Previous Article
Journal of Bacteriology, January 2000, p. 252-255, Vol. 182, No. 1
0021-9193/0/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
A celR Mutation Affecting Transcription
of Cellulase Genes in Thermobifida fusca
Nikolay A.
Spiridonov and
David B.
Wilson*
Department of Molecular Biology and Genetics,
Cornell University, Ithaca, New York 14853
Received 25 August 1999/Accepted 8 October 1999
 |
ABSTRACT |
Biosynthesis of extracellular cellulases in the cellulose-degrading
actinomycete Thermobifida fusca is controlled by a
transcriptional regulator, CelR, and cellobiose, which acts as an
inducer interfering with the CelR-DNA interaction. We report the
identification and characterization of a mutation in the
celR gene that changes Ala55 in the hinge helix
of CelR to Thr. The wild-type and mutant celR genes were
cloned in Escherichia coli, and their protein products were
characterized. The CelR mutant protein bound DNA more weakly than the
wild-type protein and formed a less stable complex with DNA in the
presence of cellobiose. The results of Western analysis and gel
retardation experiments suggest that CelR is produced constitutively
and its DNA-binding activity is regulated through posttranslational modification.
 |
TEXT |
Many soil actinomycetes degrade
cellulose in plant residues by using secreted enzymes. Biosynthesis of
extracellular cellulases in Cellulomonas uda, C. fimi, Thermomonospora curvata, T. fusca, Acidothermus cellulolyticus, Streptomyces
reticuli, S. halstedii, and other members of the family
Actinomycetaceae is regulated by induction and repression
(1-3, 9, 17, 20, 23). In several of these species,
regulation occurs at the transcriptional level (2, 3, 11,
23). The results of these studies suggest a complex control of
cellulase genes in actinomycetes.
Cellulase synthesis in T. fusca (recently reclassified as
Thermobifida fusca [26]) is induced by
cellulose and cellobiose and is subject to sugar catabolite repression
(9). The cellulolytic system of T. fusca is
encoded by at least six unlinked genes, designated celA
through celF, that form a regulon (6, 8, 25; D. Irwin, unpublished data). The six extracellular
enzymes produced by this species (endocellulases E1, E2, and E5;
exocellulases E3 and E6; and the processive endocellulase E4) act
synergistically, degrading cellulose to cellobiose and other soluble
sugars (5).
The close correlation between the levels of the celE
transcript and the level of the protein product of the celE
gene, endoglucanase E5, produced on different carbon sources provided
evidence that cellulase biosynthesis is regulated through the control
of transcription (11). A 14-bp inverted repeat
(TGGGAGCGCTCCCA) located in the 5'-upstream regions of all
cel genes was identified as a cis-acting regulatory element (10), and a transcription regulator,
CelR, that specifically binds to the 14-bp inverted repeat was isolated (19). In vitro experiments showed that cellobiose at
physiological concentrations acts as an effector causing dissociation
of the CelR-DNA complex. It was suggested that transcription of the
cel genes is controlled by CelR and cellobiose.
A partially constitutive mutant strain, CC-2, with enhanced
carboxymethyl cellulose (CMC)-hydrolyzing activity was isolated from
T. fusca (9). In this paper, we show that the
strain has a mutation in the celR gene. We used biochemical
approaches to characterize the properties of the wild-type and mutant
CelR proteins. Our results are consistent with the role of CelR as a
repressor controlled by cytoplasmic cellobiose levels and
posttranscriptional modification.
Bacterial strains, plasmids, and culture conditions.
The
following T. fusca strains were used in this study: YX (wild
type); CC-2, a partially cellulase constitutive strain (9); and ER1, an extracellular protease-negative strain (24).
Strains CC-2 and ER1 were derived from T. fusca YX.
Escherichia coli DH5
was used for cloning and plasmid
isolation; E. coli BL21(DE3) was used for protein
production. Plasmid pNS1 was described earlier (19), and
plasmids pNS2 and pNS3 were constructed as described below.
