides long, absent in
the NtcA null mutant, was observed in wild-type cells that were
nitrogen starved for 2 h under both high and low CO2
and in the presence of nitrate under a high CO2
concentration. Primer extension analysis indicated that the two
transcript species are generated from two tandem promoters, a
70 Escherichia coli-type promoter and an
NtcA-dependent promoter, located 120 and 53 nucleotides, respectively,
from the glnB initiation codon. The NtcA-dependent promoter
is up-regulated under the conditions mentioned above, while the
70 E. coli-type promoter displays
constitutive levels of transcripts in the NtcA null mutant and slightly
different levels in the wild-type cells, depending on the nitrogen and
carbon supplies. In general, a good correlation between the amounts of
the two transcript species and that of the PII protein was
observed, as revealed by immunodetection with specific antibodies. The
phosphorylation level of PII in the wild type is inversely
correlated with nitrogen availability and directly correlated with
higher CO2 concentration. This regulation is
correspondingly less stringent in the NtcA null mutant cells. In
contrast, the dephosphorylation of PII is NtcA independent.
| |
INTRODUCTION |
In cyanobacteria, nitrogen
assimilation is a genuine photosynthetic process that requires ATP and
reducing equivalents generated in the light. Both nitrate and nitrite
are reduced to ammonium in the presence of photosynthetically reduced
ferredoxin as the physiological electron donor. Ammonium is
incorporated, through the glutamine synthetase-glutamate synthase
pathway, into glutamate to yield glutamine by an ATP-dependent ligation
reaction catalyzed by glutamine synthetase, and glutamate synthase
transfers the amido group of glutamine to 2-oxoglutarate to regenerate
glutamate in the presence of reduced ferredoxin. Nitrogen assimilation
is tightly regulated in response to environmental cues. Nitrate and nitrite are taken up and reduced only in the absence of ammonium and
under CO2 fixation conditions, and the level of glutamine synthetase protein is severely reduced in the presence of ammonium (12).
In the unicellular Synechococcus sp. strain PCC 7942, which
does not fix molecular nitrogen, the signal transduction protein PII (the glnB gene product) is a key element in
the coordination of nitrogen and carbon metabolism (15).
This protein is a homotrimer of 36 kDa whose isomeric forms carry
either zero, one, two, or three phosphorylated seryl residues (Ser49),
depending on the carbon and nitrogen supply of the cells (13,
14), in contrast to the Escherichia coli
PII, which is uridylylated at a tyrosyl residue (Tyr51)
(41). The highest degree of PII
phosphorylation is observed in cells incubated under a high
CO2 concentration in the presence of nitrate or under
nitrogen-limiting conditions, while the protein is mainly
dephosphorylated under low CO2 in the presence of ammonium
(14, 15). In vitro phosphorylation experiments revealed that
both the PII kinase and phosphatase activities depend on
2-oxoglutarate and ATP but not on glutamine or glutamate (16,
23). The modification of the Synechococcus sp.
strain PCC 7942 PII protein is facilitated by the binding of ATP and 2-oxoglutarate (13, 16). Since the intracellular concentration of ATP is high under physiological conditions, it has
been proposed that PII primarily functions as a sensor of 2-oxoglutarate (13). This metabolite not only serves as a
source of carbon skeleton for nitrogen assimilation but would also be of particular importance as a small-molecule effector in the control of
this metabolic process in Synechococcus sp. strain PCC 7942.
NtcA is a global nitrogen regulator that is widespread and highly
conserved in cyanobacteria (12, 20). This DNA-binding protein, which belongs to the CRP family of bacterial transcriptional effectors, activates the expression of a number of genes in the absence
of ammonium by recognizing the target consensus nucleotide sequence
GTAN8TAC in their promoter regions (30). In
Synechococcus sp. strain PCC 7942, NtcA positively regulates
its own expression and activates the transcription of the
nir operon (encoding nitrite reductase, the ABC-type
permease complex, and nitrate reductase) (12, 30, 39), the
nirB ntcB gene cluster (which encodes, respectively, a
protein required for expression of nitrite reductase activity and a
transcriptional effector of the bacterial LysR-type family that
activates the nir operon in the presence of nitrite) (1, 26, 44), the glnA gene (encoding glutamine
synthetase) (6, 7, 30), and the cynBDS operon
(encoding two proteins likely to be involved in the active transport of
cyanate and cyanase) (22). In the N2-fixing
filamentous heterocystous cyanobacterium Anabaena sp. strain
PCC 7120, NtcA acts as an activator for the expression of genes
for the assimilation of nitrogen sources alternative to ammonium
and as an activator for heterocyst development (18, 19, 49).
It has also been proposed that it could behave as a repressor for
the rbcL gene (encoding the large
ribulose-1,5-bisphosphate carboxylase-oxygenase subunit) and
the gor gene (encoding glutathione reductase)
(24, 40). In the facultative photoheterotroph
Synechocystis sp. strain PCC 6803, glnB
appears to be regulated by both electron transport and nitrogen
availability, and the increased level of glnB under nitrogen
starvation might be under the control of NtcA (21). In the
marine unicellular N2-fixing Cyanothece sp.
strain BH68K, NtcA is involved in nitrogen assimilation rather than
nitrogen fixation, and the expression of the ntcA gene may
be under the control of the circadian rhythm (4).
Analysis of the phenotype of MP2, a PII null mutant of the
obligate photoautotroph Synechococcus sp. strain PCC 7942, revealed that nitrate utilization no longer depended on CO2
fixation (15). Moreover, in contrast to the wild-type cells,
in which ammonium exerts a rapid and reversible inhibition of nitrate
and nitrite uptake, no inhibition was observed in this mutant. It was
thus concluded that the unphosphorylated form of PII is
involved in the short-term inhibition by ammonium of nitrate and
nitrite uptake (27). In this mutant, the synthesis of
nitrate and nitrite reductases and glutamine synthetase was still
subject to control by ammonium, suggesting that there is no direct
interaction between PII and the activity of NtcA in the
regulation of nitrogen assimilation (15). However, other
relationships between PII and NtcA were not excluded.
