Previous Article | Next Article 
Journal of Bacteriology, May 1999, p. 2802-2806, Vol. 181, No. 9
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
The Periplasmic Nitrate Reductase in
Pseudomonas sp. Strain G-179 Catalyzes the First Step
of Denitrification
Laura
Bedzyk,
Tao
Wang, and
Rick W.
Ye*
DuPont Central Research and Development,
Wilmington, Delaware 19880-0328
Received 23 October 1998/Accepted 26 February 1999
 |
ABSTRACT |
Both membrane-bound and periplasmic nitrate reductases have been
found in denitrifying bacteria. Yet the role of periplasmic nitrate
reductase in denitrification has not been clearly defined. To analyze
the function of the periplasmic nitrate reductase in Pseudomonas sp. strain G-179, the nap gene
cluster was identified and found to be linked to genes
involved in reduction of nitrite and nitric oxide and anaerobic heme
biosynthesis. Mutation in the nap region rendered
the cells incapable of growing under anaerobic conditions with nitrate
as the alternative electron acceptor. No nitrate reduction activity was
detected in the Nap
mutant, but that activity could be
restored by complementation with the nap region. Unlike the
membrane-bound nitrate reductase, the nitrate reduction activity in
strain G-179 was not inhibited by a low concentration of azide. Nor
could it use NADH as the electron donor to reduce nitrate or use
chlorate as the alternative substrate. These results suggest that the
periplasmic nitrate reductase in this strain plays a primary role in
dissimilatory nitrate reduction.
 |
INTRODUCTION |
The complete pathway for microbial
denitrification has been established as NO3
NO2
NO
N2O
N2 (26, 29). Denitrification normally occurs under oxygen-limiting conditions. It plays a major role in completing the nitrogen cycle by converting nitrate or nitrite to nitrogen gas. In
practical applications, microbial denitrification has been widely used
for wastewater treatment and water purification (16). On the
other hand, N2O has been shown to have detrimental effects
on the stratospheric ozone layer (10). Nitrogen oxides (NOx), along with CO and hydrocarbons, can lead to an increase in the
amount of tropospheric ozone. Thus, production of N2O and NO due to incomplete denitrification is of concern.
Two types of dissimilatory nitrate reductases have been found
in denitrifying bacteria. One is known as the respiratory
membrane-bound nitrate reductase and the other as the
periplasmic nitrate reductase (13, 29). The
membrane-bound enzyme has been studied in Pseudomonas aeruginosa (8), Paracoccus denitrificans
(6, 11), Pseudomonas stutzeri (7),
Pseudomonas fluorescens (18), and most
extensively in Escherichia coli (13). The
membrane-bound nitrate reductase consists of three polypeptides
,
, and
. The large subunit (
) contains the cofactor,
molybdopterin guanine dinucleotide, which is the active site of the
enzyme. The enzyme is anchored to the cytoplasmic membrane by
the
subunit. All three peptides are commonly encoded by the
narGHJI gene cluster. The periplasmic nitrate
reductase consists of two subunits, NapA and NapB (4, 5). NapA is the large subunit, which contains the
molybdenum cofactor and a [4Fe-4S] cluster. NapB is a
c-type cytochrome. NapC is presumably membrane bound and
functions as the electron transporter. The nap gene cluster
has been characterized in a number of denitrifying bacteria, including
Ralstonia eutropha (23) and P. denitrificans (5).
In addition to their differences in protein structure and gene
composition, the membrane-bound and the periplasmic nitrate reductases have unique biochemical properties. The
membrane-bound enzyme can reduce chlorate and use NADH as the
electron donor (2, 9). Its activity is inhibited by low
concentrations of azide. The periplasmic nitrate reductase is
not sensitive to low concentrations of azide and cannot reduce chlorate
or use NADH as the electron donor. Therefore, the two enzymatic
activities can be distinguished based on these properties.
Both membrane-bound and periplasmic nitrate reductases are
present in P. denitrificans (2). The
periplasmic enzyme is expressed aerobically as well as
anaerobically; however, the majority of the nitrate reduction activity
under anaerobic conditions is contributed by the membrane-bound enzyme.
It is proposed that the periplasmic nitrate reductase catalyzes
the first step of aerobic denitrification, since this organism is found
to be capable of aerobic denitrification. Mutation in the
membrane-bound nitrate reductase does not affect growth on nitrate
under anaerobic conditions, probably due to the presence of the
periplasmic enzyme (3). In fact, the expression of
the periplasmic nitrate reductase in this mutant is increased under anaerobic conditions. In R. eutropha, the
periplasmic nitrate reductase is not required for
denitrification and the NAP
mutant shows only a delay in
growth after transition from aerobic to anaerobic respiration
(23). It has been suggested that the periplasmic
nitrate reductase plays a role in that transition. It has also been
speculated that periplasmic nitrate reduction is used by
organisms to dispose of excess reducing power (19, 20). To
define the function of the periplasmic nitrate reductase in
Pseudomonas sp. strain G-179, the nap region was
characterized in this study. Both genetic and biochemical analyses
indicated that the periplasmic nitrate reductase was the
primary enzyme responsible for catalyzing the first step of
denitrification in this organism.
 |
MATERIALS AND METHODS |
Bacterial strains and plasmids.
