Previous Article | Next Article 
Journal of Bacteriology, May 1999, p. 2966-2969, Vol. 181, No. 9
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Phosphorylation of HPr and Crh by HprK, Early Steps
in the Catabolite Repression Signalling Pathway for the
Bacillus subtilis Levanase Operon
Isabelle
Martin-Verstraete,1,*
Josef
Deutscher,2 and
Anne
Galinier3
Unité de Biochimie Microbienne, CNRS
URA 1300, Institut Pasteur, F-75724 Paris,1
Laboratoire de Génétique des Microorganismes,
INRA-CNRS ERS 567, F-78850 Thiverval-Grignon,2
and Institut de Biologie et Chimie des Protéines, CNRS
UPR 412, F-69367 Lyon Cedex 07,3 France
Received 22 December 1998/Accepted 17 February 1999
 |
ABSTRACT |
Carbon catabolite repression (CCR) of Bacillus subtilis
catabolic genes is mediated by CcpA and in part by P-Ser-HPr.
For certain operons, Crh, an HPr-like protein, is also implicated in
CCR. In this study we demonstrated that in ptsH1 crh1
and hprK mutants, expression of the lev operon
was completely relieved from CCR and that both P-Ser-HPr and
P-Ser-Crh stimulated the binding of CcpA to the cre
sequence of the lev operon.
 |
TEXT |
The main function of
histidine-containing protein (HPr) is to participate in the
phosphotransferase system (PTS)-catalyzed transport and phosphorylation
of carbohydrates. Being part of a phosphoenolpyruvate-dependent protein
phosphorylation chain, HPr is phosphorylated by enzyme I (EI) at His-15
(8) and transfers the phosphoryl group to the sugar-specific
EIIAs. In gram-positive bacteria, the phosphoryl carrier protein HPr is
also phosphorylated at a regulatory serine (Ser-46) by ATP and the HPr
kinase (HprK) (2, 7, 22). This ATP-dependent phosphorylation
regulates the induction and carbon catabolite repression (CCR) of
several catabolic genes (23). Replacement of Ser-46 with
alanine (ptsH1 mutation) prevents the ATP-dependent
phosphorylation of HPr and almost completely abolishes CCR of many
operons (3). However, several operons such as the
xyn, iol, and lev operons were not relieved or only partly relieved from CCR in the ptsH1
mutant (3, 6a, 18). Growth conditions were also found to
influence CCR in ptsH1 mutants, and operons which were
completely derepressed in minimal medium were only partly relieved from
CCR in complex medium (3).
In addition to HPr, an HPr-like protein called Crh (for "catabolite
repression HPr"), which was discovered during the Bacillus subtilis sequencing project and exhibits 45% sequence identity to
HPr, was suggested to participate in CCR (6a). Since His-15 of HPr is replaced by a glutamine in Crh, no
phosphoenolpyruvate-dependent, EI-catalyzed phosphorylation of Crh
could be detected. However, Crh becomes phosphorylated by ATP and the
metabolite-activated HprK at the conserved Ser-46 (6a, 7).
If the crh gene of a ptsH1 mutant was disrupted,
almost complete relief from CCR was observed for
-xylosidase,
inositol dehydrogenase, and levanase, indicating that both HPr and Crh
are implicated in CCR of the corresponding operons
(6a). In addition, HPr and Crh participate in
glucose-induced activation of ackA expression
(24).
Catabolite control protein A (CcpA), a member of the LacI-GalR family
of repressors, acts as a pleiotropic regulator of CCR in B. subtilis and binds to the cis-active operator sequences (cre, for "catabolite response element") (11, 12,
25). An interaction of P-Ser-HPr with CcpA has been demonstrated
in vitro (4, 13). The resulting complex binds specifically
to the cre sequences of the gnt, xyl,
and xyn operons and of the amyE gene (5, 6,
9, 14). P-Ser-Crh presumably also exerts its effect on CCR via
CcpA, since those operons, which were only slightly relieved from CCR
in a ptsH1 mutant, were similarly relieved from CCR in
ccpA and ptsH1 crh double mutants
(6a).
