Previous Article | Next Article ![]()
Journal of Bacteriology, January 2000, p. 189-197, Vol. 182, No. 1
Department of Biochemistry and Virginia Tech
Center for Genomics, Virginia Polytechnic Institute and State
University, Blacksburg, Virginia 24061
Received 17 August 1999/Accepted 8 October 1999
Active Fe-superoxide dismutase (SodF) was the third most abundant
soluble protein in cells of Nostoc commune CHEN/1986 after prolonged (13 years) storage in the desiccated state. Upon rehydration, Fe-containing superoxide disumutase (Fe-SOD) was released and the
activity was distributed between rehydrating cells and the extracellular fluid. The 21-kDa Fe-SOD polypeptide was purified, the N
terminus was sequenced, and the data were used to isolate sodF from the clonal isolate N. commune DRH1.
sodF encodes an open reading frame of 200 codons and is
expressed as a monocistronic transcript (of approximately 750 bases)
from a region of the genome which includes genes involved in nucleic
acid synthesis and repair, including dipyrimidine photolyase
(phr) and cytidylate monophosphate kinase
(panC). sodF mRNA was abundant and stable in
cells after long-term desiccation. Upon rehydration of desiccated
cells, there was a turnover of sodF mRNA within 15 min and
then a rise in the mRNA pool to control levels (quantity of
sodF mRNA in cells in late logarithmic phase of growth)
over approximately 24 h. The extensive extracellular
polysaccharide (glycan) of N. commune DRH1 generated
superoxide radicals upon exposure to UV-A or -B irradiation, and these
were scavenged by SOD. Despite demonstrated roles for the glycan in the
desiccation tolerance of N. commune, it may in fact be a
significant source of damaging free radicals in vivo. It is proposed
that the high levels of SodF in N. commune, and release of
the enzyme from dried cells upon rehydration, counter the effects of
oxidative stress imposed by multiple cycles of desiccation and
rehydration during UV-A or -B irradiation in situ.
The drying of cells leads to
crowding of cytoplasmic components, condensation of the nucleoid, and
increases in the melting temperature (Tm) of
membrane phase transitions, and it imposes stresses upon cell walls
(31). Prolonged desiccation may cause damage to proteins,
nucleic acids, and membrane components through Maillard reactions and
metal-dependent Fenton reactions (17, 31). High photon flux
densities and UV irradiation exacerbate the effects of reactive oxygen
species in these processes. Mechanisms that protect cells from the
effects of desiccation include those which circumvent oxidative damage
(5, 7, 16). Of these, the synthesis of superoxide dismutase
(SOD) is an important response. SOD mediates the disproportionation of
superoxide radicals to hydrogen peroxide and dioxygen; the hydrogen
peroxide is then scavenged either by ascorbate peroxidase or catalase
(27). In many bacteria, SODs are present in the periplasmic
space and their synthesis is repressed under anaerobic conditions
(3, 15). Regulation of the expression of genes that encode
these periplasmic SODs, as well as genes involved in the synthesis of
other antioxidants, may be subject to control by the alternate sigma
factor RpoS (13, 15). Other mechanisms that cells use to
protect against oxidative damage from desiccation include the synthesis
of carotenoids and tocopherols (12, 38, 45) and anthocyanins
(in plants [43]).
Cyanobacteria must be especially prone to desiccation damage because
they evolve intracellular oxygen through photosynthesis and persist in
habitats subject to intense solar irradiation (32). In fact,
many terrestrial cyanobacteria withstand the most acute long-term water
deficit; how they do so is of considerable practical importance.
Cyanobacteria are known to use both Fe- and Mn-containing SODs (Fe- and
Mn-SODs) to scavenge superoxide radicals (11), but there is
a paucity of information on the roles of these enzymes in response to
water deficit. The sod genes of a number of cyanobacteria have been characterized. The genome of Synechocystis sp.
strain PCC 6803 contains a single SOD gene (sodB; slr1516
[22]); in contrast, Plectonema boryanum
UTEX 485 contains sodB as well as three additional Mn-SOD
genes (10). Results from studies with Synechococcus sp. strain PCC 7942, in which sodB
was inactivated, suggested that in this cyanobacterium Fe-SOD did not
protect photosystem II during oxidative stress but that it did protect
photosystem I. The enzyme was also able to protect cells from the
effects of chilling in the light (S. K. Herbert and D. J. Thomas, Abstr. VIth Cyanobacterial Workshop, abstr. S15, 1998).
The cyanobacterium Nostoc commune exhibits a marked
tolerance of desiccation and was the subject of a study that sought to identify structural, physiological, and molecular mechanisms which contribute to this tolerance (31). It is becoming clear that these mechanisms are both numerous and very diverse. Cells of N. commune CHEN/1986 contain sucrose and trehalose (18),
which contribute to a marked depression in the
Tm of membranes when these are desiccated and
rehydrated (20). In each case, the Tm
value is at least 20°C below the ambient temperature of the environment from which the materials were collected. Field colonies of
N. commune CHEN/1986 also elaborate a complex extracellular glycan which is secreted in copious amounts by liquid cultures of a
derivative strain, N. commune DRH1, and which lends a
spherical appearance to colonies grown on solid media (18).