T. fusca was grown on Hagerdahl medium (4)
supplemented with either 0.5% cellobiose, glucose, or xylose (Sigma
Chemical Co.) or 1% Solka Floc (microcrystalline cellulose; James
River Corporation) at 52 to 55°C. E. coli strains
containing recombinant plasmids were grown in Luria broth or plated on
Luria agar plates containing ampicillin at 0.1 mg/ml (pNS1) or
kanamycin at 30 µg/ml (pNS2 and pNS3).
Enzyme activity and protein assays.
T. fusca culture
samples were centrifuged at 5,000 × g for 5 min, and
the supernatants were assayed for cellulase activity using filter paper
(FP) or 1% low-viscosity CMC (Sigma Chemical Co.) as the substrate.
The amount of reducing sugar (primarily cellobiose) produced was
measured spectrophotometrically at 600 nm after reaction with
dinitrosalicylic acid as previously described (18).
Cell density was estimated from cytoplasmic protein. The cell pellet
was washed two times in lysis buffer containing 10 mM
Tris-HCl (pH
8.0), 1 mM EDTA, 0.1 mM phenylmethylsulfonyl fluoride
and 0.1 mM
dithiothreitol. Cells were resuspended in lysis buffer
and lysed with a
French press at 4°C, and the cell lysate was
centrifuged at
10,000 ×
g for 20 min. Culture supernatants and
cell
lysates were stored at

20°C. Cytoplasmic protein in the
cell lysate
and total secreted (extracellular) protein in the
culture supernatant
were measured by the method of Lowry et al.
(
12).
Subcloning, expression, and purification of wild-type and mutant
celR in E. coli.
Genomic DNA was isolated from
T. fusca CC-2 as previously described (19). The
celR gene was amplified from genomic DNA with PCR using the
Expand high-fidelity DNA polymerase system (Boehringer Mannheim) and
the primers GCCGCGCACGCTGCCATTGAG and
TCCGCCTGCCTCCCGTTGTCCTC. A DNA fragment containing the
celR gene was isolated by gel electrophoresis and purified
with the QIAquick gel extraction kit (QIAGEN). The wild-type
celR gene (from pNS1) and PCR products containing the celR mutant gene (from strain CC-2) were used for
subcloning. An NdeI restriction site, CATATG, was
introduced by PCR immediately upstream from the start codon of the
genes by using primers GGGTTGGGGGAACACATATGGAGCGTC and
CTTTGCGCGGGCCCCTCATCC (pNS1) or primers
GGGTTGGGGGAACACATATGGAGCGTC and TCCGCCTGCCTCCCGTTGTCCTC
(CC-2). PCR products were cut with NdeI and
BamHI, gel purified, and ligated to pET26b(+) vector DNA
(Novagen) that had been cut with the same enzymes. The resulting plasmids, pNS2 (containing wild-type celR) and pNS3
(containing the mutant celR gene from strain CC-2), were
electroporated into E. coli DH5
. DNA was isolated
from transformants and checked for undesired PCR mutations by
sequencing. Specific primers for sequencing were synthesized, and
DNA sequencing was performed by the dideoxy-chain termination
method (14) at the BioResource Center, Cornell University.
Electrophoretically pure CelR and mutant CelR were isolated from
E. coli BL21(DE3) transformed with pNS2 or pNS3. Cells were
grown in 0.5 liter of M9 medium containing kanamycin at 30 µg/ml
and
0.8% glucose at 37°C, induced with
isopropyl-

-
D-thiogalactopyranoside
after 6 h, and
cultured overnight. Cells were harvested and lysed,
and CelR protein
was isolated and purified by chromatography on
phenyl Sepharose CL-4B
and heparin Sepharose CL-4B columns as
previously described
(
19). Precipitation with streptomycin sulfate
was omitted.
