Previous Article | Next Article 
Journal of Bacteriology, January 2000, p. 38-44, Vol. 182, No. 1
0021-9193/0/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Light-Dependent Regulation of Cyanobacterial
Phytochrome Expression
M.
García-Domínguez,
M. I.
Muro-Pastor,
J. C.
Reyes, and
F. J.
Florencio*
Instituto de Bioquímica Vegetal y
Fotosíntesis, Universidad de Sevilla-CSIC, Centro de
Investigaciones Científicas Isla de la Cartuja, Isla de la
Cartuja, E-41092 Seville, Spain
Received 11 June 1999/Accepted 14 October 1999
 |
ABSTRACT |
A histidine kinase protein (Cph1) with sequence homology and
spectral characteristics very similar to those of the plant phytochrome has been recently identified in the cyanobacterium
Synechocystis sp. strain PCC 6803. Cph1 together with Rcp1
(a protein homologue to the response regulator CheY) forms a
light-regulated two-component system whose function is presently
unknown. Levels of cph1 rcp1 mRNA increase in the dark and
decrease upon reillumination. A dark-mediated increase in cph1
rcp1 mRNA levels was inhibited by the presence of glucose, but
not by inhibition of the photosynthetic electron flow. The half-life of
cph1 rcp1 transcript in the light was about fourfold
shorter than in the dark, indicating that control of cph1
rcp1 transcript stability is one of the mechanisms by which light
regulates expression of the cyanobacterial phytochrome. After 15 min of
darkness, 3-min pulses of red, blue, green, and far-red light were
equally efficient in decreasing the cph1 rcp1 mRNA levels.
Red light downregulation was not reversed by far-red light, suggesting
that cph1 rcp1 mRNA levels are not controlled by a
phytochrome-like photoreceptor. Furthermore, a
Synechocystis strain containing an H538R Cph1 point
mutation, unable to phosphorylate Rcp1, shows normal light-dark
regulation of the cph1 rcp1 transcript levels. Our data
suggest a role of cyanobacterial phytochrome in the control of
processes required for adaptation in light-dark and dark-light transitions.
 |
INTRODUCTION |
Photosynthetic organisms must
maintain a metabolic homeostasis despite daily variations in incident
light. Not only does light provide energy for photosynthesis, but a
large number of plant developmental events are also responsive to light
cues. Accordingly, photosynthetic organisms have evolved light
detection systems (photoreceptors) that control gene expression through
signal transduction pathways (25).
Phytochromes are the best characterized of those photoreceptors.
Phytochromes exist in two different photoconvertible forms, the
red-light-absorbing form (Pr) and the far-red-light-absorbing form
(Pfr) (for reviews, see references 27 and
34). In plants, phytochromes are soluble homodimers
constituted by two subunits of about 125 kDa, each of which folds into
two major structural domains: an amino-terminal domain that binds the
chromophore and a carboxy-terminal domain that contains regions
necessary for dimerization and biological activity. How the plant
phytochrome transduces perceived photosensory information to downstream
signaling components remains unclear, although some progress has been
made toward determining it (for a review, see reference
10).
The field of phytochrome research has recently been revolutionized by
the finding of a phytochrome in the cyanobacterium
Synechocystis sp. strain PCC 6803 (16, 18, 20,
37) (for reviews, see references 9, 24, and
26). Cyanobacteria are photosynthetic prokaryotes
that carry out oxygenic photosynthesis similar to eukaryotic algae and
higher plants. The most exciting aspect of this discovery is that
cyanobacterial phytochrome, Cph1, is the sensor component of a typical
bacterial two-component signal transduction system (for reviews, see
references 15 and 23). The
amino-terminal domain of Cph1 shows 30 to 35% amino acid identity to
the chromophore-bearing domain of higher plant phytochromes, and it is
able to catalyze its own chromophore attachment in vitro, whereas the
carboxy terminus contains the consensus sequences of histidine kinases.
Immediately downstream of cph1 is found an open reading
frame (called rcp1) encoding a protein with striking
sequence similarity to the CheY family of response regulators. In fact,
Yeh et al. have shown that, in vitro, Cph1 is a light-regulated
histidine kinase that mediates red/far-red reversible phosphorylation
of the response regulator Rcp1 (37). These findings shed
light on the initial step of light signal transduction by phytochrome.
However, the function of Cph1 as a phytochrome in vivo has not yet been demonstrated.
Here we characterize the pattern of expression of the cph1
rcp1 operon under different conditions. We demonstrate that the amount of cph1 rcp1 transcript is repressed by light,
probably through the concourse of different photoreceptors.
Dark-dependent upregulation of cph1 rcp1 transcript levels
is abolished by glucose. This pattern of expression suggests a role of
cyanobacterial phytochrome in light-dark transitions.
 |
MATERIALS AND METHODS |
Bacterial strains and growth conditions.