The extracellular glycan has unusual rheological properties and can
prevent fusion of membrane vesicles at very low relative humidities
( In addition to trehalose, sucrose, and the glycan, significant amounts
of at least two major classes of UV-absorbing compounds provide
protection to colonies of N. commune (8, 18). The mycosporines (mycosporine-like amino acid derivatives or MAAs) are a
series of colorless, low-molecular-weight, water-soluble compounds with
a single absorption maximum within the solar UV-R range
(40). These MAAs constitute as much as 10% of the total dry
weight of desiccated colonies, and they are released and diffuse from
colonies upon rehydration (18). The MAAs in N. commune CHEN/1986 form strong interactions with a collection of
proteins, the water stress proteins (Wsp [41]), which
are also present in substantial amounts in desiccated colonies
(approximately 60% of the total soluble protein) and are released from
colonies upon rehydration (18).
The regulation of gene expression during desiccation and subsequent
rehydration is of considerable interest. One of the most obvious
features of gene expression in rehydrating N. commune is an
ordered, apparently stringent, recovery of metabolic functions, beginning with respiration and followed by photosynthesis and finally
nitrogen fixation (14, 33). The control of these processes is likely to be complex, given what is known about the sensing of other
environmental signals in less complex (morphologically) cyanobacteria
(42). Studies with field materials of N. commune HUN and N. commune UTEX 584 provided evidence that some, but
not all, proteins remain stable despite extended periods of desiccation (18, 41). Although the drying of N. commune UTEX
584 cells led to a rapid cessation of nitrogenase activity (33,
34), no evidence was obtained for hydrolysis of at least one
structural component of nitrogenase, Fe protein, which was present in
cells of N. commune HUN following 10 years of desiccation
(29). The intracellular ATP pool and the protein
biosynthetic machinery of desiccated cells remained unperturbed for 30 min and 2 h, respectively, after rapid drying at During our studies a marked accumulation of active Fe-SOD was found in
desiccated field materials of N. commune CHEN/1986 following
rehydration. We describe the biochemical characterization of the enzyme
and the isolation and structural characterization of sodF
from N. commune DRH1 and propose an unusual but otherwise significant role for SodF in the response to desiccation.
Cyanobacterial strains and growth conditions.
Desiccated
colonies of N. commune (Table
1) were collected from field localities
(19). All of these belong to one form species as determined
through group I intron analysis (data not shown). Colonies were kept
desiccated in the dark, for periods between 3 and 130 years, prior to
the analyses described here. The relative amounts of each sample were
determined, and the samples were used for particular experiments and
replicate trials. When necessary, desiccated cells were rehydrated with
sterile distilled water at room temperature in the light (see below);
rehydrated colonies were dried either passively over a period of
24 h or more rapidly under a forced stream of sterile air.
0021-9193/0/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Active Fe-Containing Superoxide Dismutase and
Abundant sodF mRNA in Nostoc commune
(Cyanobacteria) after Years of Desiccation
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
400 MPa) in the presence of a nonreducing sugar (20).
99.5 MPa
(1, 33, 34). In contrast, short-term drying led to
structural changes in the pigment antenna complexes of cyanobacteria,
the phycobilisomes. In the light, the phycobiliproteins were degraded,
and even in the dark, short-term drying led to subtle changes in the
polydispersity of the complexes when they were analyzed in sucrose
gradients (30, 41). De novo transcription in rehydrated
cells of N. commune UTEX 584 is directed by extant RNA
polymerase holoenzyme, which maintains its stability during
desiccation, at least long enough for some transcripts to accumulate to
control (predrying) levels (46).
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
TABLE 1.
Cyanobacterial strains
2 s
1. Desiccated colonies of
N. commune ENG/1996 were used in transcription and enzyme
analyses. Colonies were rehydrated in distilled water in shallow
suspensions contained in 14-cm-diameter petri dishes on a rotary shaker
operated at 70 rpm at room temperature. Banks of warm-white 15-W
fluorescent tubes, soft-white Duluz compact fluorescent 23-W bulbs
(Osram Sylvania Ltd., Mississauga, Canada), and a 365-nm UV source
(model 36-380 lamp; Spectronics Corporation, Westbury, N.Y.) provided a
continuous photon flux density of 2,500 µmol of photons
m
2 s
1 at the immediate surface of the cell
suspension (measured with a model QSL-100 quantum scalar irradiance
meter [Biospherical Instruments Inc., San Diego, Calif.]).
Purification and identification of SodF. Desiccated colonies of N. commune CHEN/1986 were used to isolate preparative amounts of SodF. To achieve efficient cell lysis, colonies were frozen under liquid nitrogen and ground to a powder with a pestle and mortar. The powder was mixed with sterile distilled water, and cells were allowed to rehydrate for 1 h at room temperature to allow the release of soluble proteins. Phycobiliproteins were removed by batch adsorption with Q-Sepharose (Pharmacia) resin equilibrated in 50 mM Tris · HCl (pH 7.5) buffer. After dialysis, the sample was concentrated with a 10-kDa-cutoff filter and the retentate, containing approximately 14 µg of total protein, was subjected to preparative sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (10%, wt/vol, gels) as described previously (18). Two major classes of soluble protein were resolved: the 27- to 39-kDa Wsp isoforms (41) and a protein with a prominent band at approximately 20 kDa. Proteins were transferred to Immobilon P membrane (Millipore) via Western blotting in CAPS (3-[cyclohexylamino]-1-propoanesulfonic acid) buffer at pH 10.4 in a Hoeffer transfer chamber and visualized with Coomassie brilliant blue as described previously (18). Protein, immobilized on an excised fragment of membrane, was subjected to automated Edman degradation with an Applied Biosystems model 477A protein sequencer.