The protein concentration was determined with the
bicinchoninic acid
reagent (Pierce Chemical Co.) using bovine
serum albumin (Sigma
Chemical Co.) as the
standard.
celE promoter-binding assay and quantitation of the
CelR protein in T. fusca.
The celE
promoter-binding activities of the wild-type and mutant CelR proteins
were measured in vitro with a gel retardation assay by determining the
alteration of the electrophoretic mobility of the
32P-labeled celE promoter region after formation
of a complex with the DNA-binding protein as previously described
(19).
Accurate quantitation of the CelR protein in the wild type and strain
CC-2 was not possible because of the high proteolytic
activity.
Protease-negative strain ER1 was used for CelR quantitation
by Western
blotting and gel retardation assay. Cells were grown
on 0.5%
cellobiose. Stationary-phase cultures were used to inoculate
the
medium, supplemented with either 0.5% cellobiose, glucose,
or xylose
or 1% Solka Floc. Cells were cultured at 55°C and 200
rpm in
triplicate on each carbon source.
T. fusca cytoplasmic
proteins were isolated as described above, separated by sodium
dodecyl
sulfate-12% polyacrylamide gel electrophoresis (
7),
and
electrophoretically transferred to an Immobilon-P polyvinylidene
difluoride membrane (Millipore). Rabbit polyclonal antiserum raised
against pure CelR protein and goat anti-rabbit immunoglobulin
G-alkaline phosphatase conjugate were used for CelR detection.
Dilutions of pure CelR protein separated on the same gels were
used as
standards. The CelR bands were detected with a Vistra
ECL Western
blotting kit and scanned with a STORM 840 scanner,
and the images were
quantitated with the ImageQuant program (Molecular
Dynamics). The
abundance of the CelR protein was also calculated
from
celE
promoter-binding activity in
T. fusca extracts measured
with
a gel retardation assay. Electrophoretically pure CelR protein
used as
a standard in gel retardation and Western blotting experiments
was
purified from
T. fusca grown on Solka Floc as previously
described
(
19).
Cellulase activity in T. fusca wild-type and CC-2
mutant strains.
Wild-type T. fusca YX and partially
constitutive strain CC-2 were grown on minimal medium with
microcrystalline cellulose (Solka Floc), cellobiose, or glucose as the
carbon source. Cellulase activity was measured with soluble CMC, which
is a preferred substrate for endocellulases E1 and E5, and with
microcrystalline cellulose (FP), which is degraded by the synergistic
action of all six enzymes, after 24 and 72 h of cultivation (Table
1). There were characteristic differences
in the growth of T. fusca on different carbon sources (data
not shown). Cellobiose induced fast growth of both strains. Glucose was
a poorer carbon source, as evidenced by delayed growth and decreased
production of intracellular protein. Both strains showed continuous
accumulation of extracellular protein in the medium, and the level was
higher in cultures grown on inducing carbon sources.
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Cellulase activity and extracellular protein levels in
T. fusca cultures grown on microcrystalline cellulose,
cellobiose, and glucose
|
|
Wild-type cultures reached saturating cell density by 24 h on
every carbon source, but accumulation of extracellular protein
and
cellulase activity in the supernatant continued until the
end of
cultivation. There was significant repression of cellulase
synthesis in
cultures grown on glucose, as clearly shown by both
the CMC and filter
paper assays. When both cellulose and glucose
were present in the
medium, cells preferentially metabolized glucose
and the level of
cellulase synthesis remained low during the first
24 h of
cultivation. The glucose in the medium was then exhausted
and cellulase
activity increased, reaching 60% of the fully induced
level by 72 h of
cultivation.
Strain CC-2 was characterized by enhanced cellulase production, slower
growth, and slower production of extracellular protein.
It displayed
higher FP-hydrolyzing activity on every carbon source
and higher
CMC-hydrolyzing activity in cultures grown on sugars.