Table
1 lists all the strains and plasmids used
in this study. The suicide plasmid pARO180 (17) used for
construction of insertion mutants was purchased from the American Type
Culture Collection.
Growth conditions.
Pseudomonas sp. strain G-179 was
grown in tryptic soy broth (TSB) at 28°C. The concentrations for both
rifampin and kanamycin were 50 µg/ml when used. The concentrations
for tetracycline were 3 and 12 µg/ml, respectively, for broth and
solid medium. To grow wild-type strain G-179 under denitrifying
conditions, potassium nitrate was added at a concentration of 1.5 g/liter. For mutant strain TW01 (NAP
), 5 mM sodium
nitrite was used for anaerobic growth. To introduce plasmid DNA into
the G-179 strain, triparental mating with pRK2013 as the helper was
performed. Conjugation was carried out on TSB plates at 28°C.
Exconjugants were selected on TSB plates with rifampin (50 µg/ml) and
kanamycin (50 µg/ml) or tetracyline (12 µg/ml), depending on the
plasmid used. For growth on nitrous oxide, TSB in a serum bottle was
saturated with nitrous oxide before inoculation, and the gas phase was
again filled with nitrous oxide after inoculation.
Determination of nitrate, nitrite, and chlorate
concentrations.
Ion chromatography (Dionex Corporation, Sunnyvale,
Calif.) using an IONPAC AS11-HC analytical column and an autosampler
was used to measure nitrate, nitrite, and chlorate. The eluent used was
NaOH at a concentration of 0.6 g/liter with a flow rate of 1.5 ml/min.
Detection and quantification are based on conductivity.
Measurement of nitrate reduction activity.
Whole-cell
nitrate reduction activity was measured with cells grown under
anaerobic conditions and with cells grown under microaerobic
conditions. To induce denitrification under microaerobic conditions, wild-type and mutant strains were grown in 1-liter flasks containing 600 ml of TSB medium supplemented with
potassium nitrate (1.5 g/liter). Flasks were shaken at 125 rpm. The
cells were washed with TSB medium till no nitrate or nitrite was
detected with a nitrate or nitrite strip (EM Science, Gibbstown, N.J.). Cell pellets were resuspended in 10 ml of TSB. An aliquot of 2 ml of
cell suspension was used for the whole-cell assay carried out in a
serum bottle filled with argon gas. Disappearance of nitrate or
appearance of nitrite was measured.
The assay for nitrate reductase activity with artificial electron
donors was modified from methods used previously (
7,
11).
The reaction mixture in 1 ml contained an enzyme sample,
200 µM
methyl viologen or benzyl viologen, 5 mM potassium nitrate,
and 50 mM
potassium phosphate buffer (pH 7.3). The reaction was
started with 50 µl of freshly prepared sodium dithionite solution
(16 mg/ml) in 0.8%
NaHCO
3. The reaction was stopped by adding
100-µl
aliquots into 0.9 ml of NaOH solution (0.6 g/liter), the
eluent for ion
chromatography. The reaction without sodium dithionite
was used as a
control.
Isolation of periplasmic proteins was based on the method
described for type-2 spheroplasts by Alefounder and Ferguson
(
1).
The EDTA concentration was increased to 5 mM. The
periplasmic
fraction was loaded onto a native gel without
dialysis. The native
gel was run at 4°C, and the nitrate reductase
activity was detected
by incubating the gel in 2-mg/ml methyl viologen
solution containing
50 mM Tris (pH 7.6) and 5 mM potassium
nitrate. Methyl viologen
was reduced by
dithionite.
Isolation of cosmid clones.
To identify the DNA region
responsible for reduction of nitrate, nitrite, and nitric oxide, the
DNA fragments with the Tn5 insertion from previously studied
mutant strains RTC07 and RTC13 (25) were isolated and used
to probe the DNA cosmid library of the wild-type G-179 strain. Genomic
DNA was isolated with the genomic DNA isolation kit from Qiagen (Santa
Clarita, Calif.). To construct the DNA library, the wild-type DNA was
partially digested with Sau3A and the fractions of >20 kb
in size were ligated into the BamHI site of the SuperCos 1 vector from Stratagene (Menasha, Wis.). To isolate DNA fragments with
Tn5 insertions, genomic DNA from mutant strains was digested
with EcoRI and BamHI and ligated into pUC18.
Positive clones were picked from Luria-Bertani plates containing 50 µg of kanamycin/ml. Inserts from these clones were labeled with the
nonradioactive DNA Labeling Kit from Boehringer Mannheim Biochemicals
(Indianapolis, Ind.). Colony hybridization was carried out with the
Chemiluminescent Detection Kit provided by the same company. A total of
three cosmid clones were isolated, and they all hybridized to the
nirK probe of G-179. Sequencing results revealed that
strains RTC07 and RTC13 had Tn5 inserted in the
nor region.
Construction of insertion mutant.