The levanase operon of B. subtilis (levDEFG-sacC)
encodes a fructose-specific PTS (lev-PTS) and the
extracellular levanase, which hydrolyzes fructose polymers and sucrose
(17). Expression of this operon is induced by fructose and
repressed by glucose (16). CCR of the B. subtilis
levanase operon seems to involve at least two mechanisms: one mediated
by phosphorylation of the transcriptional activator LevR by P-H15-HPr
observed in a constitutive background (levR8)
(19) and the other mediated by the repressor CcpA
(18). HPr and Crh are also involved in the CcpA-dependent CCR mechanism operative for the levanase operon (6a, 18). A
potential CcpA binding site, cre, was identified between the
12,
24 promoter and its upstream activating sequence, the target site for LevR, the specific activator of the operon (18).
In this study, we have confirmed the role of P-Ser-HPr and P-Ser-Crh
in CCR of the levanase operon by constructing a ptsH1 crh1
double mutant and by testing the interaction of the CcpA/P-Ser-HPr and
CcpA/P-Ser-Crh complexes with the cre sequence of the
levanase operon. We have also tested the involvement of HPr kinase in
the regulation of the levanase operon.
Ser-46 is the unique site of phosphorylation in Crh.
The site
of phosphorylation in Crh had been determined by mass spectroscopy to
be Ser-46 (6a). However, mass spectroscopy can fail to
detect minor phosphorylation sites. We therefore wanted to make sure
that Ser-46 represents the only site of phosphorylation in Crh. For
this purpose, a 250-bp DNA fragment containing either the
crh or crh1 allele was amplified by PCR with
chromosomal DNA of the ptsGHI deletion strain GM273
(3) or plasmid pRC17 (6a) and appropriate primers
containing an EcoRI site (3' end) or a BamHI site
(5' end). The EcoRI-BamHI fragments were cloned
into the expression vector pGEX-KT (10). Crh or CrhS46A
fused to glutathione S-transferase (GST) was expressed from
the resulting plasmids after transformation in E. coli NM522
and isopropyl-
-D-thiogalactopyranoside (IPTG) induction.
Protein purification was carried out as described by Hakes and Dixon
(10). Phosphorylation of GST-Crh and GST-CrhS46A was tested
in the presence of HprK as described by Galinier et al. (6a)
(Fig. 1). GST-Crh was phosphorylated by
[
-32P]ATP (Fig. 1, lane 2), while GST-CrhS46A was not
(lane 3), confirming that Ser-46 is the only site of HprK-catalyzed
phosphorylation in Crh.

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 1.
ATP-dependent phosphorylation of GST-Crh and
GST-CrhS46A. [ -32P]ATP and HprK were incubated
together with GST-Crh (lane 2) or GST-CrhS46A (lane 3). Lane 1 is the
control without GST-Crh or GST-CrhS46A. The phosphorylation reaction
was stopped by adding sample buffer to the assay mixtures before
loading them onto a sodium dodecyl sulfate-polyacrylamide gel. After
electrophoresis, the gel was treated for 5 min with boiling 16%
trichloroacetic acid before being dried and exposed to autoradiography
(Biomax MR; Kodak). Coomassie blue-stained gels on which the same
samples had been loaded revealed a single band for HPr and Crh (data
not shown).
|
|
P-Ser-Crh participates in CCR of the levanase operon.
Similar
to the situation for a ccpA mutant, CCR of the levanase
operon was abolished in a ptsH1
crh::aphA3 double mutant (6a). Crh
was therefore assumed to carry out its function in CCR via interaction
of phosphorylated Crh with CcpA. To test this hypothesis, a chromosomal
crh1 mutant was constructed by using a pHT315 derivative (1) carrying the crh1 allele and part of the
downstream yvcN gene (pRC23, Fig.
2). A kanamycin resistance cassette was
introduced into yvcN, giving plasmid pRC33 (Fig. 2). This
plasmid was linearized with PstI and used to transform
QB5081 (levD'-'lacZ) and QB7148 (ptsH1
levD'-'lacZ). Cotransformation of the crh1 allele with the kanamycin resistance cassette allowed us to isolate Kmr
and Ems clones containing the crh1 allele
(QB7158) or both the ptsH1 and crh1 mutations
(QB7159). The presence of the mutations was confirmed by sequencing
appropriate PCR products of these strains. Expression of the
levD'-'lacZ fusion in the wild-type QB5081 and the
crh1 mutant QB7158 was decreased 13- and 10-fold,
respectively, by the addition of glucose (Table
1). A 4.5-fold repression was observed in
the ptsH1 mutant, whereas the ptsH1 crh1 double
mutant was almost completely relieved from CCR (1.5-fold repression). These results suggest that CCR of the levanase operon is mediated via
phosphorylation of HPr and Crh at Ser-46. However, under the experimental conditions used, HPr can completely replace Crh in CCR of
the lev operon whereas Crh can only partly substitute for HPr, since a ptsH1 mutant is partially relieved from CCR.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 2.