Here we present results demonstrating that NtcA regulates
PII synthesis at the transcriptional level and is required
for a full control of the phosphorylation state of PII in
response to nitrogen and carbon availability in
Synechococcus sp. strain PCC 7942.
| |
MATERIALS AND METHODS |
Strains and culture conditions.
Wild-type and mutant cells
of Synechococcus sp. strain PCC 7942 were grown in liquid
BG110 medium (43) containing 0.4 mM Na2CO3 and supplemented with 10 mM HEPES, pH
8.0. Either NaNO3 (17.6 mM) or NH4Cl (5 mM) was
used as the N source. The NtcA
mutant, constructed by
using plasmid pMAV58 according to the method of Vega-Palas et al.
(48), was grown in ammonium-containing BG110
medium with chloramphenicol (7 µg ml1). Precultures
grown in the presence of ammonium were incubated for 3 to 4 days
(optical density at 750 nm [OD750], approximately 0.6) at
30°C in air and illuminated with fluorescent lamps (OSRAM L18W/25
universal white) providing a photosynthetic photon flux density of 50 µmol m2 s1 measured with a LI-COR LI-185B
quantum radiometer-photometer equipped with an LI-190SB quantum sensor.
Experimental cultures were incubated at 35°C under the same
photosynthetic photon flux density in a culture medium containing
ammonium and supplemented with NaHCO3 (10 mM) and with
constant bubbling with air-3% (vol/vol) CO2. Cells from
mid-exponential-phase cultures (OD750, approximately 0.4)
were collected by centrifugation at 5,000 × g for 10 min at 25°C. The cell pellets were washed twice with
BG110 and resuspended at the same cell density in
BG110 medium containing either ammonium, nitrate, or no
nitrogen source. After 2 h of incubation of the cells either in
air without bubbling or bubbled with air-3% (vol/vol) CO2, samples were collected for analysis.
Nucleic acid methods.
Standard methods were used for
E. coli plasmid DNA isolation. Restriction endonucleases
(New England Biolabs or Pharmacia) and other DNA-modifying enzymes (New
England Biolabs or Amersham) were used according to the manufacturers' recommendations.
Extraction of total RNA, gel electrophoreses, blottings, and
hybridizations were performed as described previously (27). DNA probes were labelled with [
-32P]dATP (110 TBq
mmol1) by using a Megaprime random-labelling kit
(Amersham). A probe internal to glnB (241 bp) was obtained
by PCR amplification of the corresponding fragment from plasmid pPM119
(45) with specific primers to which an EcoRI site
was added at the 5' extremity of the coding strand (5'
CGGAATTCCGTTCAAACTGGAC 3') and a BamHI site was added
at the 5' extremity of the complementary strand (5' CGGGATCCCGTCACCAATTTCGC 3'). The PCR product was cloned in the vector pTZ18R for further use in the DNA-binding assay. Plasmid DNA was
extracted with the Nucleobond AX kit (Macherey-Nagel, Düren,
Germany). A 0.6-kb KpnI-XhoI fragment containing
the rnpB gene, encoding the RNA subunit of RNase P from
Synechococcus sp. strain PCC 7942 (a gift from A. Vioque
[3]), was used as a probe to quantify the amount of
RNA loaded and transferred to the filters and to standardize the measurements.
Primer extension was performed as described by Liotenberg et al.
(
28) with 60 µg of total RNA and the 21-nucleotide-long
primer 5' GACTTCGTCCAGTTTGAACGG 3'. DNA sequencing was
performed
by using the sequencing dideoxynucleotide chain
termination method
(T7 sequencing kit; Pharmacia) with
35S-dATP (37 TBq mmol
1; Amersham) as the
labelled nucleotide and the same primer mentioned
above.
The relative transcript levels were quantified by scanning
photoactivatable screens on a Molecular Dynamics 445SI
PhosphoImager.
All quantifications, data display, and
analysis were performed
with Molecular Dynamics Image Quant
software.
Gel retardation assays.
Preparation of cell extracts from
E. coli DH5 containing the expression vector pTrc99A and
from isopropyl-
-D-thiogalactopyranoside (IPTG)-induced
cells of the NtcA-overproducing strain DH5(pCSI26), gel retardation
assays, and labelling of the probes were performed as described
previously (30). The DNA probes were a 440-bp
NheI-AvaI fragment of the glnB
promoter region from plasmid pPM119; the PCR product corresponding to a
fragment internal to the glnB gene, obtained as described
above in "Nucleic acid methods"; and a 350-bp EcoRI-XhoI fragment of the glnA
promoter region from pCSI38 (30). These probes were labelled
with [-32P]dCTP (110 TBq/mmol; Amersham). The
protein-DNA complex was visualized with an Instant Imager (Packard).
Quantification of the PII protein and determination
of its modification state.
Cell extracts were prepared from
cultures grown to an OD750 of 0.4, and aliquots
corresponding to 10 µg of total protein were separated by
polyacrylamide gel electrophoresis under either denaturing or
nondenaturing conditions as described by Forchhammer and Tandeau de
Marsac (14). The protein content of cell extracts was
estimated by the method of Lowry modified as described previously
(32), with bovine serum albumin as a standard. The
PII protein was revealed by immunoblotting with a
PII-specific antiserum in an enhanced chemoluminescence
detection system (ECL kit; Amersham). Quantification was done with the
National Institutes of Health Image program.
| |
RESULTS |
Control of glnB expression by NtcA.
Examination of
the nucleotide sequence of the glnB gene of
Synechococcus sp. strain PCC 7942 revealed the presence of a
consensus DNA-binding site for the transcriptional effector NtcA (Fig.
1) located upstream of the
glnB initiation codon between nucleotides 88 and 102. Experiments were designed to analyze the conditions under which
the expression of the glnB gene of
Synechococcus sp. strain PCC 7942 was regulated and to
determine the corresponding start sites for transcription. RNA-DNA
hybridizations, using a probe internal to the glnB gene, and
primer extension analysis were performed. Total RNA was extracted from
ammonium-grown cultures of the wild type and the NtcA null mutant after
transfer of the cells for 2 h to a medium containing either
ammonium, nitrate, or no combined nitrogen and under either air or air
enriched with 3% (vol/vol) CO2. One or two transcript
species of slightly different sizes (0.68 and 0.62 kb) were observed,
depending on the nutrient conditions and the strain (Fig.