Enzyme characterization. Aggregates of desiccated colonies of N. commune ENG/1996 were dispersed gently with a mortar and pestle at room temperature and suspended in sterile distilled water (0.6 g of desiccated cells in 30 ml of sterile distilled water). The suspended cells were incubated quiescently for 5 h in the dark at room temperature and then collected through centrifugation. The supernatant fraction (exudate) was dialyzed at 4°C in 50 mM potassium phosphate-0.1 mM EDTA (pH 7.8) buffer. The exudate at this point was colorless, and only a trace of color (blue; attributed to phycobiliprotein) was observed after subsequent concentration (see below). The cell pellet was resuspended in 6 ml of phosphate buffer, mixed with 0.6 g of alumina (Sigma type A-5), and ground in a mortar for 12 min. The initial slurry, with an additional 6 ml of phosphate buffer, was centrifuged, and the supernatant fraction (extract) was dialyzed in the phosphate buffer. The dialyzed extract and exudate were concentrated approximately fourfold under N2 (Amicon ultra filter, 10-kDa cutoff).
Protein concentration was measured by the bicinchoninic acid method (Pierce Chemical Co.) with bovine serum albumin as a standard. SOD activity was measured by monitoring the inhibition of O2
·-dependent reduction of ferricytochrome
c (25). Sodium azide, when present, was added to
the assay prior to initiation of the reaction with xanthine oxidase
(26). SOD activity was visualized in native polyacrylamide
tube gels as described by Salin and McCord (37).
Generation of O2
· from N. commune DRH1 glycan.
The complex extracellular
polysaccharide (glycan) of N. commune DRH1 was subjected to
exhaustive purification as described previously (20). The
glycan was sterilized through autoclaving and used either directly in
assays (preparation A) or after solvent extraction to remove
monosaccharides released upon autoclaving (preparation B). Glycan (0.9 ml, 10 mg ml
1) was added to a sterile petri dish and
mixed with 0.1 ml of 1 mM ferricytochrome c (final
concentration, 100 µM). The absorbance at 550 nm
(A550) was set to zero, and then the solution
was irradiated with a 0.6-A Fisher FBUVLS-150 UV-A and -B radiation
source with a spectral intensity maximum at 365 nm. The flux densities
at the surfaces of the glycan solutions were measured with digital radiometers (Spectronics Corporation, Westbury, N.Y.) and were 200 µW
cm
2 (UV-A) and 20 µW cm
2 (UV-B). The
A550 of the solution was measured at time
intervals over the course of 70 min. Either 70 or 140 U of bovine
erythrocyte Cu-Zn-SOD (1,400 U ml
1) or 1,000 U of bovine
liver catalase (14,000 U ml
1) was added to separate
aliquots of the glycan-ferricytochrome c solution
immediately prior to irradiation. Catalase was assayed by its rate of
disproportionation of H2O2, monitored at 245 nm (28). The enzymes were stored in 50 mM potassium
phosphate-0.1 mM EDTA (pH 7.8) prior to use.
DNA purification.
Cells of N. commune DRH1 were
harvested, lyophilized, and ground to a powder under liquid nitrogen.
The powder was rehydrated (approximately 1:1, powder-buffer) in
extraction buffer (100 mM Tris · HCl, 1.4 M NaCl, 20 mM EDTA,
1.5% [wt/vol] cetyltrimethylammonium bromide, 1% [vol/vol]
-mercaptoethanol [2]) at 65°C, frozen under
liquid nitrogen, and thawed again at 65°C. The cycle was repeated six
times. The mixture was extracted with chloroform-isoamyl alcohol (24:1)
and centrifuged, and the aqueous phase was mixed with an equal volume
of isopropanol. DNA was spooled, dried in air, rehydrated with a
minimal volume of Tris-EDTA buffer, and purified further through cesium
chloride buoyant-density ultracentrifugation.
Construction of gene libraries. Genomic DNA of N. commune DRH1 was digested partially with Sau3AI and ligated to Lambda Fix II arms prepared by a partial fill-in reaction with dTTP and dCTP after digestion with XhoI (Stratagene). Ligation reaction mixtures were packaged with Gigapack III XL (Stratagene) packaging extracts to select for inserts approximately 18 to 23 kb in size in recombinant phage grown on Escherichia coli XLI-Blue MRA (P2).
Purification of phage DNA. E. coli XLI-Blue MRA (P2) was infected with recombinant phage by standard protocols (44), and phage was recovered from plate lysates in SM buffer (50 mM Tris · HCl [pH 7.5], 100 mM NaCl, 8 mM MgSO4, 0.01% [wt/vol] gelatin). Phage DNA was recovered with the Wizards Lambda Preps DNA purification system (Promega Corporation).
Isolation and cloning of sodF. A 475-bp fragment of sodF was amplified from N. commune DRH1 genomic DNA by a PCR assay. Two 19-mer oligonucleotides were designed based upon a portion of the sequence (PYGMK) at the N-terminal region of N. commune DRH1 SodF (see Results). The two N-terminal oligonucleotides each had a redundancy of 1:64 and differed only in their 3'-terminal purine; the sequence of SODN-2A is 5'GGAA/GCCNTAT/CGGNATGAAA3' and the sequence of SODN-2G is 5'GGAA/GCCNTAT/CGGNATGAAG3'. Two C-terminal 20-mer oligonucleotides were synthesized based upon the reverse complement of the DNA that encodes the conserved sequence DVWEHAYY found in the carboxy-terminal region of Sod proteins. These two primers had a redundancy of 1:128 and differed only in their 3'-terminal purine; the sequence of SODI-2A is 5'AA/GTANGCA/GTGT/CTCCCANACA3' and that of SODI-2G is 5'AA/GTANGCA/GTGT/CTCCCANACG3'. All four possible permutations of these primers were tested. Assays were performed with 50-µl reaction mixtures in pH 9.0 buffer (supplied by the manufacturer, Promega Biotec) containing 12.5 nmol (250 µM) of each deoxynucleoside triphosphate, 1 mM MgCl, and 2.5 U of Taq polymerase (Promega Biotec). The annealing (90 s) temperature was at 60°C in the first cycle, dropped 1.5°C per cycle for the first 10 cycles (to 45°C), and was kept constant at 45°C for the remaining 30 cycles. In each cycle, denaturation occurred at 95°C for 1 min and elongation was at 72°C for 90 s. The assay began with a denaturation temperature of 95°C for 2 min and ended with an elongation time of 10 min.