Construction and restriction map of plasmids used in
this study. A 1-kb DNA fragment containing the crh1 allele
and part of yvcN was cloned between the BamHI and
EcoRI sites of pHT315 (1) to give plasmid pRC23.
A 1.5-kb ClaI DNA fragment containing the kanamycin
resistance gene aphA3 was inserted in yvcN at the
unique BstBI restriction site, providing plasmid pRC33.
Plasmid pRC35 was constructed as follows. An
EcoRI-ClaI and a ClaI-BamHI
fragment, corresponding to the 5' and 3' ends of hprK,
respectively, were amplified by PCR. These two fragments were cloned
into the integrative vector pJH101 digested with EcoRI and
BamHI, thus reconstituting an hprK gene deleted
from codons 26 to 232. pRC37 was obtained by insertion of the 1.5-kb
kanamycin cassette into the newly created ClaI site of
hprK.
|
|
Both HPr and Crh are phosphorylated by ATP and HprK (6a, 7).
The B. subtilis hprK (former yvoB) gene has
recently been identified (7, 22), and HprK was found to be
bifunctional, also catalyzing the dephosphorylation of P-Ser-HPr
(15). To confirm the importance of ATP-dependent HPr and Crh
phosphorylation for CCR of the levanase operon, we constructed an
hprK mutant by using plasmid pRC37 containing
hprK carrying a deletion from codons 26 to 232 and a
kanamycin resistance cassette inserted at the newly created
ClaI restriction site (Fig. 2). Plasmid pRC37 was cut with
ScaI and used to replace hprK in QB5081
(levD'-'lacZ) with the modified hprK. A
Kmr Cms clone (QB7160) was isolated, and the
presence of the kanamycin cassette in hprK was confirmed by
PCR. Similar to the situation for the ptsH1 crh1 double
mutant, expression of the levD'-'lacZ fusion in QB7160 was
reduced only 1.3-fold by glucose (Table 1), confirming that
ATP-dependent phosphorylation of HPr and Crh is part of the CCR signal
transduction pathway operative for the levanase operon. However, we
cannot exclude that in addition to the hprK mutation,
alterations in the expression of the downstream genes due to the
insertion of the kanamycin resistance cassette into hprK
might influence CCR.
Binding of the CcpA/P-Ser-HPr and CcpA/P-Ser-Crh complexes to the
lev cre sequence.
To completely understand the signal
transduction pathway in CCR of the levanase operon, we wanted to
investigate whether both P-Ser-HPr and P-Ser-Crh influence the binding
of CcpA to the lev cre sequence. P-Ser-HPr has been
demonstrated to interact in vitro with CcpA (4, 13), and the
resulting protein complex binds specifically to the cre
sequences of the gnt, xyn, and xyl
operons and of the amyE gene (5, 6, 9, 14). To
test whether P-Ser-Crh can also interact with CcpA and allow specific
binding of CcpA to the lev cre sequence, we performed DNase
I footprinting experiments. A 178-bp fragment containing the
lev promoter region (from positions
148 to +30) was 3'-end
labelled with [
-32P]dATP at the EcoRI site.
The assay mixture contained 10 mM HEPES (pH 7.6), 1 mM
MgCl2, 200 mM KCl, 0.1 mM EDTA, 1 mM dithiothreitol, 10%
glycerol, 50 µg of poly(dI-dC)-(dI-dC) per ml as the bulk carrier
DNA, the radioactive DNA probe (100,000 cpm), 2.5 µM CcpA, and 10 µM HPr, P-Ser-HPr, Crh, or P-Ser-Crh. After a 15-min incubation at
room temperature, 2 ng of bovine pancreatic DNase I (Worthington) was
added to the assay mixture, which was incubated for a further 60 s
at room temperature. DNase I digestion was terminated by adding stop
solution (final concentration, 2.5 mM EDTA, 0.4 M sodium acetate, and
50 µg of calf thymus DNA) and subjecting the mixture to phenol
extraction. All the proteins were purified on Ni-nitrilotriacetate-agarose columns, and HPr(His)6 and
Crh(His)6 were phosphorylated by HprK(His)6 in
the presence of ATP as described by Galinier et al. (6a, 7).