The final
cellulase levels in cultures grown on glucose and cellobiose
were 54 and 45%, respectively, of the level reached on microcrystalline
cellulose. Strain CC-2 grown on glucose showed enhanced CMCase
activity
both after 24 h of cultivation, when the glucose in the
medium was
not completely exhausted, and 48 h later. Strain CC-2
grown on
microcrystalline cellulose in the presence of glucose
showed a lowered
glucose repression of CMCase activity after 24
h of cultivation
(23% instead of the 80% of the wild type) that
increased by the end
of cultivation (34% instead of the 54% of
the wild type). We
could not measure glucose repression of FP-hydrolyzing
activity after
24 h because the high level of glucose in the medium
interfered
with the
assay.
Partially constitutive stain CC-2 carries a mutation in the
celR gene.
The celR gene in partially
constitutive strain CC-2 carries a G-to-A substitution at the first
position of the 55 triplet which changed the alanine residue to
threonine in the mutant protein. Residue 55 lies within the hinge
helix connecting the DNA-binding domain to the
corepressor-binding domain. Crystallographic studies of another
member of the GalR-LacI family, PurR, showed that the repressor-operator complex consists of two PurR molecules bound to the
palindromic operator sequence. The hinge helix participates in
DNA-protein complex formation by binding to the DNA minor groove and by
forming a series of contacts with the DNA-binding domain, the
corepressor-binding domain, and the hinge helix of the other PurR
monomer (16). Ala55 in CelR is a homologue of
Val50 in PurR, which forms van der Waals contacts with the
side chain of Val50 in the other PurR monomer. Mutagenesis
studies of the LacI repressor from E. coli showed that this
region is particularly sensitive to mutations. Amino acid replacements
in the hinge helix resulted in defective repressors with altered
operator binding, inducer binding, or allosteric transition
(13).
celE promoter-binding activities of wild-type and
mutant CelR proteins.
The wild-type and mutant CelR proteins were
purified to homogeneity from the overproducing E. coli
strains, and their properties were compared to those of wild-type CelR
purified from T. fusca. Both the wild-type and mutant CelR
proteins produced in E. coli had an apparent molecular mass
of 41.5 kDa, identical to that of CelR from T. fusca. The
dissociation constant for the CelR-celE promoter complex was
calculated as the concentration of CelR that caused 50% of the DNA to
bind under the conditions of the assay. CelR expressed in E. coli had a slightly lower celE promoter-binding affinity (Kd = 1.9 × 10
9 M)
than CelR isolated from T. fusca (Kd = 1 × 10
9 M). The CelR mutant protein had even
weaker DNA binding (Kd = 4.1 × 10
9 M).
The effect of cellobiose on DNA-protein complex formation was measured
with the gel retardation assay using CelR and the mutant
CelR protein
expressed in
E. coli. It was shown that the mutant
protein
formed a less stable intermolecular complex with the
celE promoter than did wild-type CelR (see Fig.
2). A weaker dissociation
constant and lower stability of the CelR mutant-DNA complex in
the
presence of cellobiose may be responsible for the partial
constitutive
cellulase synthesis in the CC-2 mutant. The CelR
protein purified from
T. fusca formed a significantly more stable
CelR-
celE promoter complex in the presence of cellobiose
than
did CelR expressed in
E. coli.
celE promoter-binding activity and abundance of the
CelR protein in T. fusca.
The highest celE
promoter-binding activity was found in T. fusca cultures
grown on microcrystalline cellulose (Fig.