Alkali-labile digoxigenin-11 (DIG)-dUTP (Boehringer Mannheim GmbH) was used to label the 457-bp sodF PCR product for use as a hybridization probe. In this case the concentrations of deoxynucleoside triphosphates were 250 µM each for dATP, dCTP, and dGTP; 130 µM for dTTP; and 70 µM for DIG-dUTP. The product was resolved in an agarose gel, excised, and purified with a Wizard PCR prep kit (Promega Corporation). The phage library was hybridized with the DIG-dUTP probe by using the buffer and protocols specified in the DIG Easy System manual (Boehringer Mannheim GmbH). Hybridization was overnight at 42°C, with washes first in 2× SSC (1× SSC is 0.15 M NaCl and 0.015 M trisodium citrate, pH 7.0)-0.1% (wt/vol) SDS and then at high stringency in 0.1× SSC-0.1% (wt/vol) SDS. Lambda DNA was purified from one phage isolate, and DNA sequencing was performed on an Applied Biosystems 377 Prism DNA sequencer, with the BigDye Terminator system of Perkin-Elmer Applied Biosystems and Taq DNA polymerase.Distribution of sodF in N. commune. The distribution of sodF was investigated in desiccated colonies of form species N. commune strains obtained from diverse geographic locations as described in the figure legends (Table 1). Two primers were designed to amplify a 427-bp fragment from within the coding region of N. commune DRH1 sodF (5'GAGTATCACTATGGCAAGCA3' and 5'CTAAAGTCAATGTAGTAG3'). Conditions of the PCR were as described above.
Transcription analysis.
Approximately 1 g of desiccated
colonies of N. commune ENG/1996 or rehydrated colonies which
were blotted dry quickly was frozen in liquid nitrogen and ground to a
powder. The powder was mixed with 1.5 ml of RNA extraction buffer (0.25 M sucrose, 0.2 M NaCl, 10 mM magnesium acetate, 0.1 M Tris · HCl
[pH 9.0]). After the addition of 1.5 ml of buffered phenol, the
mixture was sonicated at a setting of 30 (Fisher sonic dismembrator
model 300) three times for 15 s each time, with cooling on ice.
Glass beads (4-mm diameter) were added (1:1 ratio), and the slurry was
vortexed at top speed for 10 min. The aqueous phase was recovered
through centrifugation and extracted with an equal volume of
phenol-chloroform-isoamyl alcohol (25:24:1) multiple times until no
deposit remained at the interface. The aqueous phase was then extracted
with chloroform-isoamyl alcohol (24:1), mixed with 2 volumes of
ice-cold 100% (vol/vol) ethanol, and left at
20°C for several
hours. The precipitate was recovered, dissolved in 1.7 ml of diethyl
pyrocarbonate-treated water, mixed with an equivalent volume of 8 M
LiCl, and left overnight at 4°C. The pellet was washed with 70%
(vol/vol) ice-cold ethanol and stored in 70% (vol/vol) ethanol at
70°C until needed.
Nucleotide sequence accession number. The DNA sequence data reported here were deposited in GenBank and assigned the accession no. AF177945.
| |
RESULTS |
|---|
|
|
|---|
Identification of SodF in desiccated N. commune CHEN/1986. Soluble proteins of N. commune CHEN/1986 were obtained from desiccated colonies after one cycle of freezing and thawing through the addition of water. Resolution of proteins with SDS-polyacrylamide gels identified Wsp isoforms as well as a single prominent band at approximately 21 kDa (Fig. 1a). The 21-kDa protein was recovered, and the unambiguous sequence of the first 20 amino acids of SodF (lacking N-formylmethionine) was determined to be AFVQDPLPFDINALEPYGMK (Fig. 1a). Based on the relative amounts of Wsp proteins, which are the most abundant proteins in desiccated N. commune CHEN/1986 (41), and phycobiliproteins, SodF was judged to be the third most abundant soluble protein in materials of N. commune CHEN/1986 desiccated for 13 years (Fig. 1a).
|
SOD activity in vivo.
After identification of SodF, aliquots
of the retentate (see Materials and Methods) stored at
70°C for
approximately 1 month, as well as rehydrating cells of N. commune CHEN/1986, were subjected to enzyme assay. In each case
azide-inhibitable SOD activity was detected. In one well-controlled
experiment, azide-inhibitable SOD activity was distributed almost
equally between the rehydrating cells and the extracellular fluid
(~170 U g [dry weight]
1 in each fraction). However,
these experiments depleted the supply of desiccated N. commune CHEN/1986. Further experiments were therefore undertaken
with other, more abundant, desiccated materials and the readily
available clonal strain N. commune DRH1, which was derived
from N. commune CHEN/1986.
|
|
Cloning of sodF. Based upon published alignments of cyanobacterial Sod proteins (data not shown), PCR amplification was expected to generate an approximately 483-bp DNA fragment of sodF. A single prominent 475-bp product was obtained with N. commune DRH1 genomic DNA with primers SODN2A and SODI2A; a much less prominent band of equivalent size was produced with primers SODN2G and SODI2A (data not shown). The identity of the former product as a fragment of sodF was confirmed through DNA sequence analysis (data not shown).