Under these conditions, HPr and Crh were about 90% phosphorylated.
After phosphorylation, HprK was inactivated by keeping the assay
mixture for 10 min at 80°C.
The results of the DNase I footprinting experiments are presented in
Fig. 3. In the presence of either
P-Ser-HPr or P-Ser-Crh, CcpA specifically recognized the lev
cre sequence (Fig. 3, lanes 4 and 7, respectively). This
interaction was not observed with HPr or Crh (data not shown) or when
CcpA, CcpA and HPr, or CcpA and Crh were present in the assay mixture
(lanes 2, 3, and 6, respectively). The slightly increased protection in
the presence of CcpA and HPr or of CcpA and Crh appears to be
nonspecific, since it affects the total DNA (lanes 3 and 6). By
contrast, the region strongly protected in the presence of CcpA and
P-Ser-HPr or of CcpA and P-Ser-Crh
(AAATAACAACAATGAAAACGCTTAACACAA) (lanes 4 and 7) contains the presumed cre-like sequence (in
bold letters) located between positions
50 and
36 upstream of the promoter of the levanase operon (18). Moreover, sites of
hypersensitivity to DNase I digestion were observed only when CcpA and
either P-Ser-HPr or P-Ser-Crh were present in the reaction mixture.
The addition of 20 mM fructose-1,6-bisphosphate (FBP) did not modify
the binding of the CcpA protein in the presence of P-Ser-HPr or
P-Ser-Crh (lanes 5 and 8).

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 3.
DNase I footprinting experiments with the lev
cre sequence in the presence of CcpA, P-Ser-HPr, and P-Ser-Crh.
A 178-bp EcoRI-PstI fragment (from positions
148 to +30) containing the lev promoter and the
cre sequence (from position 50 to 36) was labeled at the
3'-end as described in the text. DNA was digested with DNase I in the
absence of any protein (lane 1) or in the presence of 5 µM CcpA (lane
2); 2.5 µM CcpA and 10 µM HPr (lane 3), 2.5 µM CcpA and 10 µM
P-Ser-HPr (lane 4), 2.5 µM CcpA, 10 µM P-Ser-HPr, and 20 mM FBP
(lane 5), 2.5 µM CcpA and 10 µM Crh (lane 6), 2.5 µM CcpA and 10 µM P-Ser-Crh (lane 7), or 2.5 µM CcpA, 10 µM P-Ser-Crh, and 20 mM FBP (lane 8). The base-specific chemical cleavage reaction at
guanine and adenine (20) is shown in lane G+A. The
cre sequence is boxed, and the cre consensus
sequence is indicated. The bases protected against digestion by DNase I
are indicated by asterisks, while the sites of hyperdigestion by DNase
I are indicated by arrows.
|
|
Compared to the consensus cre sequence, the lev
cre sequence contains additional base pairs close to the 3' end.
In addition, most of the cre sequences were found to be
located either within the coding sequence of the corresponding gene or
close to the transcription start site (12). In the levanase
operon, the cre sequence (
50 to
36) is situated upstream
from the
12,
24 promoter. Binding of the CcpA/P-Ser-HPr or
CcpA/P-Ser-Crh complexes to the cre sequence located
between the LevR binding site (upstream activating sequence) and the
12,
24 promoter may influence the formation of the complex between
LevR and the RNA polymerase-
54 which is necessary for
melting the DNA and activating transcription. In this context, it is
interesting that binding of the CcpA/P-Ser-HPr or CcpA/P-Ser-Crh
complexes also caused significant alterations in the pattern of DNase I
digestion outside the cre sequence (Fig. 3), suggesting that
binding of CcpA to the lev cre sequence might induce changes
in the DNA structure.