The 5.5-kb
KpnI-HindIII fragment containing the
napEFABC region was cloned into the pARO180 vector. An
internal SalI-BglII region was deleted and
replaced by a kanamycin resistance cassette. The construct was
introduced into the wild-type G-179 strain by conjugation. After 6 to
12 passes in TSB medium containing rifampin and kanamycin, colonies
with double crossovers were selected based on poor growth on
ampicillin-containing plates (500 µg/ml). Insertions were confirmed
by Southern blot analysis with the 5.5-kb
KpnI-HindIII fragment as a probe. The mutant
strain selected for detailed study was designated TW01.
Overexpression of NapA protein.
The DNA region containing
the napA gene was amplified by PCR. An NdeI site
was incorporated into the translational start site in the first primer
(5'-ACGTACGTACATATGACGGCAGAACTCACGCGGCGTGATGTGC-3'). A
six-histidine tail before the stop codon and a BamHI site
after the stop codon were introduced in the second primer
(5'-TACGGAT CCTCGAGTCAGTGATGGTGGTGATGGTGGGCGACGGGAAGGATCT TGACTGC-3').
The PCR product was cloned into the NdeI and
BamHI sites of the pET-21a(+) vector (Novagen, Madison,
Wis.), resulting in construct pNAPA. This plasmid was introduced into
Escherichia coli BL21(DE3) for overexpression. The NapA
protein with a His tag was primarily found in inclusion bodies after
isopropyl-
-D-thiogalactopyranoside induction. The
protein was purified with Ni-nitrilotriacetic acid spin columns under
denaturing conditions as described by the manufacturer (Novagen). The
NapA protein was further purified by cutting the protein band from a
sodium dodecyl sulfate-polyacrylamide gel electrophoresis gel. The
identity of NapA was verified by sequencing the N terminus. Polyclonal
antibody against the NapA protein was generated in rabbits by Cocalico
Biologicals, Inc. (Reamstown, Pa.).
Nucleotide sequence accession number.
The sequence reported
in Fig. 1 has been deposited in the GenBank database under accession
no. AF083948. The sequence for 16S rDNA (genes coding for rRNA) of
G-179 is under accession no. AF109171.
 |
RESULTS |
Gene organization of the DNA region containing
the nap gene cluster.
The structural
gene of Cu-type nitrite reductase (nirK) has been previously
isolated and characterized in Pseudomonas sp. strain G-179
(27). Sequence analysis of its downstream region in
this study revealed a nap gene cluster containing genes for the periplasmic nitrate reductase (Fig.
1). The first open reading frame (ORF) in
this cluster is the napE gene, which has been previously identified by comparing the nap gene cluster from P. denitrificans with the partial sequence upstream of the
nirK gene (5). The second ORF shows about 30%
identity with the ferredoxin-type electron transport protein NapF from
E. coli (12). Following napF is an ORF
that encodes a protein with 25% identity to the putative cytoplasmic protein NapD from P. denitrificans
(5). NapD and NapF have been found to be important for
optimal periplasmic nitrate reductase activity
(21). The derived protein product from the ORF after
napD is NapA, which has about 76% identity to the
large subunit of periplasmic nitrate reductase from
P. denitrificans. A conserved [4Fe-4S] binding motif
was found near the N terminus. In fact, the proposed
specificity-determining regions between these two proteins are very
similar, and the likely molybdenum ligand cysteine (cysteine-203 of the
NapA precursor in strain G-179) is conserved. The region containing
the first 30 amino acids is very hydrophobic and could serve as the
leader peptide. Hydropathy analysis indicated that the mature NapA was
hydrophilic, suggesting NapA of G-179 is located in the
periplasmic space, similar to the NapA protein of P. denitrificans. The NapB subunit of G-179 also appears to have a
leader peptide, and Ala-32 of the NapB precursor could be the
first residue of the mature protein. NapC has an N-terminal
membrane-spanning region, suggesting it is a membrane-anchored
cytochrome. A potential FNR box,
TTGATTTTCATCAA, was
located 85 bp upstream of the putative translational start site of
napE, indicating the napEFDABC cluster could be
regulated by an FNR-like regulator(s) under anaerobic conditions
(28).

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 1.
Organization of the gene clusters involved in reduction
of nitrate, nitrite, and nitric oxide. K, KpnI; B,
BamHI; Bg, BglII; H, HindIII; S,
SalI.
|
|
Interestingly, the
napEFDABC region is directly linked to
other DNA regions involved in denitrification (Fig.
1). The
hemN gene, which encodes the anaerobic coproporphyrinogen
III oxidase
for anaerobic heme biosynthesis, is located downstream of
nap.
Further downstream is the
norEFCBQD region
involved in nitric
oxide reduction. Beyond the
nor region
are three ORFs that, based
on sequence similarities, may encode
proteins involved in metal
uptake or transport
functions.
Mutation and complementation analysis of the nap
region.
The linkage of the nap region to other genes
involved in denitrification drew our attention to its possible
role in denitrification. To construct mutant with a deletion in the
nap region, a SalI-BglII fragment was replaced with a kanamycin resistance cassette from Tn5 (Fig. 1). The resulting mutant strain, TW01, showed no
growth with nitrate as the alternative electron acceptor under
denitrifying conditions. It could grow on nitrite, although there was a
slight decrease in growth rate compared to that of the wild type (data not shown). No nitrate reductase activity was detected in a
whole-cell assay when induced under microaerobic conditions in the
presence of nitrate (Table
2). The wild-type strain accumulated
nitrite in the growth medium. No nitrite accumulation, however, was
observed with TW01.