1). The maximum level of activity was
observed after 12 h of cultivation and remained high during
72 h of growth. Significant binding activity was present in cells
grown on cellobiose. In this case, activity decreased rapidly and was
almost undetectable after 48 h of cultivation. Cells grown on
glucose and xylose showed very low activity after 12 and 24 h of
cultivation.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 1.
celE promoter-binding activity in T. fusca ER1 grown on Solka Floc (SF), cellobiose (CB), glucose (GL),
and xylose (XL) measured with the gel retardation assay. One unit of
celE promoter-binding activity is the amount of DNA-binding
protein that converts 50% of the DNA fragment to a DNA-protein complex
under the assay conditions used.
|
|
The abundance of the CelR protein in crude
T. fusca extracts
was measured after 20 h of cultivation, the peak of
celE promoter-binding
activity. Dilutions of cell extracts
were analyzed by Western
blot analysis and by the gel retardation
assay. Both Western blotting
and the gel retardation assay showed
similar CelR levels in cells
grown on cellulose and cellobiose (Table
2). However, the gel
retardation assay
showed very low CelR levels in cells grown on
glucose and xylose, while
Western analysis revealed significant
levels of the protein in these
cells. These results indicate that
most of the CelR produced under
noninducing conditions cannot
bind its DNA target.
View this table:
[in this window]
[in a new window]
|
TABLE 2.
Levels of CelR protein in T. fusca ER1
cultures grown for 20 h on different carbon sources as determined
by Western blotting and gel retardation assay
|
|
The high levels of CelR in
T. fusca grown under both
inducing and noninducing conditions from Western blotting analysis is
evidence for its constitutive synthesis. The fact that only a
minor
fraction of the CelR in cells grown under noninducing conditions
can
bind its target DNA indicates that the activity of CelR may
be
regulated through posttranslational modification. Another indication
of
posttranslational modification is the different stabilities
of the
CelR-
celE promoter complexes formed by the CelR proteins
expressed in
T. fusca and
E. coli in the presence
of cellobiose
(Fig.
2). There is no
CelR-binding site in the upstream region
of the
celR gene
that would allow its negative autoregulation.
Based on these
results, we suggest that CelR is produced constitutively
but its
DNA-binding activity is regulated by a protein kinase
or some other
mechanism.

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 2.
Effect of cellobiose on the dissociation constant of the
CelR-celE promoter complex. The values are averages ± the standard deviations. The celE promoter-binding
activities of electrophoretically pure CelR and mutant CelR expressed
in E. coli and CelR isolated from T. fusca were
measured with the gel retardation assay.
|
|
In many respects, regulation of the
cel genes in
T. fusca is similar to transcriptional regulation of
polysaccharide degradation
genes in phylogenetically related
actinomycetes. In
Streptomyces reticuli, transcription
of the
cel1 cellulase gene is controlled
by a CebR repressor
that shows high homology to CelR and binds
to the same target sequence
(
15).

-Amylase (
aml) genes in
S. coelicolor are under the negative control of MalR, another member
of the GalR-LacI family (
21,
22). Similar to the
cel genes
in
T. fusca that are induced by
cellobiose (the end product of
cellulase),
aml genes in
S. coelicolor are induced by maltose
and maltotriose derived
from starch by the enzymatic action of
products of the
aml
genes. Both the CelR and MalR regulatory proteins
are expressed
constitutively. Similar to
celR, which is located
immediately downstream of the
bglABC operon that encodes
components
of an energy-dependent sugar (probably cellobiose) transport
system,
cebR and
malR are located in the vicinity
of gene clusters encoding
components of similar systems for
cellobiose-cellotriose and maltose
utilization. These common features
indicate a close evolutionary
relationship among the polysaccharide
catabolic pathways of the
three
species.
 |
ACKNOWLEDGMENTS |
We gratefully thank Diana Irwin for advice and helpful suggestions
and Joseph Calvo for discussion and critical reading of the manuscript.
This work was supported by grant DE-FG02-84ER13233 from the Department
of Energy Basic Energy Research Program.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: 458 Biotechnology Bldg., Cornell University, Ithaca, NY 14853. Phone: (607)
255-5706. Fax: (607) 255-2428. E-mail: dbw3{at}cornell.edu.
 |
REFERENCES |
| 1.
|
Fennington, G.,
D. Neubauer, and F. Stutzenberger.
1984.