CCR of the B. subtilis levanase operon seems to involve at
least two mechanisms: one mediated by the transcriptional activator LevR (19) and the other mediated by the repressor CcpA. The first CCR mechanism is based on activation of LevR by
P-His-HPr-dependent phosphorylation at His-585. In the presence of a
PTS sugar, the phosphoryl group of P-His-HPr is thought to be
preferentially used for sugar phosphorylation, leading to poor
phosphorylation of LevR. The reduced phosphorylation of LevR lowers its
transcriptional activator function and leads to slowed expression of
the levanase operon (19). The second CCR mechanism is based
on the interaction of P-Ser-HPr or P-Ser-Crh with CcpA. Under the
reaction conditions used, we observed similar binding affinities with
both complexes. In the case of the B. subtilis xyn operon, a
more detailed study had revealed that the CcpA/P-Ser-HPr complex is
more effective in protecting the xyn cre sequence
(6). The increased production of glycolytic intermediates
accompanying the rapid metabolism of a carbon source is thought to
activate HprK, which catalyzes the ATP-dependent phosphorylation of HPr
and Crh. P-Ser-HPr and P-Ser-Crh function as corepressors by
interacting with CcpA, the global regulator of CCR. They enable CcpA to
bind to the lev cre sequence located between the
binding site of the transcriptional activator LevR and the
12,
24
promoter, thus preventing expression of the lev operon.
 |
ACKNOWLEDGMENTS |
We are grateful to G. Rapoport, in whose laboratory part of this
work was carried out, for continuous encouragement and critical reading
of the manuscript and to A. Kolb for helpful discussions.
This research was supported by the Ministère de l'Education
Nationale, de la Recherche et de la Technologie, the Centre National de
la Recherche Scientifique, the Institut National de la Recherche Agronomique, the Institut Pasteur, the Université de Lyon, and the Université Paris 7.
 |
FOOTNOTES |
*
Corresponding author. Present address: Unité de
Régulation de l'Expression Génétique, CNRS URA1129,
Institut Pasteur, F-75724 Paris, France. Phone: 33-1-45688445. Fax:
31-1-45688948. E-mail: iverstra{at}pasteur.fr.
 |
REFERENCES |
| 1.
|
Arantes, O., and D. Lereclus.
1991.
Construction of cloning vectors for Bacillus thuringiensis.
Gene
108:115-119[Medline].
|
| 2.
|
Deutscher, J., and M. H. Saier, Jr.
1983.
ATP-dependent protein kinase-catalyzed phosphorylation of a seryl residue in HPr, a phosphate carrier protein of the phosphotransferase system in Streptococcus pyogenes.
Proc. Natl. Acad. Sci. USA
80:6790-6794[Abstract/Free Full Text].
|
| 3.
|
Deutscher, J.,
J. Reizer,
C. Fischer,
A. Galinier,
M. H. Saier, Jr., and M. Steinmetz.
1994.
Loss of protein kinase-catalyzed phosphorylation of HPr, a phosphocarrier of the phosphostransferase system, by mutation of the ptsH gene confers catabolite repression resistance to several catabolic genes of Bacillus subtilis.
J. Bacteriol.
176:3336-3344[Abstract/Free Full Text].
|
| 4.
|
Deutscher, J.,
E. Küster,
U. Bergstedt,
V. Charrier, and W. Hillen.
1995.
Protein kinase-dependent HPr/CcpA interaction links glycolytic activity to carbon catabolite repression in Gram-positive bacteria.
Mol. Microbiol.
15:1049-1053[Medline].
|
| 5.
|
Fujita, Y.,
Y. Miwa,
A. Galinier, and J. Deutscher.
1995.
Specific recognition of the Bacillus subtilis gnt cis-acting catabolite-responsive element by a protein complex formed between CcpA and seryl-phosphorylated HPr.
Mol. Microbiol.
17:953-960[Medline].
|
| 6.
|
Galinier, A.,
J. Deutscher, and I. Martin-Verstraete.
1999.
Phosphorylation of either Crh or HPr mediates binding of CcpA to the xyn cre and catabolite repression of the Bacillus subtilis xyn operon.
J. Mol. Biol.
286:307-314[Medline].
|
| 6a.
|
Galinier, A.,
J. Haiech,
M. C. Kilhoffer,
M. Jaquinod,
J. Stülke,
J. Deutscher, and I. Martin-Verstraete.
1997.
The Bacillus subtilis crh gene encodes a HPr-like protein involved in carbon catabolite repression.
Proc. Natl. Acad. Sci. USA
94:8439-8444[Abstract/Free Full Text].
|
| 7.
|
Galinier, A.,
M. Kravanja,
R. Engelmann,
W. Hengstenberg,
M. C. Kilhoffer,
J. Deutscher, and J. Haiech.
1998.