View this table:
[in this window]
[in a new window]
|
TABLE 2.
Accumulation of nitrite in the growth medium and the
whole-cell nitrate reduction activities of different strains grown
under microaerobic conditionsa
|
|
For complementation study, the 5.5-kb
KpnI-
HindIII fragment containing the
napFDABC region was cloned into pTJS75 under control
of the
lac promoter. The resulting construct, pNAP01, was
able
to restore the ability of strain TW01 to grow on nitrate as the
alternative electron acceptor (Fig.
1). Even though nitrate reductase
activity was found in the crude extract, the mutant strain with
NapC

construct pNAP02 could not grow on nitrate. This is
consistent
with the suggestion that NapC functions as the electron
transporter
for NapAB in vivo. Other constructs without a complete
nap region
also failed to complement TW01. These results
indicated that the
nap region was required for
dissimilatory nitrate reduction in
strain G-179.
Biochemical characterization of the nitrate reduction system.
Requirement of the nap region for dissimilatory nitrate
reduction suggested that the periplasmic nitrate reductase was
the primary enzyme carrying out dissimilatory nitrate reduction. To verify this hypothesis, the nitrate reduction system of strain G-179
was characterized based on effects of electron donors, azide sensitivity, and substrate specificity. Both membrane-bound and periplasmic nitrate reductases can use reduced benzyl viologen (BV+) and methyl viologen (MV+) as electron
donors (2, 9). Because BV+ is more permeable to
the cell membrane than MV+ in intact cells, presence of
membrane-bound nitrate reductase often results in a much higher
activity with BV+. In the whole-cell assay with the
wild-type strain, the nitrate reduction activities with
BV+ or MV+ as the electron donor were
similar (Table 3). No BV+- or
MV+-dependent activity was detected in the mutant
strain. When NADH was used as the electron donor in the crude
extract assay, no reduction of nitrate was observed. These
results suggest that the nitrate reduction activity was primarily due
to the periplasmic nitrate reductase.
View this table:
[in this window]
[in a new window]
|
TABLE 3.
Effects of artificial electron donors and azide on the
activity of nitrate reduction in wild-type
strain G-179a
|
|
At micromolar concentrations, azide inhibits the membrane-bound nitrate
reductase but has no effect on the periplasmic enzyme
(
2,
9). The BV
+-dependent nitrate reductase activity
in both whole cells and
crude extract was not inhibited by
40 µM azide (Table
3). No
chlorate reduction was detected
with either whole cells or crude
extract (data not shown). All these
results indicate that the
nitrate reduction system in the G-179 strain
had the typical biochemical
properties of periplasmic nitrate
reductase. Activities characteristic
of membrane-bound nitrate
reductase were not
detected.
Native gel and immunoblot analyses.
To confirm the presence of
a periplasmic nitrate reductase encoded by the nap
region, proteins from different subcellular fractions were isolated.
Nitrate reductase activity was visualized as a bleached area against a
dark blue background in a native gel with MV+ as the
electron donor. No activity band was found in the cytoplasmic fraction of the wild type (data not shown). A strong activity band was,
however, detected in the periplasmic fraction (Fig. 2A). In the membrane fraction, a weaker
band in the same location was also observed. No activity bands were
found with the mutant strain TW01 from periplasmic,
cytoplasmic, or membrane fractions.

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 2.
Detection of nitrate reductase from anaerobic cultures.
(A) Native gel. Lane 1, wild-type periplasmic fraction; lane 2, TW01 soluble fraction; lane 3, wild-type membrane fraction; lane 4, TW01 membrane fraction. All lanes contained 80 µg of protein. (B)
Western blot analysis using polyclonal antibody against the NapA
protein. Lane 1, molecular size standard; lane 2, wild-type
periplasmic proteins; lane 3, wild-type membrane proteins; lane
4, mutant TW01 total soluble proteins; lane 5, mutant TW01 total
membrane proteins.
|
|
To further confirm the identity of the nitrate reductase, the purified
NapA subunit was used to generate polyclonal antibody
for
immunoblot analysis. When the Western blot was developed with
the NapA
antibody, a positive protein band with a molecular size
of about 90 kDa
was detected in the wild-type periplasmic fraction
(Fig.
2B). A weak band corresponding to the same molecular size
was also
observed in the membrane fraction. This suggests that
a portion of the
periplasmic nitrate reductase was associated
with the membrane,
probably through static or hydrophobic interactions.
No positive band
was found in the cytoplasmic fraction (data not
shown). The
90-kDa positive band was also absent in all fractions
from the mutant
strain TW01. These results indicate that the
nap region
encodes a periplasmic nitrate reductase, consistent with
its
sequence similarity to other periplasmic nitrate
reductases.
Phylogenetic analysis.