2). A particularly high level of
transcripts was found in the wild-type cells incubated under nitrogen
limitation and a high CO2 concentration; their abundance was low under each of the other conditions tested.
View larger version (29K):
[in this window]
[in a new window]
|
FIG. 2.
RNA-DNA hybridization of total RNA from cells of
wild-type Synechococcus sp. strain PCC 7942 (WT) and the
NtcA-deficient mutant (NtcA) in response to the nature of
the nitrogen source and the availability of CO2.
Ammonium-grown cells were transferred for 2 h to
BG-110 medium containing ammonium (lanes 1), nitrate (lanes
2), or no nitrogen source (lanes 3), under either air or air-3%
(vol/vol) CO2. The same RNA blots were hybridized with a
DNA probe internal to the glnB gene encoding the
PII protein and with a DNA probe of the rnpB
gene encoding the RNA subunit of RNase P to provide an estimate of the
RNA loading.
|
|
Primer extension analysis revealed four extension products (Fig.
3). Two of them, which might correspond
to the transcription
start points designated
tsp1 and
tsp2, varied in abundance with
the conditions of nitrogen
and carbon availability in both the
wild-type and the NtcA null mutant
cells. The two additional small
extension products most likely result
from earlier pauses caused
by a GC-rich stretch starting immediately
downstream from
tsp2.
The transcription start point
tsp1, situated 120 nucleotides from
the
glnB
initiation codon, was found with RNA from both the wild-type
and NtcA
null mutant cells, whatever the conditions tested. The
transcript
species corresponding to
tsp1 was preceded on the DNA
sequence by a
70-like promoter (
10 TAAAAT;
35 TTGCCT). The second transcription
start point,
tsp2, localized 53 nucleotides from
glnB,
corresponded
to extension products whose abundance increased under
nitrogen
limitation and high CO
2 concentration in the
wild-type cells.
This was accompanied by a decreased intensity of the
extension
products corresponding to
tsp1. The transcription
start point
tsp2 was preceded on the DNA sequence by a
10
box, TACCAA, and
a perfect consensus NtcA-binding sequence,
GTAN
8TAC (
30), between
nucleotides
35 and
50. No extension products corresponding to
tsp2 were
detectable in the RNA from the NtcA
mutant cells,
whatever the conditions tested. These results indicated
that NtcA
controls the expression of the
glnB gene at
tsp2.
View larger version (60K):
[in this window]
[in a new window]
|
FIG. 3.
Primer extension with the glnB gene. Total
RNA (60 µg) from wild-type Synechococcus sp. strain PCC
7942 (WT) and NtcA-deficient mutant (NtcA) cells was
annealed with an oligonucleotide specific to the glnB gene
and extended with avian myeloblastosis virus reverse transcriptase as
indicated in Materials and Methods. The cells were incubated as
described in the legend to Fig. 2. Lanes A, C, G, and T contain a
dideoxy sequencing ladder of the same DNA region used as a size control
of the extension products. The sequences around the 5' ends are listed
on the right. tsp1 and tsp2 are putative
transcription start points.
|
|
Binding of NtcA to the glnB promoter region.
Mobility shift assays of electrophoretically resolved DNA fragments
carrying the upstream region of glnB were performed with cell extracts of an NtcA-overproducing E. coli strain. This
strain harbors plasmid pCSI26, which carries the ntcA gene
downstream from the synthetic IPTG-inducible promoter trc
and thus overexpresses NtcA after IPTG induction (30). As a
positive control, experiments were performed in parallel with the
promoter region of the glnA gene
(PglnA). The DNA fragment containing the
promoter region of the glnB gene
(PglnB) was retarded by the NtcA-containing extract from E. coli carrying pCSI26 but not by the extract
from E. coli cells harboring pTrc99A, the vector used to
construct pCSI26 (Fig. 4A). The DNA
fragment corresponding to an internal part of the glnB gene
did not display any mobility shift and did not compete with either
PglnB or PglnA (Fig. 4A).
These results confirmed that the NtcA protein might bind specifically
to DNA upstream from the glnB gene. At least a
50-fold-higher concentration of the cell extract was required, however,
to obtain an NtcA-promoted shift of PglnB than
to obtain a shift of PglnA (Fig. 4B), and the
retarded band was fuzzier, whatever the concentration of the cell
extracts tested (Fig. 4A and B).
View larger version (49K):
[in this window]
[in a new window]
|
FIG. 4.
Gel retardation of DNA fragments from the
glnB and glnA promoter regions by cell extracts
of an NtcA-overproducing E. coli strain. (A) glnA
promoter region, PglnA (lanes 1 to 3), and
glnB promoter region, PglnB (lanes 4 to 6), incubated with a DNA fragment internal to the glnB
gene as the competitor DNA. Lanes 1 and 4, no NtcA-containing extract
added; lanes 2 and 5, 5 µg of extract from cells of E. coli DH5(pTrc99A) added; lanes 3 and 6, 5 µg of
NtcA-containing extract from IPTG-induced cells of E. coli DH5(pCSI26) added. CglnA and
CglnB are complexes formed after incubation of
the DNA fragments carrying PglnA and
PglnB, respectively, with the NtcA-containing
extracts. (B) Same conditions as in panel A, lanes 1 and 4, with
various amounts (0 [] to 8.0 µg) of extract from IPTG-induced
cells of E. coli DH5(pCSI26) added.
|
|
Immunological detection of PII in the wild type and in
an NtcA null mutant.
The amount of PII protein was
estimated by immunoblotting with specific PII antibodies.
In general, the total amount of the protein was found to be in good
correlation with the levels of the transcripts in both the wild-type
and the NtcA cells incubated under the different nutrient
conditions tested (Fig. 5). This
indicated that, in addition to a basal level of expression of the
glnB gene, which is NtcA independent, there is control by
NtcA that occurs at a transcriptional level.