New protein kinase and protein phosphatase families mediate signal transduction in bacterial catabolite repression.
Proc. Natl. Acad. Sci. USA
95:1823-1828[Abstract/Free Full Text].
|
| 8.
|
Gassner, M.,
D. Stehlik,
O. Schrecker,
W. Hengstenberg,
W. Maurer, and H. Rüterjans.
1977.
The phosphoenolpyruvate-dependent phosphotransferase system of Staphylococcus aureus. 2. 1H and 31P nuclear-magnetic-resonance studies on the phosphocarrier protein HPr, phosphohistidines and phosphorylated HPr.
Eur. J. Biochem.
75:287-296[Medline].
|
| 9.
|
Gösseringer, R.,
E. Küster,
A. Galinier,
J. Deutscher, and W. Hillen.
1997.
Cooperative and non-cooperative DNA binding modes of catabolite control protein CcpA from Bacillus megaterium result from sensing two different signals.
J. Mol. Biol.
266:665-676[Medline].
|
| 10.
|
Hakes, D. J., and J. E. Dixon.
1992.
New vectors for high level expression of recombinant proteins in bacteria.
Anal. Biochem.
202:293-298[Medline].
|
| 11.
|
Henkin, T. M.
1996.
The role of CcpA transcriptional regulator in carbon metabolism in Bacillus subtilis.
FEMS Microbiol. Lett.
135:9-15[Medline].
|
| 12.
|
Hueck, C. J.,
W. Hillen, and M. H. Saier, Jr.
1994.
Analysis of a cis-active sequence mediating catabolite repression in Gram-positive bacteria.
Res. Microbiol.
145:503-518[Medline].
|
| 13.
|
Jones, B. E.,
V. Dossonnet,
E. Küster,
W. Hillen,
J. Deutscher, and R. E. Klevit.
1997.
Binding of the catabolite repressor protein CcpA to its DNA target is regulated by phosphorylation of its corepressor HPr.
J. Biol. Chem.
272:26530-26535[Abstract/Free Full Text].
|
| 14.
|
Kim, J.-H.,
M. I. Voskuil, and G. H. Chambliss.
1998.
NADP, corepressor for the Bacillus catabolite control protein CcpA.
Proc. Natl. Acad. Sci. USA
95:9590-9595[Abstract/Free Full Text].
|
| 15.
|
Kravanja, M.,
R. Engelmann,
V. Dossonnet,
M. Blüggel,
H. E. Meyer,
R. Frank,
A. Galinier,
J. Deutscher,
N. Schnell, and W. Hengstenberg.
1999.
The hprK gene of Enterococcus faecalis encodes a novel bifunctional enzyme: the HPr kinase/phosphatase.
Mol. Microbiol.
31:59-66[Medline].
|
| 16.
|
Martin, I.,
M. Débarbouillé,
A. Klier, and G. Rapoport.
1989.
Induction and metabolite regulation of levanase synthesis in Bacillus subtilis.
J. Bacteriol.
171:1885-1892[Abstract/Free Full Text].
|
| 17.
|
Martin-Verstraete, I.,
M. Débarbouillé,
A. Klier, and G. Rapoport.
1990.
Levanase operon of Bacillus subtilis includes a fructose-specific phosphotransferase system regulating the expression of the operon.
J. Mol. Biol.
214:657-671[Medline].
|
| 18.
|
Martin-Verstraete, I.,
J. Stülke,
A. Klier, and G. Rapoport.
1995.
Two different mechanisms mediate catabolite repression of the Bacillus subtilis levanase operon.
J. Bacteriol.
177:6919-6927[Abstract/Free Full Text].
|
| 19.
|
Martin-Verstraete, I.,
V. Charrier,
A. Galinier,
J. Stülke,
B. Erni,
G. Rapoport, and J. Deutscher.
1998.
Antagonistic effects of dual PTS-catalysed phosphorylation on the Bacillus subtilis transcriptional activator LevR.
Mol. Microbiol.
28:293-303[Medline].
|
| 20.
|
Maxam, A. M., and W. Gilbert.
1980.
Sequencing end-labelled DNA with base-specific chemical cleavages.
Methods Enzymol.
65:499-560[Medline].
|
| 21.
|
Miller, J. H.
1972.
Experiments in molecular genetics, p. 352-355.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 22.
|
Reizer, J.,
C. Hoischen,
F. Titgemeyer,
C. Rivolta,
R. Rabus,
J. Stülke,
D. Karamata,
M. H. Saier, Jr., and W. Hillen.
1998.