Five positive plaques were isolated from the phage library, and an 18-kbp insert from one of these was sequenced partially. Sequence analysis (with specific primers through the technique of chromosome walking) identified an open reading frame of 200 codons corresponding to sodF (Fig. 3) and located 10 bases downstream of a putative ribosome-binding site (AGAGAGGA). The putative derived amino acid sequence of N. commune DRH1 SodF showed highest sequence similarity to SodF from the filamentous nonheterocystous cyanobacterium P. boryanum UTEX 485 (10). Because detailed alignments of SODs from many sources are published, a comparison of only these two cyanobacterial SODs is presented (Fig. 4). The proximal region upstream of sodF showed highest sequence identity with the region immediately downstream of narB in Anabaena sp. strain PCC 7120 (9). The proximal region downstream of sodF showed high sequence identity to the rbcL-rbcX intergenic region of Nostoc sp. strain NIVA-CYA 124 (36) as well as the region immediately downstream of argF (ornithine carbamoyl transferase) in Nostoc sp. strain PCC 73102 (21).
|
|
Distribution of sodF in N. commune. A single amplification product of approximately 427 bp was obtained with sodF-specific primers under stringent conditions of PCR from all strains tested (Fig. 1b), including the three strains (N. commune CHEN/1986, ENG/1996, and DRH1) which were used for the biochemical and enzymatic characterizations of SodF.
Expression of sodF in N. commune ENG/1996. Probing of RNA extracts from desiccated and rehydrating materials of N. commune ENG/1996, as well as liquid cultures of N. commune DRH1 in the late logarithmic phase of growth, identified a major transcript of around 750 bases. Two minor signals between 400 and 600 bases were detected (Fig. 5a, lanes 2, 3, 4 and C), but their resolution was varied in repeat trials. sodF mRNA was abundant in cells after 3 years of desiccation (Fig. 5a, lane 2) and remained so up to 15 min after the onset of rehydration (Fig. 5a, lanes 3 and 4). After this time the intensity of the signals diminished and then gradually increased over the next 24 h (Fig. 5a, lanes 5 through 9). The decrease in sodF mRNA after 15 min of rehydration accompanied an increase in the intensity of signals attributed to 23S rRNA that appeared to reach steady state after approx 3 h of rehydration (Fig. 5b). Multiple bands detected when we used the 23S rDNA probe may represent precursor and processed forms of one or more copies of 23S rRNA (1). The fluctuation in the amounts of sodF mRNA in cells, apparently according to their degree of hydration, raised the question of the variability in mRNA content within different colonies. However, the pattern was consistent in repeat trials with different samples of cells of N. commune ENG/1996; most notably, the depletion in sodf mRNA after 15 min of rehydration and the subsequent increase in the pool of sodF mRNA to controls levels after approximately 24 h were reproducible (data not shown). The patterns in the de novo synthesis of 23S rRNA in response to rehydration (Fig. 5c) were consistent when different samples of the desiccated colonies of N. commune ENG/1996 were used (data not shown).
|
Function of SodF in vivo.
In view of the release of
significant amounts of SodF upon cell rehydration, we questioned the
physiological relevance of this extracellular activity and the possible
role of the glycan, because there is some evidence that superoxide
radicals can lead to depolymerization of polysaccharides
(10). Ferricytochrome c was reduced in a
time-dependent fashion when it was irradiated with UV in the presence
of the glycan (Fig. 6). The rates of
ferricytochrome c reduction in the presence of glycan
preparation A (Fig. 6a) or glycan preparation B (Fig. 6b) were
approximately 150 × 10
3 min
1 and
80 × 10
3 min
1, respectively, in
comparison to the autoreduction rate in these experiments (20 × 10
3 min
1). Reduction of ferricytochrome
c was inhibited approximately 50% in the presence of SOD,
and the degrees of inhibition were equivalent when two different
concentrations of SOD were used (see Materials and Methods). Catalase
did not prevent the reduction of ferricytochrome c in this
system (Fig. 6).
|
| |
DISCUSSION |
|---|
|
|
|---|
Genetic mechanisms that contribute to desiccation tolerance remain
poorly understood. It was proposed, in view of the destructive effects
of oxygen, that genes involved in oxygen-scavenging mechanisms are
likely to be important in the responses of prokaryotes to air drying
(31). The quantities of active SodF in N. commune strains CHEN/1986 and ENG/1996, despite prolonged desiccation of cells,
suggest that SOD is an important component of the repair process of
this cyanobacterium. The fact that SodF remains active after such
long-term storage may suggest that the enzyme has structural features
which permit it to remain in the native state despite removal of most
of the water from the cells or that it may be sequestered in a
particular cell microenvironment. The amount of water in such
desiccated (anhydrobiotic) cells can be as small as 0.02 g g (dry
weight) of cells
1 in which proteins lack a monolayer
coverage of water (31, 32). However, not all proteins remain
stable under these conditions (30, 41).
SOD activity is located in extracellular fluids, such as synovial fluid (24), or the periplasmic space of E. coli (6) and other bacteria (3, 13, 15), and Nocardia asteroides synthesizes and secretes a SOD which adheres to the outer cell membrane (4). In each of these instances, SOD intercepts extracellular superoxide radicals and diminishes damage to the cell. In none of these examples, however, does the quantity of SOD released from the cells approach the magnitude of that released by rehydrating N. commune. This finding is all the more significant considering the time the cells were stored in a dormant state.