View larger version (19K):
[in this window]
[in a new window]
|
FIG. 5.
Immunoblot analysis of the PII protein in
cells of wild-type Synechococcus sp. strain PCC 7942 (WT)
and of the NtcA-deficient mutant (NtcA) in response to
the nature of the nitrogen source and CO2 availability. The
cells were incubated as described in the legend to Fig. 2.
|
|
Modulation of phosphorylation levels of PII isoforms by
NtcA.
In the wild-type cells, the relative abundance of the four
PII isoforms, PII0,
PII1, PII2, and
PII3, which possess either zero, one, two or
three phosphorylated monomers, respectively, varied with both the
nitrogen supply and the concentration of CO2 (Fig.
6). In the presence of ammonium, whatever
the CO2 level, or in the presence of nitrate under low CO2, PII was mainly unphosphorylated. Three to
four isoforms were observed in the presence of nitrate under high
CO2 and in nitrogen-limiting conditions under both high and
low CO2. In the NtcA null mutant, whatever the availability
of CO2, PII remained unphosphorylated in cells
incubated in the presence of ammonium, as in the wild-type cells. In
contrast, only two (under high CO2) to three (under low
CO2) isoforms were observed when the cells were incubated with nitrate or under nitrogen limitation. As expected, the same results were obtained under both nitrogen conditions, since the NtcA-deficient mutant is impaired in the expression of a number of
genes involved in nitrogen assimilation (48). Addition of ammonium to the nitrogen-starved cells led to a complete
dephosphorylation of PII in the NtcA null mutant, as in the
wild type. Therefore, NtcA is not required for the dephosphorylation of
PII but only for the accumulation of phosphorylated forms
in response to both the nitrogen and carbon sources.
View larger version (22K):
[in this window]
[in a new window]
|
FIG. 6.
In vivo phosphorylation of the PII protein
in cells of wild-type Synechococcus sp. strain PCC 7942 (WT)
and the NtcA-deficient mutant (NtcA) in response to the
nature of the nitrogen source and CO2 availability. Lanes 1 to 3, the cells were incubated as described in the legend to Fig. 2.
Lanes 4, cells starved for nitrogen as in lanes 3 were further
incubated for 2 h following addition of ammonium to the culture
medium. PII0, PII1,
PII2, and PII3
correspond to the four isoforms of the trimeric PII protein
containing zero, one, two, or three phosphorylated monomers.
|
|
| |
DISCUSSION |
In this study, a role for the global nitrogen regulator NtcA in
the control of the transcription of the glnB gene, which
encodes the signal transduction PII protein, in response to
changes in the availability of nitrogen and carbon in the environment
has been demonstrated in the unicellular cyanobacterium
Synechococcus sp. strain PCC 7942.
At least two distinct promoter-like structures have been identified
that control the expression of the unique glnB gene in Synechococcus sp. strain PCC 7942, depending on the nitrogen
supply and CO2 concentration. The first, located upstream
from tsp1, is of the common 70 E. coli type. It yields constitutive levels of glnB mRNA
in both wild-type and NtcA null mutant cells. The second, located
upstream from tsp2, is activated by the global nitrogen
regulator NtcA. The putative NtcA-binding site from the
Synechococcus glnB promoter exactly matches the consensus
sequence (GTAN8TAC), as is the case with other genes from
this organism, such as glnA, ntcA, and the nir operon (Fig. 1). However, there is obviously a different
binding affinity for the glnB and the glnA
promoter regions (Fig. 4). Previous in vitro studies have shown that
NtcA from the filamentous heterocystous cyanobacterium
Anabaena sp. strain PCC 7120 displays different affinities,
depending on the target genes (40). A similar type of
control could occur in Synechococcus sp. strain PCC 7942.
The abundance of the NtcA-dependent transcripts is inversely correlated
with the availability of nitrogen and increases with higher
CO2 concentrations (Fig. 3). This positive effect of
CO2 could be exerted by CO2 itself or by a
metabolite derived from its fixation. A corresponding decrease in the
level of the transcripts that initiate at tsp1 is
particularly evident in cells incubated with high CO2. This
would result if the binding of NtcA to the tsp2 transcript
species prevents the RNA polymerase from initiating transcription from
the more distal tsp1 promoter region, and it is not due to a
specific recognition of the tsp1 promoter region by NtcA,
since no NtcA consensus sequence is present in that region.
In Synechocystis sp. strain PCC 6803, nitrogen availability
and electron transport have been shown to control the expression of the
glnA and glnB genes (21). In this
cyanobacterium, one putative promoter of the glnB gene is
constitutively expressed at a very low level in the absence of nitrogen
and in the presence of ammonium and/or nitrate. The other promoter is
functional only in cells starved for nitrogen (21).
Therefore, the glnB control system in
Synechocystis sp. strain PCC 6803, as well as those of other
genes (e.g., icd, encoding NADP+-isocitrate
dehydrogenase, and glnA and glnN, encoding
glutamine synthetases I and III) (38, 42), differs from the
one that operates in Synechococcus sp. strain PCC 7942 for
glnA (6, 30) and glnB (Fig. 3), in
which the inducible promoter is active in cells grown both in the
absence of nitrogen and in the presence of nitrate. Moreover, the
physical organizations of the promoter regions in these two strains
differ. In contrast to Synechocystis sp. strain PCC 6803, in
Synechococcus sp. strain PCC 7942 the two promoter sequences
do not overlap and the constitutively expressed promoter is upstream of
the nitrogen-regulated one (Fig. 7).
View larger version (19K):
[in this window]
[in a new window]
|
FIG. 7.
Comparison of the physical organization of the promoter
regions of the glnB genes from Synechococcus sp.
strain PCC 7942 and Synechocystis sp. strain PCC 6803.
|
|
Two types of promoters for the genes encoding PII and
PII-like proteins that recognize either 70
or a nitrogen-regulated RNA polymerase are commonly found in bacteria.