Cellulase biosynthesis in a catabolite repression-resistant mutant of Thermomonospora fusca.
Appl. Environ. Microbiol.
47:201-204[Abstract/Free Full Text].
|
| 2.
|
Fernandez-Abalos, J. M.,
A. Ruiz-Arribas,
A. L. Garda, and R. I. Santamaria.
1997.
Effect of carbon source on the expression of celA-1, a cellulase-encoding gene from Streptomyces halstedii JM8.
FEMS Microbiol. Lett.
153:97-103[Medline].
|
| 3.
|
Greenberg, N. M.,
R. A. J. Warren,
D. G. Kilburn, and R. C. Miller, Jr.
1987.
Regulation, initiation and termination of the cenA and cex transcripts of Cellulomonas fimi.
J. Bacteriol.
169:646-653[Abstract/Free Full Text].
|
| 4.
|
Hagerdahl, B. G. R.,
J. D. Ferchak, and E. K. Pye.
1978.
Cellulolytic enzyme system of Thermomonospora sp. grown on microcrystalline cellulose.
Appl. Environ. Microbiol.
36:606-612[Abstract/Free Full Text].
|
| 5.
|
Irwin, D.,
L. Walker,
M. Spezio, and D. Wilson.
1993.
Activity studies of eight purified cellulases: specificity, synergism, and binding domain effects.
Biotech. Bioeng.
42:1002-1013[CrossRef].
|
| 6.
|
Jung, E. D.,
G. Lao,
D. Irwin,
B. K. Barr,
A. Benjamin, and D. B. Wilson.
1993.
DNA sequences and expression in Streptomyces lividans of an exoglucanase gene and an endoglucanase gene from Thermomonospora fusca.
Appl. Environ. Microbiol.
59:3032-3043[Abstract/Free Full Text].
|
| 7.
|
Laemmli, U. K.
1970.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature (London)
227:680-685[CrossRef][Medline].
|
| 8.
|
Lao, G.,
G. S. Ghangas,
E. D. Jung, and D. B. Wilson.
1991.
DNA sequences of three -1,4-endoglucanase genes from Thermomonospora fusca.
J. Bacteriol.
173:3397-3407[Abstract/Free Full Text].
|
| 9.
|
Lin, E., and D. B. Wilson.
1987.
Regulation of -1,4-endoglucanase synthesis in Thermomonospora fusca.
J. Bacteriol.
53:1352-1357.
|
| 10.
|
Lin, E., and D. B. Wilson.
1988.
Identification of a celE binding protein and its potential role in induction of the celE gene in Thermomonospora fusca.
J. Bacteriol.
170:3843-3846[Abstract/Free Full Text].
|
| 11.
|
Lin, E., and D. B. Wilson.
1988.
Transcription of the celE gene in Thermomonospora fusca.
J. Bacteriol.
170:3838-3842[Abstract/Free Full Text].
|
| 12.
|
Lowry, O. H.,
N. J. Rosebrough,
A. L. Farr, and R. J. Randall.
1951.
Protein measurement with the Folin phenol reagent.
J. Biol. Chem.
193:265-275[Free Full Text].
|
| 13.
|
Markiewicz, P.,
L. G. Kleina,
C. Cruz,
S. Ehret, and J. H. Miller.
1994.
Genetic studies of the lac repressor. XIV. Analysis of 4000 altered Escherichia coli lac repressors reveals essential and nonessential residues, as well as "spacers" which do not require a specific sequence.
J. Mol. Biol.
240:421-433[CrossRef][Medline].
|
| 14.
|
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467[Abstract/Free Full Text].
|
| 15.
|
Schlösser, A.,
J. Jantos,
K. Hackmann, and H. Schrempf.
1999.
Characterization of the binding protein-dependent cellobiose and cellotriose transport system of the cellulose degrader Streptomyces reticuli.