A novel protein kinase that controls carbon catabolite repression in bacteria.
Mol. Microbiol.
27:1157-1169[Medline].
|
| 23.
|
Saier, M. H., Jr.
1996.
Cyclic AMP-independent catabolite repression in bacteria.
FEMS Microbiol. Lett.
138:97-103[Medline].
|
| 24.
|
Turinsky, A. J.,
F. J. Grundy,
J.-H. Kim,
G. H. Chambliss, and T. M. Henkin.
1998.
Transcriptional activation of the Bacillus subtilis ackA gene requires sequences upstream of the promoter.
J. Bacteriol.
180:5961-5967[Abstract/Free Full Text].
|
| 25.
|
Weickert, M. J., and G. H. Chambliss.
1990.
Site-directed mutagenesis of a catabolite repression operator sequence in Bacillus subtilis.
Proc. Natl. Acad. Sci. USA
87:6238-6242[Abstract/Free Full Text].
|
Journal of Bacteriology, May 1999, p. 2966-2969, Vol. 181, No. 9
0021-9193/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Abranches, J., Nascimento, M. M., Zeng, L., Browngardt, C. M., Wen, Z. T., Rivera, M. F., Burne, R. A.
(2008). CcpA Regulates Central Metabolism and Virulence Gene Expression in Streptococcus mutans. J. Bacteriol.
190: 2340-2349
[Abstract]
[Full Text]
-
Chaptal, V., Vincent, F., Gueguen-Chaignon, V., Monedero, V., Poncet, S., Deutscher, J., Nessler, S., Morera, S.
(2007). Structural Analysis of the Bacterial HPr Kinase/Phosphorylase V267F Mutant Gives Insights into the Allosteric Regulation Mechanism of This Bifunctional Enzyme. J. Biol. Chem.
282: 34952-34957
[Abstract]
[Full Text]
-
Goh, Y. J., Lee, J.-H., Hutkins, R. W.
(2007). Functional Analysis of the Fructooligosaccharide Utilization Operon in Lactobacillus paracasei 1195. Appl. Environ. Microbiol.
73: 5716-5724
[Abstract]
[Full Text]
-
Deutscher, J., Francke, C., Postma, P. W.
(2006). How Phosphotransferase System-Related Protein Phosphorylation Regulates Carbohydrate Metabolism in Bacteria. Microbiol. Mol. Biol. Rev.
70: 939-1031
[Abstract]
[Full Text]
-
Puri-Taneja, A., Paul, S., Chen, Y., Hulett, F. M.
(2006). CcpA Causes Repression of the phoPR Promoter through a Novel Transcription Start Site, PA6. J. Bacteriol.
188: 1266-1278
[Abstract]
[Full Text]
-
Lorca, G. L., Chung, Y. J., Barabote, R. D., Weyler, W., Schilling, C. H., Saier, M. H. Jr
(2005). Catabolite Repression and Activation in Bacillus subtilis: Dependency on CcpA, HPr, and HprK. J. Bacteriol.
187: 7826-7839
[Abstract]
[Full Text]
-
Choi, S.-K., Saier, M. H. Jr.
(2005). Regulation of sigL Expression by the Catabolite Control Protein CcpA Involves a Roadblock Mechanism in Bacillus subtilis: Potential Connection between Carbon and Nitrogen Metabolism. J. Bacteriol.
187: 6856-6861
[Abstract]
[Full Text]
-
Maze, A., Boel, G., Poncet, S., Mijakovic, I., Le Breton, Y., Benachour, A., Monedero, V., Deutscher, J., Hartke, A.
(2004). The Lactobacillus casei ptsHI47T Mutation Causes Overexpression of a LevR-Regulated but RpoN-Independent Operon Encoding a Mannose Class Phosphotransferase System. J. Bacteriol.
186: 4543-4555
[Abstract]
[Full Text]
-
Gorke, B., Fraysse, L., Galinier, A.
(2004). Drastic Differences in Crh and HPr Synthesis Levels Reflect Their Different Impacts on Catabolite Repression in Bacillus subtilis. J. Bacteriol.
186: 2992-2995
[Abstract]
[Full Text]
-
Warner, J. B., Magni, C., Lolkema, J. S.