Their physical organization and their levels of expression may vary,
depending on the organism, but in most cases nitrogen control is
exerted from a 54-dependent promoter through the NtrC
protein (2, 5, 9-11, 17, 25, 29, 34, 36, 37, 46, 47, 50,
51).
In this study, we did not look at the kinetics of phosphorylation and
dephosphorylation of PII in the wild-type and mutant strains in response to nitrogen shifts. Therefore, we do not know whether the accumulation of the phosphorylated forms of PII
depends on a kinase or a phosphatase activity. Nevertheless, the
dephosphorylation of PII in the presence of ammonium
appears to be NtcA independent, while the accumulation of the
phosphorylated forms is at least in part NtcA dependent in
Synechococcus sp. strain PCC 7942 (Fig. 6, compare lanes 3).
The transcriptional activator NtcA might therefore modulate the
phosphorylation state of PII in response to the
intracellular N-C balance by directly or indirectly controlling the
synthesis, activity, and/or stability of the serine kinase-phosphatase enzyme system, which posttranslationally modifies PII.
At present, in Synechococcus sp. strain PCC 7942, we do not
know whether NtcA is a single protein or a complex of one or more proteins or if it needs to be liganded to some effector(s) or posttranslationally modified to be active or to modulate its activity, depending on environmental conditions. The effect of NtcA on the activation of transcription of the glnB gene in
Synechococcus sp. strain PCC 7942 and on the increased
phosphorylation state of the protein could result from a higher level
of expression of the corresponding ntcA gene and/or from a
greater affinity of this regulator for its target sites under a high
CO2 concentration. Whether this is due to an increased
electron transport activity or to the presence of a specific
CO2 fixation product(s) remains to be elucidated. The fact
that the concentration of 2-oxoglutarate varies greatly in
cyanobacterial cells, depending on the supply of carbon and nitrogen
(8, 33, 35, 38), and that this is a very important
metabolite involved in the regulation of nitrogen assimilation pathways
in cyanobacteria and other prokaryotes (15, 35, 31) favors
the hypothesis that this compound could play a key role in the
regulatory system that coordinates the corresponding metabolic
processes via PII and NtcA.
| |
ACKNOWLEDGMENTS |
We are grateful to M. Herdman for critical reading of the
manuscript. We also thank J. Houmard, J. Gomez Ochoa de Alda, and I. Luque for helpful discussions and A. Vioque for kindly
providing the plasmid containing the rnpB gene from
Synechococcus sp. strain PCC 7942.
This work was supported by the Institut Pasteur and the Centre National
de la Recherche Scientifique (URA 1129), by grant PB 95-1267 from the
Dirreción General Ensenanza Superior, and, in part, by a joint
Picasso program from the Ministère des Affaires Etrangères
(France) and the Ministerio de Educación y Ciencia (Spain).
| |
FOOTNOTES |
*
Corresponding author. Mailing address:
Département de Biochimie et Génétique
Moléculaire, Unité de Physiologie Microbienne, Institut
Pasteur, 28 rue du Docteur Roux, 75724 Paris Cedex 15, France. Phone:
33 (0)1 45 68 8415. Fax: 33 (0)1 40 61 3042. E-mail: ntmarsac{at}pasteur.fr.
| |
REFERENCES |
| 1.
|
Aichi, M., and T. Omata.
1997.
Involvement of NtcB, a LysR family transcription factor, in nitrite activation of the nitrate assimilation operon in the cyanobacterium Synechococcus sp. strain PCC 7942.
J. Bacteriol.
179:4671-4675[Abstract/Free Full Text].
|
| 2.
|
Amar, M.,
E. J. Patriarca,
G. Manco,
P. Bernard,
A. Riccio,
A. Lamberti,
R. Defez, and M. Iaccarino.
1994.
Regulation of nitrogen metabolism is altered in a glnB mutant strain of Rhizobium leguminosarum.
Mol. Microbiol.
11:685-693[Medline].
|
| 3.
|
Banta, A. B.,
E. S. Haas,
J. W. Brown, and N. R. Pace.
1992.
Sequence of the ribonuclease P RNA gene from the cyanobacterium Anacystis nidulans.
Nucleic Acids Res.
20:911[Free Full Text].
|
| 4.
|
Bradley, R. L., and K. J. Reddy.
1997.
Cloning, sequencing, and regulation of the global nitrogen regulator gene ntcA in the unicellular diazotrophic cyanobacterium Cyanothece sp. strain BH68K.
J. Bacteriol.
179:4407-4410[Abstract/Free Full Text].
|
| 5.
|
Chiurazzi, M., and M. Iaccarino.
1990.
Transcriptional analysis of the glnB-glnA region of Rhizobium leguminosarum biovar viciae.
Mol. Microbiol.
4:1727-1735[Medline].
|
| 6.
|
Cohen-Kupiec, R.,
M. Gurevitz, and A. Zilberstein.
1993.
Expression of glnA in the cyanobacterium Synechococcus sp. strain PCC 7942 is initiated from a single nif-like promoter under various nitrogen conditions.
J. Bacteriol.
175:7727-7731[Abstract/Free Full Text].
|
| 7.
|
Cohen-Kupiec, R.,
A. Zilberstein, and M. Gurevitz.
1995.
Characterization of cis elements that regulate the expression of glnA in Synechococcus sp. strain PCC 7942.
J. Bacteriol.
177:2222-2226[Abstract/Free Full Text].
|
| 8.
|
Coronil, T.,
C. Lara, and M. G. Guerrero.
1993.
Shift in carbon flow and stimulation of amino-acid turnover induced by nitrate and ammonium assimilation in Anacystis nidulans.
Planta
189:461-467.
|
| 9.
|
de Zamaroczy, M.,
F. Delorme, and C. Elmerich.
1990.
Characterization of three different nitrogen-regulated promoter regions for the expression of glnB and glnA in Azospirillum brasilense.
Mol. Gen. Genet.
224:421-430[Medline].
|
| 10.
|
de Zamaroczy, M.,
A. Paquelin, and C. Elmerich.
1993.
Functional organization of the glnB-glnA cluster of Azospirillum brasilense.