To facilitate the comparison of
Pseudomonas sp. strain G-179 with other organisms which
may have the same biochemical properties in nitrate reduction, the 16S
rDNA sequence and fatty acid profiles were analyzed. The fatty
acid profile is similar to those of Agrobacterium tumefaciens and Achromobacter cycloclastes, another
unclassified denitrifier. In addition, both strain G-179 and
A. cycloclastes had small amounts of cyclopropane and
10-methyl-branched fatty acids. The 16S rDNA sequence of strain G-179
showed 97% similarity to that of Rhizobium galegae,
while the 16S rDNA sequence of A. cycloclastes was
more similar to Rhizobium fredii. The phylogenetic tree is presented in Fig. 3. This result
suggests that Pseudomonas sp. strain G-179 is likely a
Rhizobium species. Attempts to isolate either small plasmids
or megaplasmids from strain G-179 were not successful.

View larger version (11K):
[in this window]
[in a new window]
|
FIG. 3.
Phylogenetic analysis of Pseudomonas sp.
strain G-179. The phylogenetic tree was obtained by the clustal method
with DNASTAR software.
|
|
 |
DISCUSSION |
This study provides both genetic and biochemical evidence for the
requirement of periplasmic nitrate reductase in the first step
of denitrification in Pseudomonas sp. strain G-179. This finding brings a new perspective to our understanding of the mechanism of dissimilatory nitrate reduction in denitrifying bacteria. Here we
propose that there are two systems responsible for dissimilatory nitrate reduction in denitrifiers. The first system, represented by P. denitrificans, uses the membrane-bound nitrate
reductase as the primary enzyme for nitrate reduction, while the
periplasmic enzyme has only secondary functions, including
aerobic denitrification, transition to anaerobic respiration, or
dissipating excess reducing equivalents. In the second system,
represented by strain G-179, the periplasmic nitrate reductase
is required for the first step of denitrification. The status and
function of the membrane-bound nitrate reductase in this system
are unknown. The mechanism by which strain G-179 uses the
periplasmic nitrate reductase to gain energy is also
unclear. It has been shown, however, that Nir
mutants RTC22 and RTC23 can grow on nitrate (25),
suggesting dissimilatory reduction of nitrate in G-179 is an
energy-generating process.
The function of the NapC protein is required for the in vivo activity
of the periplasmic nitrate reductase (Fig. 1). Since the NapC
protein is membrane bound, the NapAB subunits may have a close contact
with the membrane or even associate with the membrane through static or
hydrophobic interactions. In fact, one of the similarities between the
membrane-bound nitrate reductase and the periplasmic enzyme is
that both systems have a membrane component to transport electrons. The
NarGH subunits are located in the cytoplasm and anchored to the
membrane through NarI (2, 14, 15, 29). On the other hand,
the dissimilatory nitrite reductase, the second enzyme in the
pathway, is often located in the periplasmic space in
many gram-negative denitrifiers. Thus, when a membrane-bound nitrate reductase is employed, a transport mechanism may be required for nitrate to cross the cytoplasmic membrane and for nitrite to return to the periplasmic space. If the periplasmic
nitrate reductase catalyzes the nitrate reduction, the entire reaction of denitrification can be completed in the periplasmic space.
The periplasmic nitrate reductase is ubiquitous in nature, and
its role may vary depending on the organism. Our observations in this
report point toward a need for further examination of the roles of both
periplasmic and membrane-bound nitrate reductases among
different denitrifying bacteria. During the preparation of this report,
the DNA sequence of the nap region from Rhodobacter sphaeroides f. sp. denitrificans was deposited in the
GenBank database (accession no. AF069545). It was indicated that the nap region in this organism was also required for
denitrification. If biochemical characterization substantiates that
finding, it would further strengthen the hypothesis that the
periplasmic nitrate reductase has a major role in this organism
as well. In addition, based on our preliminary results, the nitrate
reduction system in A. cycloclastes was not sensitive to a
low concentration of azide and showed little activity with chlorate.
This indicates that biochemical properties of the nitrate reduction
system observed with strain G-179 may not be unique. From an ecological
or evolutionary point of view, the distribution of denitrifying
bacteria with the periplasmic enzyme as the major nitrate
reductase warrants much closer examination. It has been shown that the
periplasmic nitrate reductase provides one of the important
mechanisms for aerobic nitrate reduction (2, 9).
Oxygen-insensitive nitrate respiration may make a significant and
previously unrecognized contribution to the flux from nitrate to
nitrite in oxic and micro-oxic environments (9). In
addition, aerobic nitrate reduction and aerobic denitrification may
have potential applications in water and industrial wastewater treatment.
 |
ACKNOWLEDGMENTS |
We thank Vasantha Nagarajan and Ethel Jackson for their strong
support to our research program in denitrification. We also thank
Roslyn Young for sequencing 16S rDNA of G-179.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Experimental
Station E328/148B, Route 141 and Henry Clay Rd., Wilmington, DE
19880-0328. Phone: (302) 695-1750. Fax: (302) 695-1829. E-mail:
rick.ye{at}usa.dupont.com.
 |
REFERENCES |
| 1.
|
Alefounder, P. R., and S. J. Ferguson.
1980.
The location of dissimilatory nitrite reductase and the control of dissimilatory nitrate reductase by oxygen in Paracoccus denitrificans.