Appl. Environ. Microbiol.
65:2636-2643[Abstract/Free Full Text].
|
| 16.
|
Schumacher, M. A.,
K. Y. Choi,
H. Zalkin, and R. G. Brennan.
1994.
Crystal structure of LacI member, PurR, bound to DNA: minor groove binding by alpha helices.
Science
266:763-770[Abstract/Free Full Text].
|
| 17.
|
Shiang, M.,
J. C. Linden,
A. Mohagheghi,
K. Grohmann, and M. E. Himmel.
1991.
Regulation of cellulase synthesis in Acidothermus cellulolyticus.
Biotechnol. Prog.
7:315-322[CrossRef].
|
| 18.
|
Spiridonov, N. A., and D. B. Wilson.
1998.
Regulation of biosynthesis of individual cellulases in Thermomonospora fusca.
J. Bacteriol.
180:3529-3532[Abstract/Free Full Text].
|
| 19.
|
Spiridonov, N. A., and D. B. Wilson.
1999.
Characterization and cloning of CelR, a transcriptional regulator of cellulase genes from Thermomonospora fusca.
J. Biol. Chem.
274:13127-13132[Abstract/Free Full Text].
|
| 20.
|
Stoppok, W.,
P. Rapp, and F. Wagner.
1982.
Formation, location, and regulation of endo-1,4- -glucanases and -glucosidases from Cellulomonas uda.
Appl. Environ. Microbiol.
44:44-53[Abstract/Free Full Text].
|
| 21.
|
van Wezel, G. P.,
J. White,
M. J. Bibb, and P. W. Postma.
1997.
The malEFG gene cluster of Streptomyces coelicolor A3(2): characterization, disruption and transcriptional analysis.
Mol. Gen. Genet.
254:604-608[CrossRef][Medline].
|
| 22.
|
van Wezel, G. P.,
J. White,
P. Young,
P. W. Postma, and M. J. Bibb.
1997.
Substrate induction and glucose repression of maltose utilization by Streptomyces coelicolor A3(2) is controlled by malR, a member of the lacI-galR family of regulatory genes.
Mol. Microbiol.
23:537-549[CrossRef][Medline].
|
| 23.
|
Walter, S., and H. Schrempf.
1996.
The synthesis of the Streptomyces reticuli cellulase (Avicelase) is regulated by both activation and repression mechanisms.
Mol. Gen. Genet.
251:186-195[Medline].
|
| 24.
|
Wilson, D. B.
1992.
Biochemistry and genetics of actinomycete cellulases.
Crit. Rev. Biotechnol.
12:45-63[Medline].
|
| 25.
|
Zhang, S.,
G. Lao, and D. B. Wilson.
1995.
Characterization of a Thermomonospora fusca exocellulase.
Biochemistry
34:3386-3395[CrossRef][Medline].
|
| 26.
|
Zhang, Z.,
Y. Wang, and J. Ruan.
1998.
Reclassification of Thermomonospora and Microtetraspora.
Int. J. Syst. Bacteriol.
48:411-422[Abstract/Free Full Text].
|
Journal of Bacteriology, January 2000, p. 252-255, Vol. 182, No. 1
0021-9193/0/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Lykidis, A., Mavromatis, K., Ivanova, N., Anderson, I., Land, M., DiBartolo, G., Martinez, M., Lapidus, A., Lucas, S., Copeland, A., Richardson, P., Wilson, D. B., Kyrpides, N.
(2007). Genome Sequence and Analysis of the Soil Cellulolytic Actinomycete Thermobifida fusca YX. J. Bacteriol.
189: 2477-2486
[Abstract]
[Full Text]
-
Zhang, Y.-H. P., Lynd, L. R.
(2005). Regulation of Cellulase Synthesis in Batch and Continuous Cultures of Clostridium thermocellum. J. Bacteriol.
187: 99-106
[Abstract]
[Full Text]