J. Bacteriol.
175:2507-2515[Abstract/Free Full Text].
|
| 11.
|
de Zamaroczy, M.,
A. Paquelin,
G. Pletre,
K. Forchhammer, and C. Elmerich.
1996.
Coexistence of two structurally similar but functionally different PII proteins in Azospirillum brasilense.
J. Bacteriol.
178:4143-4149[Abstract/Free Full Text].
|
| 12.
|
Flores, E., and A. Herrero.
1994.
Assimilatory nitrogen metabolism and its regulation, p. 487-517.
In
D. A. Bryant (ed.), The molecular biology of cyanobacteria. Kluwer Academic Publishers, Dordrecht, The Netherlands.
|
| 13.
|
Forchhammer, K., and A. Hedler.
1997.
Phosphoprotein PII from cyanobacteria. Analysis of functional conservation with the PII signal-transduction protein from Escherichia coli.
Eur. J. Biochem.
244:869-875[Medline].
|
| 14.
|
Forchhammer, K., and N. Tandeau de Marsac.
1994.
The PII protein in the cyanobacterium Synechococcus sp. strain PCC 7942 is modified by serine phosphorylation and signals the cellular N-status.
J. Bacteriol.
176:84-91[Abstract/Free Full Text].
|
| 15.
|
Forchhammer, K., and N. Tandeau de Marsac.
1995.
Functional analysis of the phosphoprotein PII (glnB gene product) in the cyanobacterium Synechococcus sp. strain PCC 7942.
J. Bacteriol.
177:2033-2040[Abstract/Free Full Text].
|
| 16.
|
Forchhammer, K., and N. Tandeau de Marsac.
1995.
Phosphorylation of the PII protein (glnB gene product) in the cyanobacterium Synechococcus sp. strain PCC 7942: analysis of in vitro kinase activity.
J. Bacteriol.
177:5812-5817[Abstract/Free Full Text].
|
| 17.
|
Foster-Hartnett, D., and R. G. Kranz.
1994.
The Rhodobacter capsulatus glnB gene is regulated by NtrC at tandem rpoN-independent promoters.
J. Bacteriol.
176:5171-5176[Abstract/Free Full Text].
|
| 18.
|
Frías, J. E.,
E. Flores, and A. Herrero.
1994.
Requirement of the regulatory protein NtcA for the expression of nitrogen assimilation and heterocyst development genes in the cyanobacterium Anabaena sp. PCC 7120.
Mol. Microbiol.
14:823-832[Medline].
|
| 19.
|
Frías, J. E.,
E. Flores, and A. Herrero.
1997.
Nitrate assimilation gene cluster from the heterocyst-forming cyanobacterium Anabaena sp. strain PCC 7120.
J. Bacteriol.
179:477-486[Abstract/Free Full Text].
|
| 20.
|
Frías, J. E.,
A. Mérida,
A. Herrero,
J. Martín-Nieto, and E. Flores.
1993.
General distribution of the nitrogen control gene ntcA in cyanobacteria.
J. Bacteriol.
175:5710-5713[Abstract/Free Full Text].
|
| 21.
|
Garcia-Dominguez, M., and F. J. Florencio.
1997.
Nitrogen availability and electron transport control the expression of glnB gene (encoding PII protein) in the cyanobacterium Synechocystis sp. PCC 6803.
Plant Mol. Biol.
35:723-734[Medline].
|
| 22.
|
Harano, Y.,
I. Suzuki,
S.-I. Maeda,
T. Kaneko,
S. Tabata, and T. Omata.
1997.
Identification and nitrogen regulation of the cyanase gene from the cyanobacteria Synechocystis sp. strain PCC 6803 and Synechococcus sp. strain PCC 7942.
J. Bacteriol.
179:5744-5750[Abstract/Free Full Text].
|
| 23.
|
Irmler, A.,
S. Sanner,
H. Dierks, and K. Forchhammer.
1997.
Dephosphorylation of the phosphoprotein PII in Synechococcus PCC 7942: identification of an ATP and 2-oxoglutarate-regulated phosphatase activity.
Mol. Microbiol.
26:81-90[Medline].
|
| 24.
|
Jiang, F.,
B. Mannervik, and B. Bergman.
1997.
Evidence for redox regulation of the transcription factor NtcA, acting both as an activator and a repressor, in the cyanobacterium Anabaena PCC 7120.
Biochem. J.
327:513-517.
|
| 25.
|
Johansson, M., and S. Nordlund.
1996.
Transcription of the glnB and glnA genes in the photosynthetic bacterium Rhodospirillum rubrum.
Microbiology
142:1265-1272[Abstract/Free Full Text].
|
| 26.
|
Kikuchi, H.,
M. Aichi,
I. Suzuki, and T. Omata.
1996.
Positive regulation by nitrite of the nitrate assimilation operon in the cyanobacteria Synechococcus sp. strain PCC 7942 and Plectonema boryanum.
J. Bacteriol.
178:5822-5825[Abstract/Free Full Text].
|
| 27.
|
Lee, H. M.,
E. Flores,
A. Herrero,
J. Houmard, and N. Tandeau de Marsac.
1998.
A role for the signal transduction protein PII in the control of nitrate/nitrite uptake in a cyanobacterium.
FEBS Lett.
427:291-295[Medline].
|
| 28.
|
Liotenberg, S.,
D. Campbell,
R. Rippka,
J. Houmard, and N. Tandeau de Marsac.
1996.
Effect of the nitrogen source on phycobiliprotein synthesis and cell reserves in a chromatically adapting filamentous cyanobacterium.
Microbiology
142:611-622[Abstract/Free Full Text].
|
| 29.
|
Liu, J., and B. Magasanik.
1993.
The glnB region of the Escherichia coli chromosome.
J. Bacteriol.
175:7441-7449[Abstract/Free Full Text].
|
| 30.
|
Luque, I.,
E. Flores, and A. Herrero.
1994.
Molecular mechanism for the operation of nitrogen control in cyanobacteria.
EMBO J.
13:2862-2869[Medline].
|
| 31.
|
Magasanik, B., and F. C. Neidhardt.
1987.
Regulation of carbon and nitrogen utilization, p. 1318-1325.