Biochem. J.
192:231-240[Medline].
|
| 2.
|
Bell, L. C.,
D. J. Richardson, and S. J. Ferguson.
1990.
Periplasmic and membrane-bound respiratory nitrate reductases in Thiosphaera pantotropha.
FEBS Lett.
265:85-87[Medline].
|
| 3.
|
Bell, L. C.,
M. D. Page,
B. C. Berks,
D. J. Richardson, and S. J. Ferguson.
1993.
Insertion of transposon Tn5 into a structural gene of the membrane-bound nitrate reductase of Thiosphaera pantotropha results in anaerobic overexpression of periplasmic nitrate reductase activity.
J. Gen. Microbiol.
139:3205-3214[Abstract/Free Full Text].
|
| 4.
|
Berks, B. C.,
D. J. Richardson,
C. Robinson,
A. Reilly,
R. T. Aplin, and S. J. Ferguson.
1994.
Purification and characterization of the periplasmic nitrate reductase from Thiosphaera pantotropha.
Eur. J. Biochem.
220:117-124[Medline].
|
| 5.
|
Berks, B. C.,
D. J. Richardson,
A. Reilly,
A. C. Willis, and S. J. Ferguson.
1995.
The napEDABC gene cluster encoding the periplasmic nitrate reductase system of Thiosphaera pantotropha.
Biochem. J.
309:983-992.
|
| 6.
|
Berks, B. C.,
M. D. Page,
D. J. Richardson,
A. Reilly,
A. Cavill,
F. Outen, and S. J. Ferguson.
1995.
Sequence analysis of subunits of the membrane-bound nitrate reductase from a denitrifying bacterium: the integral membrane subunit provides a prototype for the dihaem electron-carrying arm of a redox loop.
Mol. Microbiol.
15:319-331[Medline].
|
| 7.
|
Blümle, S., and W. G. Zumft.
1991.
Respiratory nitrate reductase from denitrifying Pseudomonas stutzeri, purification, properties and target of proteolysis.
Biochim. Biophys. Acta
105:102-108.
|
| 8.
|
Carlson, C.,
L. P. Ferguson, and J. L. Ingraham.
1982.
Properties of dissimilatory nitrate reductase purified from the denitrifier Pseudomonas aeruginosa.
J. Bacteriol.
151:162-171[Abstract/Free Full Text].
|
| 9.
|
Carter, J. P.,
Y. H. Hsiao,
S. Spiro, and D. J. Richardson.
1995.
Soil and sediment bacteria capable of aerobic nitrate respiration.
Appl. Environ. Microbiol.
61:2852-2858[Abstract].
|
| 10.
|
Conrad, R.
1996.
Soil microorganisms as controllers of atmospheric trace gases.
Microbiol. Rev.
60:609-640[Abstract/Free Full Text].
|
| 11.
|
Craske, A., and S. J. Ferguson.
1986.
The respiratory nitrate reductase from Paracoccus denitrificans.
Eur. J. Bioichem.
158:429-436[Medline].
|
| 12.
|
Grove, J.,
S. Tanapongpipat,
G. Thomas,
L. Griffiths,
H. Crooke, and J. Cole.
1996.
Escherichia coli K-12 genes essential for the synthesis of c-type cytochromes and a third nitrate reductase located in the periplasm.
Mol. Microbiol.
19:467-481[Medline].
|
| 13.
|
Hille, R.
1996.
The mononuclear molybdenum enzymes.
Chem. Rev.
96:2757-2816[Medline].
|
| 14.
|
Jones, R. W.,
W. J. Ingledew,
A. Graham, and P. B. Garland.
1978.
Topography of nitrate reductase of the cytoplasmic membrane of Escherichia coli: the nitrate-reducing site.
Biochem. Soc. Trans.
6:1287-1289[Medline].
|
| 15.
|
Kristjansson, J. K., and T. C. Hollocher.
1979.
Substrate binding site for nitrate reductase of Escherichia coli is on the inner aspect of the membrane.
J. Bacteriol.
137:1227-1233[Abstract/Free Full Text].
|
| 16.
|
Mateju, V.,
S. Cizinska,
J. Krejci, and T. Janoch.
1992.
Biological water denitrification.
Enzyme Microb. Technol.
14:172-183.
|
| 17.
|
Parke, D.
1990.
Construction of mobilizable vectors derived from plasmids RP4, pUC18, and pUC19.
Gene
93:135-137[Medline].
|
| 18.
|
Philippot, L.,
A. Clays-Josserand,
R. Lensi,
I. Trinsoutreau,
P. Normand, and P. Potier.
1997.
Purification of the dissimilative nitrate reductase of Pseudomonas fluorescens and the cloning and sequencing of its corresponding genes.
Biochim. Biophys. Acta
1350:272-276[Medline].
|
| 19.
|
Potter, L., and J. Cole.
1998.
The periplasmic nitrate reductase of Escherichia coli a comparison with the Nap systems of other bacteria.
Biochem. Soc. Trans.
26:S217[Medline].
|
| 20.
|
Reyes, F.,
M. D. Roldán,
W. Klipp,
F. Castillo, and C. Moreno-Vivián.
1996.