(2003). CcpA-Independent Regulation of Expression of the Mg2+-Citrate Transporter Gene citM by Arginine Metabolism in Bacillus subtilis. J. Bacteriol.
185: 854-859
[Abstract]
[Full Text]
-
Hanson, K. G., Steinhauer, K., Reizer, J., Hillen, W., Stulke, J.
(2002). HPr kinase/phosphatase of Bacillus subtilis: expression of the gene and effects of mutations on enzyme activity, growth and carbon catabolite repression. Microbiology
148: 1805-1811
[Abstract]
[Full Text]
-
Muscariello, L., Marasco, R., De Felice, M., Sacco, M.
(2001). The Functional ccpA Gene Is Required for Carbon Catabolite Repression in Lactobacillus plantarum. Appl. Environ. Microbiol.
67: 2903-2907
[Abstract]
[Full Text]
-
Ould Ali, N., Bignon, J., Rapoport, G., Debarbouille, M.
(2001). Regulation of the Acetoin Catabolic Pathway Is Controlled by Sigma L in Bacillus subtilis. J. Bacteriol.
183: 2497-2504
[Abstract]
[Full Text]
-
Yoshida, K.-i., Kobayashi, K., Miwa, Y., Kang, C.-M., Matsunaga, M., Yamaguchi, H., Tojo, S., Yamamoto, M., Nishi, R., Ogasawara, N., Nakayama, T., Fujita, Y.
(2001). Combined transcriptome and proteome analysis as a powerful approach to study genes under glucose repression in Bacillus subtilis. Nucleic Acids Res
29: 683-692
[Abstract]
[Full Text]
-
Jankovic, I., Egeter, O., Brückner, R.
(2001). Analysis of Catabolite Control Protein A-Dependent Repression in Staphylococcus xylosus by a Genomic Reporter Gene System. J. Bacteriol.
183: 580-586
[Abstract]
[Full Text]
-
Zeng, X., Galinier, A., Saxild, H. H.
(2000). Catabolite repression of dra-nupC-pdp operon expression in Bacillus subtilis. Microbiology
146: 2901-2908
[Abstract]
[Full Text]
-
Dossonnet, V., Monedero, V., Zagorec, M., Galinier, A., Pérez-Martínez, G., Deutscher, J.
(2000). Phosphorylation of HPr by the Bifunctional HPr Kinase/P-Ser-HPr Phosphatase from Lactobacillus casei Controls Catabolite Repression and Inducer Exclusion but Not Inducer Expulsion. J. Bacteriol.
182: 2582-2590
[Abstract]
[Full Text]
-
Huynh, P. L., Jankovic, I., Schnell, N. F., Brückner, R.
(2000). Characterization of an HPr Kinase Mutant of Staphylococcus xylosus. J. Bacteriol.
182: 1895-1902
[Abstract]
[Full Text]
-
Jault, J.-M., Fieulaine, S., Nessler, S., Gonzalo, P., Di Pietro, A., Deutscher, J., Galinier, A.
(2000). The HPr Kinase from Bacillus subtilis Is a Homo-oligomeric Enzyme Which Exhibits Strong Positive Cooperativity for Nucleotide and Fructose 1,6-Bisphosphate Binding. J. Biol. Chem.
275: 1773-1780
[Abstract]
[Full Text]
-
Küster-Schöck, E., Wagner, A., Völker, U., Hillen, W.
(1999). Mutations in Catabolite Control Protein CcpA Showing Glucose-Independent Regulation in Bacillus megaterium. J. Bacteriol.
181: 7634-7638
[Abstract]
[Full Text]
-
Presecan-Siedel, E., Galinier, A., Longin, R., Deutscher, J., Danchin, A., Glaser, P., Martin-Verstraete, I.
(1999). Catabolite Regulation of the pta Gene as Part of Carbon Flow Pathways in Bacillus subtilis. J. Bacteriol.
181: 6889-6897
[Abstract]
[Full Text]
-
Martin-Verstraete, I., Galinier, A., Darbon, E., Quentin, Y., Kilhoffer, M.-C., Charrier, V., Haiech, J., Rapoport, G., Deutscher, J.
(1999). The Q15H mutation enables Crh, a Bacillus subtilis HPr-like protein, to carry out some regulatory HPr functions, but does not make it an effective phosphocarrier for sugar transport. Microbiology
145: 3195-3204
[Abstract]
[Full Text]