In
F. C. Neidhardt, J. L. Ingraham, K. B. Low, B. Magasanik, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella typhimurium: cellular and molecular biology. American Society for Microbiology, Washington, D.C.
|
| 32.
|
Markwell, M. A.,
S. M. Haas,
L. L. Bieber, and N. E. Tolbert.
1978.
A modification of the Lowry procedure to simplify protein determination in membrane and lipoprotein samples.
Anal. Biochem.
87:206-210[Medline].
|
| 33.
|
Marqués, S.,
A. Mérida,
P. Candau, and F. J. Florencio.
1992.
Light-mediated regulation of glutamine-synthetase activity in the unicellular cyanobacterium Synechococcus sp. PCC 6301.
Planta
187:247-253.
|
| 34.
|
Martin, G. B.,
M. F. Thomashow, and B. K. Chelm.
1989.
Bradyrhizobium japonicum glnB, a putative nitrogen-regulatory gene, is regulated by NtrC at tandem promoters.
J. Bacteriol.
171:5638-5645[Abstract/Free Full Text].
|
| 35.
|
Mérida, A.,
P. Candau, and F. J. Florencio.
1991.
Regulation of glutamine synthetase activity in the unicellular cyanobacterium Synechococcus sp. strain PCC 6803 by the nitrogen source: effect of ammonium.
J. Bacteriol.
173:4095-4100[Abstract/Free Full Text].
|
| 36.
|
Michel-Reydellet, N.,
N. Desnoues,
C. Elmerich, and P. A. Kaminski.
1997.
Characterization of Azorhizobium caulinodans glnB and glnA genes: involvement of the PII protein in symbiotic nitrogen fixation.
J. Bacteriol.
179:3580-3587[Abstract/Free Full Text].
|
| 37.
|
Moreno, S.,
E. J. Patriarca,
M. Chiurazzi,
R. Meza,
R. Defez,
A. Lamberti,
A. Riccio,
M. Iaccarino, and G. Espin.
1993.
Phenotype of a Rhizobium leguminosarum ntrC mutant.
Res. Microbiol.
143:161-171.
|
| 38.
|
Muro-Pastor, M. I.,
J. C. Reyes, and F. J. Florencio.
1996.
The NADP+-isocitrate dehydrogenase gene (icd) is nitrogen regulated in cyanobacteria.
J. Bacteriol.
178:4070-4076[Abstract/Free Full Text].
|
| 39.
|
Omata, T.
1995.
Structure, function and regulation of the nitrate transport system of the cyanobacterium Synechococcus sp. PCC7942.
Plant Cell Physiol.
36:207-213[Abstract/Free Full Text].
|
| 40.
|
Ramasubramanian, T. S.,
T. F. Wei, and J. W. Golden.
1994.
Two Anabaena sp. strain PCC 7120 DNA-binding factors interact with vegetative cell- and heterocyst-specific genes.
J. Bacteriol.
176:1214-1223[Abstract/Free Full Text].
|
| 41.
|
Reitzer, L.
1996.
Ammonia assimilation and the biosynthesis of glutamine, glutamate, aspartate, asparagine, L-alanine, and D-alanine, p. 391-407.
In
F. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella typhimurium: cellular and molecular biology, 2nd ed., vol. 1. American Society for Microbiology, Washington, D.C.
|
| 42.
|
Reyes, J. C.,
M. I. Muro-Pastor, and F. J. Florencio.
1997.
Transcription of glutamine synthetase genes (glnA and glnN) from the cyanobacterium Synechocystis sp. strain PCC 6803 is differently regulated in response to nitrogen availability.
J. Bacteriol.
179:2678-2689[Abstract/Free Full Text].
|
| 43.
|
Rippka, R., and M. Herdman.
1992.
Pasteur culture collection of cyanobacterial strains in axenic culture, p. 1-103.
In
Catalogue & Taxonomic Handbook, vol. I. Catalogue of Strains. Institut Pasteur, Paris, France.
|
| 44.
|
Suzuki, I.,
N. Horie,
T. Sugiyama, and T. Omata.
1995.
Identification and characterization of two nitrogen-regulated genes of the cyanobacterium Synechococcus sp. strain PCC 7942 required for maximum efficiency of nitrogen assimilation.
J. Bacteriol.
177:290-296[Abstract/Free Full Text].
|
| 45.
|
Tsinoremas, N. F.,
A. M. Castets,
M. A. Harrison,
J. F. Allen, and N. Tandeau de Marsac.
1991.
Photosynthetic electron transport controls nitrogen assimilation in cyanobacteria by means of posttranslational modification of the glnB gene product.
Proc. Natl. Acad. Sci. USA
88:4565-4569[Abstract/Free Full Text].
|
| 46.
|
Van Heeswijk, W. C.,
B. Stegeman,
S. Hoving,
D. Molenaar,
D. Kahn, and H. V. Westerhoff.
1995.
An additional PII in Escherichia coli: a new regulatory protein in the glutamine synthetase cascade.
FEMS Microbiol. Lett.
132:153-157[Medline].
|
| 47.
|
Van Heeswijk, W. C.,
S. Hoving,
D. Molenaar,
B. Stegeman,
D. Kahn, and H. V. Westerhoff.
1996.
An alternative PII protein in the regulation of glutamine synthetase in Escherichia coli.
Mol. Microbiol.
21:133-146[Medline].
|
| 48.
|
Vega-Palas, M. A.,
E. Flores, and A. Herrero.
1992.
NtcA, a global nitrogen regulator from the cyanobacterium Synechococcus that belongs to the Crp family of bacterial regulators.
Mol. Microbiol.
6:1853-1859[Medline].
|
| 49.
|
Wei, T. F.,
T. S. Ramasubramanian,
F. Pu, and J. W. Golden.
1993.
Anabaena sp. strain PCC 7120 bifA gene encoding a sequence-specific DNA-binding protein cloned by in vivo transcriptional interference selection.
J. Bacteriol.
175:4025-4035[Abstract/Free Full Text].
|
| 50.
|
Wray, L. V., Jr.,
M. R. Atkinson, and S. H. Fisher.
1994.