Isolation of periplasmic nitrate reductase genes from Rhodobacter sphaeroides DSM 158: structural and functional differences among prokaryotic nitrate reductase.
Mol. Microbiol.
19:1307-1318[Medline].
|
| 21.
|
Reyes, F.,
M. Gavira,
F. Castillo, and C. Moreno-Vivián.
1998.
Periplasmic nitrate-reducing system of the phototrophic bacterium Rhodobacter sphaeroides DSM 158: transcriptional and mutational analysis of the napKEFDABC gene cluster.
Biochem. J.
331:897-904.
|
| 22.
|
Schmidhauser, T. J., and D. R. Helinski.
1985.
Regions of broad-host-range plasmid RK2 involved in replication and stable maintenance in nine species of gram-negative bacteria.
J. Bacteriol.
164:446-455[Abstract/Free Full Text].
|
| 23.
|
Siddiqui, R. A.,
U. Warnecke-Eberz,
A. Hengsberger,
B. Schneider,
S. Kostka, and B. Friedrich.
1993.
Structure and function of a periplasmic nitrate reductase in Alcaligenes eutrophus H16.
J. Bacteriol.
175:5867-5876[Abstract/Free Full Text].
|
| 24.
|
Tyson, K.,
R. Metheringham,
L. Griffiths, and J. Cole.
1997.
Characterization of Escherichia coli K-12 mutants defective in formate-dependent nitrite reduction, essential roles for hemN and the menFDBCE operon.
Arch. Microbiol.
168:403-411[Medline].
|
| 25.
|
Ye, R. W.,
B. A. Averill, and J. M. Tiedje.
1992.
Characterization of Tn5 mutants deficient in dissimilatory nitrite reduction in Pseudomonas sp. strain G-179, which contains a copper nitrite reductase.
J. Bacteriol.
174:6653-6658[Abstract/Free Full Text].
|
| 26.
|
Ye, R. W.,
B. A. Averill, and J. M. Tiedje.
1994.
Denitrification: production and consumption of nitric oxide.
Appl. Environ. Microbiol.
60:1053-1058[Free Full Text].
|
| 27.
|
Ye, R. W.,
M. R. Fries,
S. G. Serguei,
B. A. Averill, and J. M. Tiedje.
1993.
Characterization of the structural gene encoding a copper-containing nitrite reductase and homology of this gene to DNA from other denitrifiers.
Appl. Environ. Microbiol.
59:250-254[Abstract/Free Full Text].
|
| 28.
|
Ye, R. W.,
D. Haas,
J. O. Ka,
V. Krishnapillai,
A. Zimmermann,
C. Baird, and J. M. Tiedje.
1995.
Anaerobic activation of the entire denitrification pathway in Pseudomonas aeruginosa requires ANR, an analog of FNR.
J. Bacteriol.
177:3606-3609[Abstract/Free Full Text].
|
| 29.
|
Zumft, G. W.
1997.
Cell biology and molecular basis of denitrification.
Microbiol. Mol. Biol. Rev.
61:533-616[Abstract].
|
Journal of Bacteriology, May 1999, p. 2802-2806, Vol. 181, No. 9
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Bru, D., Sarr, A., Philippot, L.
(2007). Relative Abundances of Proteobacterial Membrane-Bound and Periplasmic Nitrate Reductases in Selected Environments. Appl. Environ. Microbiol.
73: 5971-5974
[Abstract]
[Full Text]
-
Palmer, K. L., Brown, S. A., Whiteley, M.
(2007). Membrane-Bound Nitrate Reductase Is Required for Anaerobic Growth in Cystic Fibrosis Sputum. J. Bacteriol.
189: 4449-4455
[Abstract]
[Full Text]
-
Sohaskey, C. D., Wayne, L. G.
(2003). Role of narK2X and narGHJI in Hypoxic Upregulation of Nitrate Reduction by Mycobacterium tuberculosis. J. Bacteriol.
185: 7247-7256
[Abstract]
[Full Text]
-
Delgado, M. J., Bonnard, N., Tresierra-Ayala, A., Bedmar, E. J., Muller, P.
(2003). The Bradyrhizobium japonicum napEDABC genes encoding the periplasmic nitrate reductase are essential for nitrate respiration. Microbiology
149: 3395-3403
[Abstract]
[Full Text]
-
Sheehan, B. J., Bosse, J. T., Beddek, A. J., Rycroft, A. N., Kroll, J. S., Langford, P. R.
(2003). Identification of Actinobacillus pleuropneumoniae Genes Important for Survival during Infection in Its Natural Host. Infect. Immun.
71: 3960-3970
[Abstract]
[Full Text]
-
Mesa, S., Bedmar, E. J., Chanfon, A., Hennecke, H., Fischer, H.-M.
(2003). Bradyrhizobium japonicum NnrR, a Denitrification Regulator, Expands the FixLJ-FixK2 Regulatory Cascade. J. Bacteriol.
185: 3978-3982
[Abstract]
[Full Text]
-
Chain, P., Lamerdin, J., Larimer, F., Regala, W., Lao, V., Land, M., Hauser, L., Hooper, A., Klotz, M., Norton, J., Sayavedra-Soto, L., Arciero, D., Hommes, N., Whittaker, M., Arp, D.