SodF does not have a recognizable N-terminal signal sequence, and microsequencing of the protein through Edman degradation confirmed that there was no processing at the N-terminal region in vivo. Three observations suggest that SodF is secreted in the exudate specifically, rather than via large-scale breakage of cells. First, the specific activity of extracellular Fe-SOD was significantly greater (fivefold in N. commune DRH-1) in the exudate than in the cell extract. Second, there was only a limited number of proteins observed upon electrophoretic examination of the exudate compared to the number present in the crude cell extract. Third, the exudate was colorless and carried only a faint tinge of color following concentration; i.e., there was an inverse correlation between the presence of phycobiliprotein (a sensitive indicator of cell lysis) and SodF activity distributed between the exudate and cell extract. The mechanism of release of SodF from N. commune is unknown, but it represents the third secretion event we have identified that may be of physiological relevance to rehydrating N. commune. Both the predominant acidic water stress proteins (Wsp) and the water-soluble UV-absorbing pigments (MAAs) are released in conspicuous amounts upon rehydration of desiccated cells in the absence of cell lysis (18, 19). A recent characterization of the wsp gene suggests that Wsp, like SodF, lacks an N-terminal signal sequence for secretion (data not shown).
It is reasonable to suspect that crowding and elevated salt concentrations within desiccated cells, as well as intense solar irradiation, contribute to the production of both intra- and extracellular superoxide radicals during rehydration as cells become metabolically active in an environment laced with organic compounds. Metabolic activity exacerbates the damage acquired during desiccation, because cells recover the capacity for photosynthesis and thus oxygen evolution (39).
Cells are metabolically inactive following dehydration and during subsequent storage in the dry state. Transcription analysis indicates that there is turnover of sodF mRNA immediately upon rewetting and that then sodF mRNA synthesis resumes. Although not directly measured, sodF mRNA synthesis must continue to be made and/or be stable as water is removed from cells (to account for the large amounts in all desiccated samples analyzed). The cells after 24 h of rehydration (Fig. 5a, lane 9) are in recovery phase, which may be equated with exponential growth. However, the system is complex. For example, in previous studies we demonstrated a sequential recovery of metabolic functions upon rehydration, beginning with respiration and followed by photosynthesis, etc. (for references, see reference 31). Nitrogen fixation is recovered after 24 h of rehydration. The fact that sodF mRNA is abundant after 24 h of rehydration emphasizes the possible importance of SodF during the recovery phase.
The extracellular glycan may be the primary potential source of damage
for rehydrating N. commune in view of its abundance, its
capacity to generate significant quantities of superoxide radicals upon
UV irradiation, and the fact that it completely envelops the cells and
makes intimate contact with the outer membrane (18,
19; in particular, see Fig. 1 in reference
20). Autoclaving the glycan leads to release of
ribose from the structure (data not shown) and thus an increase in the
concentration of free reducing ends. This finding is consistent with
the higher rate of ferricytochrome c reduction obtained with
glycan preparation A (Fig. 6a) and mediated through increased
O2
· generation. Again, this may be of
physiological relevance in situ, because the ribose linkage is labile,
and changes in the rheological properties of the glycan during growth
of the cells may involve release of ribose through enzyme hydrolysis
(data not shown). In situ, the UV-absorbing MAAs (especially in the presence of reducing sugars) may also be a source of superoxide; they
were largely removed during purification of the glycan for the
experiments described here. We therefore interpret the release of SodF
to be a beneficial biological response to rehydration of the desiccated
cells. During this upshift, cells must deal with damage accumulated
during desiccation and in part in response to UV radiation. There is
clear evidence that SODs can mediate such repair. For example,
Deinococcus radiodurans R1 is extremely resistant to
oxidative stress and sodA mutants of this organism are much
more sensitive to ionizing radiation than the wild type (23). The flux densities encountered by N. commune ENG/1996 in situ on a clear sunny day were measured as
2,150 and 300 µW cm
2 for UV-A and UV-B, respectively.
These values are an order of magnitude greater than those used in the
experiments with the purified glycan. The contribution of the glycan to
superoxide generation in situ may therefore be significant.
Although sodF is transcribed as a monocistronic transcript, its proximity to at least two genes involved in DNA repair and synthesis may suggest that this region of the genome of N. commune DRH1 functions as part of a global response to environmental stress.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by NSF grant IBN9513157 (M.P.) and DARPA grant N00173-98-1-G005 (M.P. and R.F.H.).
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Biochemistry, Virginia Polytechnic Institute and State University, Blacksburg, VA 24061. Phone: (540) 231-5745. Fax: (540) 231-9070. E-mail: geordie{at}vt.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Angeloni, S. V., and M. Potts.
1986.
Polysome turnover in immobilized cells of Nostoc commune (Cyanobacteria) exposed to water stress.
J. Bacteriol.
168:1036-1039 |
| 2. | Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl. 1992. Short protocols in molecular biology, 2nd ed., p. I-index 25. John Wiley and Sons, New York, N.Y. |
| 3. | Barnes, A. C., M. C. Balebona, M. T. Horne, and A. E. Ellis. 1999. Superoxide dismutase and catalase in Photobacterium damselae subsp. piscicida and their roles in resistance to reactive oxygen species. Microbiology 145:483-494[Abstract]. |
| 4. |
Beaman, B. L.,
S. M. Scates,
S. E. Moring,
R. Deem, and H. P. Misra.
1983.