The nitrogen-regulated Bacillus subtilis nrgAB operon encodes a membrane protein and a protein highly similar to the Escherichia coli glnB-encoded PII protein.
J. Bacteriol.
176:108-114[Abstract/Free Full Text].
|
| 51.
|
Zinchenko, V.,
Y. Churin,
V. Shestopalov, and S. Shestakov.
1994.
Nucleotide sequence and characterization of the Rhodobacter sphaeroides glnB and glnA genes.
Microbiology
140:2143-2151[Abstract/Free Full Text].
|
Journal of Bacteriology, May 1999, p. 2697-2702, Vol. 181, No. 9
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Eisenhut, M., von Wobeser, E. A., Jonas, L., Schubert, H., Ibelings, B. W., Bauwe, H., Matthijs, H. C.P., Hagemann, M.
(2007). Long-Term Response toward Inorganic Carbon Limitation in Wild Type and Glycolate Turnover Mutants of the Cyanobacterium Synechocystis sp. Strain PCC 6803. Plant Physiol.
144: 1946-1959
[Abstract]
[Full Text]
-
Osanai, T., Tanaka, K.
(2007). Keeping in Touch with PII: PII-Interacting Proteins in Unicellular Cyanobacteria. Plant Cell Physiol
48: 908-914
[Abstract]
[Full Text]
-
Takatani, N., Omata, T.
(2006). Effects of PII Deficiency on Expression of the Genes Involved in Ammonium Utilization in the Cyanobacterium Synechocystis sp. Strain PCC 6803. Plant Cell Physiol
47: 679-688
[Abstract]
[Full Text]
-
Schwarz, R., Forchhammer, K.
(2005). Acclimation of unicellular cyanobacteria to macronutrient deficiency: emergence of a complex network of cellular responses. Microbiology
151: 2503-2514
[Abstract]
[Full Text]
-
Kloft, N., Rasch, G., Forchhammer, K.
(2005). Protein phosphatase PphA from Synechocystis sp. PCC 6803: the physiological framework of PII-P dephosphorylation. Microbiology
151: 1275-1283
[Abstract]
[Full Text]
-
Sugiyama, K., Hayakawa, T., Kudo, T., Ito, T., Yamaya, T.
(2004). Interaction of N-Acetylglutamate Kinase with a PII-Like Protein in Rice. Plant Cell Physiol
45: 1768-1778
[Abstract]
[Full Text]
-
Burillo, S., Luque, I., Fuentes, I., Contreras, A.
(2004). Interactions between the Nitrogen Signal Transduction Protein PII and N-Acetyl Glutamate Kinase in Organisms That Perform Oxygenic Photosynthesis. J. Bacteriol.
186: 3346-3354
[Abstract]
[Full Text]
-
Li, J.-H., Laurent, S., Konde, V., Bedu, S., Zhang, C.-C.
(2003). An increase in the level of 2-oxoglutarate promotes heterocyst development in the cyanobacterium Anabaena sp. strain PCC 7120. Microbiology
149: 3257-3263
[Abstract]
[Full Text]
-
Fadi Aldehni, M., Sauer, J., Spielhaupter, C., Schmid, R., Forchhammer, K.
(2003). Signal Transduction Protein PII Is Required for NtcA-Regulated Gene Expression during Nitrogen Deprivation in the Cyanobacterium Synechococcus elongatus Strain PCC 7942. J. Bacteriol.
185: 2582-2591
[Abstract]
[Full Text]
-
Palinska, K. A., Laloui, W., Bedu, S., Loiseaux-de Goer, S., Castets, A. M., Rippka, R., Tandeau de Marsac, N.
(2002). The signal transducer PII and bicarbonate acquisition in Prochlorococcus marinus PCC 9511, a marine cyanobacterium naturally deficient in nitrate and nitrite assimilation. Microbiology
148: 2405-2412
[Abstract]
[Full Text]
-
Tanigawa, R., Shirokane, M., Maeda, S.-i., Omata, T., Tanaka, K., Takahashi, H.
(2002). Transcriptional activation of NtcA-dependent promoters of Synechococcus sp. PCC 7942 by 2-oxoglutarate invitro. Proc. Natl. Acad. Sci. USA
99: 4251-4255
[Abstract]
[Full Text]
-
Meeks, J. C., Elhai, J.
(2002). Regulation of Cellular Differentiation in Filamentous Cyanobacteria in Free-Living and Plant-Associated Symbiotic Growth States. Microbiol. Mol. Biol. Rev.
66: 94-121
[Abstract]
[Full Text]
-
Vazquez-Bermudez, M. F., Paz-Yepes, J., Herrero, A., Flores, E.
(2002). The NtcA-activated amt1 gene encodes a permease required for uptake of low concentrations of ammonium in the cyanobacterium Synechococcus sp. PCC 7942. Microbiology
148: 861-869
[Abstract]
[Full Text]
-
Miller, S. R., Castenholz, R. W.
(2001). Ecological Physiology of Synechococcus sp. Strain SH-94-5, a Naturally Occurring Cyanobacterium Deficient in Nitrate Assimilation. Appl. Environ. Microbiol.
67: 3002-3009
[Abstract]
[Full Text]
-
Arcondeguy, T., Jack, R., Merrick, M.
(2001). PII Signal Transduction Proteins, Pivotal Players in Microbial Nitrogen Control. Microbiol. Mol. Biol. Rev.
65: 80-105
[Abstract]
[Full Text]
-
Herrero, A., Muro-Pastor, A. M., Flores, E.
(2001). Nitrogen Control in Cyanobacteria. J. Bacteriol.
183: 411-425
[Full Text]
-
Tanigawa, R., Shirokane, M., Maeda, S.-i., Omata, T., Tanaka, K., Takahashi, H.
(2002). Transcriptional activation of NtcA-dependent promoters of Synechococcus sp. PCC 7942 by 2-oxoglutarate invitro. Proc. Natl. Acad. Sci. USA
99: 4251-4255
[Abstract]
[Full Text]
Top
Abstract
Introduction