(2003). Complete Genome Sequence of the Ammonia-Oxidizing Bacterium and Obligate Chemolithoautotroph Nitrosomonas europaea. J. Bacteriol.
185: 2759-2773
[Abstract]
[Full Text]
-
Ellington, M. J. K., Richardson, D. J., Ferguson, S. J.
(2003). Rhodobacter capsulatus gains a competitive advantage from respiratory nitrate reduction during light-dark transitions. Microbiology
149: 941-948
[Abstract]
[Full Text]
-
Mesa, S., Velasco, L., Manzanera, M. E., Delgado, M. J., Bedmar, E. J.
(2002). Characterization of the norCBQD genes, encoding nitric oxide reductase, in the nitrogen fixing bacterium Bradyrhizobium japonicum. Microbiology
148: 3553-3560
[Abstract]
[Full Text]
-
Nogales, B., Timmis, K. N., Nedwell, D. B., Osborn, A. M.
(2002). Detection and Diversity of Expressed Denitrification Genes in Estuarine Sediments after Reverse Transcription-PCR Amplification from mRNA. Appl. Environ. Microbiol.
68: 5017-5025
[Abstract]
[Full Text]
-
Gavira, M., Roldan, M. D., Castillo, F., Moreno-Vivian, C.
(2002). Regulation of nap Gene Expression and Periplasmic Nitrate Reductase Activity in the Phototrophic Bacterium Rhodobacter sphaeroides DSM158. J. Bacteriol.
184: 1693-1702
[Abstract]
[Full Text]
-
Stewart, V., Lu, Y., Darwin, A. J.
(2002). Periplasmic Nitrate Reductase (NapABC Enzyme) Supports Anaerobic Respiration by Escherichia coli K-12. J. Bacteriol.
184: 1314-1323
[Abstract]
[Full Text]
-
Jain, R., Shapleigh, J. P.
(2001). Characterization of nirV and a gene encoding a novel pseudoazurin in Rhodobacter sphaeroides 2.4.3. Microbiology
147: 2505-2515
[Abstract]
[Full Text]
-
Barnett, M. J., Fisher, R. F., Jones, T., Komp, C., Abola, A. P., Barloy-Hubler, F., Bowser, L., Capela, D., Galibert, F., Gouzy, J., Gurjal, M., Hong, A., Huizar, L., Hyman, R. W., Kahn, D., Kahn, M. L., Kalman, S., Keating, D. H., Palm, C., Peck, M. C., Surzycki, R., Wells, D. H., Yeh, K.-C., Davis, R. W., Federspiel, N. A., Long, S. R.
(2001). Nucleotide sequence and predicted functions of the entire Sinorhizobium meliloti pSymA megaplasmid. Proc. Natl. Acad. Sci. USA
10.1073/pnas.161294798v1
[Abstract]
[Full Text]
-
Fischer, H.-M., Velasco, L., Delgado, M. J., Bedmar, E. J., Schären, S., Zingg, D., Göttfert, M., Hennecke, H.
(2001). One of Two hemN Genes in Bradyrhizobium japonicum Is Functional during Anaerobic Growth and in Symbiosis. J. Bacteriol.
183: 1300-1311
[Abstract]
[Full Text]
-
Sears, H. J., Sawers, G., Berks, B. C., Ferguson, S. J., Richardson, D. J.
(2000). Control of periplasmic nitrate reductase gene expression (napEDABC) from Paracoccus pantotrophus in response to oxygen and carbon substrates. Microbiology
146: 2977-2985
[Abstract]
[Full Text]
-
Richardson, D. J.
(2000). Bacterial respiration: a flexible process for a changing environment. Microbiology
146: 551-571
[Full Text]
-
Bernhard, M., Friedrich, B., Siddiqui, R. A.
(2000). Ralstonia eutropha TF93 Is Blocked in Tat-Mediated Protein Export. J. Bacteriol.
182: 581-588
[Abstract]
[Full Text]
-
Moreno-Vivián, C., Cabello, P., Martínez-Luque, M., Blasco, R., Castillo, F.
(1999). Prokaryotic Nitrate Reduction: Molecular Properties and Functional Distinction among Bacterial Nitrate Reductases. J. Bacteriol.
181: 6573-6584
[Full Text]
-
Barnett, M. J., Fisher, R. F., Jones, T., Komp, C., Abola, A. P., Barloy-Hubler, F., Bowser, L., Capela, D., Galibert, F., Gouzy, J., Gurjal, M., Hong, A., Huizar, L., Hyman, R. W., Kahn, D., Kahn, M. L., Kalman, S., Keating, D. H., Palm, C., Peck, M. C., Surzycki, R., Wells, D. H., Yeh, K.-C., Davis, R. W., Federspiel, N. A., Long, S. R.
(2001). From the Cover: Nucleotide sequence and predicted functions of the entire Sinorhizobium meliloti pSymA megaplasmid. Proc. Natl. Acad. Sci. USA
98: 9883-9888
[Abstract]
[Full Text]