Purification and properties of a unique superoxide dismutase from Nocardia asteroides.
J. Biol. Chem.
258:91-96 |
| 5. |
Beckman, K. B., and B. N. Ames.
1998.
The free radical theory of aging matures.
Physiol. Rev.
78:547-581 |
| 6. | Benov, L., L. Y. Chang, B. Day, and I. Fridovich. 1995. Copper, zinc superoxide dismutase in Escherichia coli: periplasmic location. Arch. Biochem. Biophys. 319:508-511[CrossRef][Medline]. |
| 7. |
Berlett, B. S., and E. R. Stadtman.
1997.
Protein oxidation in aging, disease, and oxidative stress.
J. Biol. Chem.
272:20313-20316 |
| 8. |
Böhme, G. A.,
W. Pfleiderer,
P. Böger, and S. Scherer.
1995.
Structure of a novel oligosaccharide-mycosporine amino acid ultraviolet-A/B sunscreen pigment from the terrestrial cyanobacterium Nostoc commune.
J. Biol. Chem.
270:8536-8539 |
| 9. |
Cai, Y., and C. P. Wolk.
1997.
Nitrogen deprivation of Anabaena sp. strain PCC 7120 elicits rapid activation of a gene cluster that is essential for uptake and utilization of nitrate.
J. Bacteriol.
179:258-266 |
| 10. |
Campbell, W. S., and D. E. Laudenbach.
1995.
Characterization of four superoxide dismutase genes from a filamentous cyanobacterium.
J. Bacteriol.
177:964-972 |
| 11. | Canini, A., P. Civitareale, S. Marini, M. Grilli Caiola, and G. Rotilio. 1992. Purification of iron superoxide dismutase from the cyanobacterium Anabeana cylindrica Lemm. and localization of the enzyme in heterocysts by immunogold labeling. Planta 187:438-444. |
| 12. |
Ehling-Schulz, M.,
W. Bilger, and S. Scherer.
1997.
UV-B-induced synthesis of photoprotective pigments and extracellular polysaccharides in the terrestrial cyanobacterium Nostoc commune.
J. Bacteriol.
179:1940-1945 |
| 13. |
Fang, F. C.,
M. A. DeGroote,
J. W. Foster,
A. J. Baumler,
U. Ochsner,
T. Testerman,
S. Bearson,
J. C. Giard,
Y. S. Xu,
G. Campbell, and T. Laessig.
1999.
Virulent Salmonella typhimurium has two periplasmic Cu, Zn-superoxide dismutases.
Proc. Natl. Acad. Sci. USA
96:7502-7507 |
| 14. | Gao, K., B. Qiu, J. Xia, and A. Yu. 1998. Light dependency of the photosynthetic recovery of Nostoc flagelliforme. J. Appl. Phycol. 10:51-53. |
| 15. | Gort, A. S., D. M. Ferber, and J. A. Imlay. 1999. The regulation and role of the periplasmic copper, zinc superoxide dismutase of Escherichia coli. Mol. Microbiol. 32:179-191[CrossRef][Medline]. |
| 16. | Haslekas, C., R. A. P. Stacy, V. Nygaard, F. A. Culiáñez-Macia, and R. B. Aalen. 1998. The expression of a peroxiredoxin antioxidant gene, AtPer1, in Arabidopsis thaliana is seed-specific and related to dormancy. Plant Mol. Biol. 36:833-845[CrossRef][Medline]. |
| 17. |
Henle, E. S., and S. Linn.
1997.
Formation, prevention, and repair of DNA damage by iron/hydrogen peroxide.
J. Biol. Chem.
272:19095-19098 |
| 18. |
Hill, D. R.,
S. L. Hladun,
S. Scherer, and M. Potts.
1994.
Water stress proteins of Nostoc commune (Cyanobacteria) are secreted with UV-A/B-absorbing pigments and associate with 1,4- -D-xylanxylanohydrolase activity.
J. Biol. Chem.
269:7726-7734 |
| 19. | Hill, D. R., A. Peat, and M. Potts. 1994. Biochemistry and structure of the glycan secreted by desiccation-tolerant Nostoc commune (Cyanobacteria). Protoplama 182:126-148. |
| 20. | Hill, D. R., T. W. Keenan, R. F. Helm, M. Potts, L. M. Crowe, and J. H. Crowe. 1997. Extracellular polysaccharide of Nostoc commune (Cyanobacteria) inhibits fusion of membrane vesicles during desiccation and freeze-drying. J. Appl. Phycol. 9:237-248[CrossRef]. |
| 21. | Jansson, E., and P. Lindblad. 1998. Cloning and molecular characterization of a presumptive argF, a structural gene encoding ornithine carbamoyl transferase (OCT), in the cyanobacterium Nostoc PCC 73102. Physiol. Plant. 103:347-353[CrossRef]. |
| 22. | Kaneko, T., S. Sato, H. Kotani, A. Tanaka, E. Asamizu, Y. Nakamura, N. Miyajima, M. Hirosawa, M. Sugiura, S. Sasamoto, T. Kimura, T. Hosouchi, A. Matsuno, A. Muraki, N. Nakazaki, K. Naruo, S. Okumura, S. Shimpo, C. Takeuchi, T. Wada, A. Watanabe, M. Yamada, M. Yasuda, and S. Tabata. 1996. Sequence analysis of the genome of the unicellular cyanobacterium Synechocystis sp. strain PCC6803. II. Sequence determination of the entire genome and assignment of potential protein-coding regions. DNA Res. 3:109-136[Abstract]. |
| 23. |
Markillie, L. M.,
S. M. Varnum,
P. Hradecky, and K. K. Wong.
1999.
Targeted mutagenesis by duplication insertion in the radioresistant bacterium Deinococcus radiodurans: radiation sensitivities of catalase (katA) and superoxide dimutase (sodA) mutants.
J. Bacteriol.
181:666-669 |
| 24. | Marklund, S. L. 1984. Extracellular superoxide dismutase in human tissue and human cell lines. J. Clin. Investig. 74:1398-1403. |
| 25. |
McCord, J. M., and I. Fridovich.
1969.
Superoxide dismutase: an enzymatic function for erythrocuprein.
J. Biol. Chem.
244:6049-6055 |
| 26. | Misra, H. P., and I. Fridovich. 1978. Inhibition of superoxide dismutase by azide. Arch. Biochem. Biophys. 189:317-322[CrossRef][Medline]. |
| 27. |
Miyake, C.,
F. Michihata, and K. Asada.
1991.
Scavenging of hydrogen peroxide in prokaryotic and eukaryotic algae: acquisition of ascorbate peroxidase during evolution of cyanobacteria.
Plant Cell Physiol.
32:33-43 |
| 28. | Nelson, D. P., and L. A. Kiesow. 1972. Enthalpy of decomposition of hydrogen peroxide by catalase at 25°C (with molar extinction coefficients of H2O2 in the uv). Anal. Biochem. 49:474-478[CrossRef][Medline]. |
| 29. | Peat, A., N. Powell, and M. Potts. 1988. Ultrastructural analysis of the rehydration of desiccated Nostoc commune HUN (Cyanobacteria) with particular reference to the immunolabelling of NifH. Protoplasma 146:72-80[CrossRef]. |
| 30. |
Potts, M.
1985.
Protein synthesis and proteolysis in immobilized cells of Nostoc commune UTEX 584 (Cyanobacteria) subjected to water stress.
J. Bacteriol.
164:1025-1031 |
| 31. |
Potts, M.
1994.
Desiccation tolerance of prokaryotes.
Microbiol. Rev.
58:755-805 |
| 32. | Potts, M. Mechanisms for desiccation tolerance. Eur. J. Phycol., in press. |
| 33. | Potts, M., and M. A. Bowman. 1985. Sensitivity of Nostoc commune UTEX 584 (Cyanobacteria) to water stress. Arch. Microbiol. 141:51-56[CrossRef]. |
| 34. |
Potts, M.,
M. A. Bowman, and N. S. Morrison.
1984.
Control of matric water potential ( m) in immobilized cultures of cyanobacteria.
FEMS Microbiol. Lett.
24:193-196.
|
| 35. | Rippka, R., J. Deruelles, J. B. Waterbury, M. Herdman, and R. Y. Stanier. 1979. Generic assignments, strain histories and properties of pure cultures of cyanobacteria. J. Gen. Microbiol. 111:1-61. |
| 36. |
Rudi, K.,
O. M. Skulberg, and K. S. Jakobsen.
1998.
Evolution of cyanobacteria by exchange of genetic material among phyletically related strains.
J. Bacteriol.
180:3453-3461 |
| 37. | Salin, M. L., and J. M. McCord. 1974. Superoxide dismutase in polymorphonuclear leucocytes. J. Clin. Investig. 54:1005-1009. |
| 38. |
Sandmann, G.,
S. Kuhn, and P. Böger.
1998.
Evaluation of structurally different carotenoids in Escherichia coli transformants as protectants against UV-B radiation.
Appl. Environ. Microbiol.
64:1972-1974 |
| 39. | Scherer, S., A. Ernst, T.-W. Chen, and P. Böger. 1984. Rewetting of drought-resistant blue-green algae: time course of water uptake and reappearance of respiration, photosynthesis, and nitrogen fixation. Oecologia (Berlin) 62:418-423[CrossRef]. |
| 40. |
Scherer, S.,
T.-W. Chen, and P. Böger.
1988.
A new UVA/B protecting pigment in the terrestrial cyanobacterium Nostoc commune.
Plant Physiol.
88:1055-1057 |
| 41. |
Scherer, S., and M. Potts.
1989.
Novel water stress protein from a desiccation-tolerant cyanobacterium: purification and partial characterization.
J. Biol. Chem.
264:12546-12553 |
| 42. |
Schwarz, R., and A. R. Grossman.
1998.
A response regulator of cyanobacteria integrates diverse environmental signals and is critical for survival under adverse extreme conditions.
Proc. Natl. Acad. Sci. USA
95:11008-11013 |
| 43. | Sherwin, H. W., and J. M. Farrant. 1998. Protection mechanisms against excess light in the resurrection plants Craterostigma wilmsii and Xerophyta viscosa. Plant Growth Regul. 24:203-210. |
| 44. | Silhavy, T. J., M. L. Berman, and L. W. Enquist. 1984. Experiments with gene fusions. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 45. | Stahl, W., and H. Sies. 1993. Physical quenching of singlet oxygen and cis-trans isomerization of carotenoids. Ann. N. Y. Acad. Sci. 691:10-19[Medline]. |
| 46. | Xie, W.-Q., D. Tice, and M. Potts. 1995. Cell water deficit regulates expression of rpoC1C2 (RNA polymerase) at the level of mRNA in desiccation-tolerant Nostoc commune UTEX 584 (Cyanobacteria). FEMS Microbiol. Lett. 126:159-164[CrossRef]. |
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||