Synechocystis sp. strain PCC 6803 was grown
photoautotrophically at 30°C in BG11c medium (30) and
bubbled with a continuous stream of 1% (vol/vol) CO2 in
air under continuous fluorescent illumination (50 µE of white light
m
2 s
1) (referred to in the text as
"normal illumination conditions"). For mixotrophic growth, glucose
was added to a final concentration of 10 mM. Dark conditions were
obtained by wrapping culture flasks with aluminum foil. Light intensity
was measured with an LI-188B Integrating Quantum/Radiometer/Photometer
(LI-COR, Inc). For light quality experiments, Synechocystis
cultures were irradiated with 20 µE of light of a specific wavelength
m
2 s
1. Selective irradiation was generated
with the following narrow-band filters: blue,
max = 455 nm; green,
max = 500 nm; red,
max = 650 nm; far-red,
max = 725 nm. 3-(3,4-Dichlorophenyl)-1,1-dimethylurea (DCMU) and
2,5-dibromo-3-methyl-6-isopropylbenzoquinone (DBMIB) were used at a
final concentration of 5 µM when indicated.
Escherichia coli DH5
(Bethesda Research Laboratories)
grown in Luria broth medium was used for plasmid construction and
replication. E. coli was supplemented with 100 µg of
ampicillin per ml or 50 µg of kanamycin per ml when required.
RNA isolation and Northern blot hybridization.
Total RNA was
isolated from 25-ml samples of Synechocystis sp. strain PCC
6803 cultures at the mid-exponential phase (3 to 5 µg of
chlorophyll/ml). Extractions were performed by vortexing cells in the
presence of phenol-chloroform and acid-washed baked glass beads (0.25 to 0.3 mm in diameter; Braun, Melsungen, Germany) as previously
described (12).
For Northern blotting, 15 µg of total RNA was loaded per lane and
electrophoresed in 1.2% agarose denaturing formaldehyde
gels. Transfer
to nylon membranes (Hybond N-plus; Amersham), prehybridization,
hybridization, and washes were performed in accordance with Amersham
instruction manuals, with hybridization taking place at 42°C in
the
presence of 50% formamide. The 1,150-bp DNA fragment obtained
by PCR
amplification with oligonucleotides pht1 (5'
GATCCCATCCAGAGTCGCCTAACG
3') (from nucleotide +223 to nucleotide
+246, considering the
first nucleotide of the
cph1 gene
translation start codon as +1)
and pht2 (5'
AAGCATGATTTGGGTCACCGCCCC 3') (from nucleotide +1372
to nucleotide
+1349) and the 467-bp DNA fragment obtained with
oligonucleotides pht5
(5' GGTATTGAACCATGTCCGACG 3') (from nucleotide

11 to
nucleotide +10, considering the first nucleotide of the
rcp1
gene translation start codon as +1) and pht6 (5'
GGAGGATGCCAATTAAGCTGC
3') (from nucleotide +456 to nucleotide
+436) were used as the
cph1 and
rcp1 probes,
respectively. As a control, in all cases,
the filters were reprobed
with a
HindIII-
BamHI 580-bp probe from
plasmid pAV1100 that contains the constitutively expressed RNase
P RNA
gene from
Synechocystis sp. strain PCC 6803 (
36).
To determine
the cpm of radioactive areas in Northern blot
hybridizations,
an InstantImager Electronic Autoradiography apparatus
(Packard
Instrument Company, Meriden, Conn.) was
used.
Primer extension analysis.
Oligonucleotide pht3 (5'
GGTCGCTGAGTTGTACGG 3') (from nucleotide +28 to nucleotide +11)
end labeled with T4 polynucleotide kinase and
[
-32P]dATP (3,000 Ci/mmol) following standard
procedures (31) was used for primer extension analysis. For
annealing, a 10-µl mixture containing 0.15 M NaCl, 10 mM Tris-HCl (pH
8.0), 1 mM EDTA, 20 µg of total RNA, and about 2 pmol of
oligonucleotide (106 cpm) was prepared. The annealing
mixture was heated for 2 min at 90°C in a water bath that was
subsequently kept at room temperature to reach 50°C. For extension, a
10-µl mixture was prepared with one-half of the annealing mixture, 10 mM dithiothreitol, 0.5 mM each deoxynucleoside triphosphate (dNTP), 2 µg of actinomycin D, 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM
MgCl2, and 100 U of Superscript II RNase H-reverse
transcriptase (Gibco BRL, Gaithersburg, Md.). The mixture was incubated
for 45 min at 45°C, and the reaction was stopped by adding 4 µl of
formamide-loading buffer. One-half of the reaction mixture was
electrophoresed on a 6% polyacrylamide sequencing gel together with a
sequencing reaction mixture of the cph1 gene 5' region by
using the pht3 oligonucleotide.
Transcriptional gene fusion.
A transcriptional gene fusion
was constructed in the plasmid pFF11, a promoter-probe vector based on
the chloramphenicol acetyltransferase (CAT) reporter gene
(cat) (11). A 413-bp DNA fragment from nucleotide
245 to +168 bp with respect to the cph1 transcription
start point was subcloned into pFF11, yielding the plasmid pFF11-cph.
This reporter plasmid was used to transform the SFC
5 variant of
Synechocystis sp. strain PCC 6803 (4).
CAT activity was assayed in vitro at 37°C by the colorimetric
procedure (
33). One unit of CAT represents 1 µmol of
chloramphenicol
acetylated per min per mg of protein. Crude extracts
from
Synechocystis strains were prepared with glass beads as
described in reference
28, except that the buffer
was substituted for by 50 mM Tris-HCl
(pH 8.0).
The strains SFF16 (
11), which contains a promoterless
cat gene, and SFC57 (
5), which contains the
cat gene under the
control of its own promoter, were used as
controls.
The amount of protein in cell extracts was determined by the method of
Bradford (
2) with ovalbumin as a
standard.
Construction of Synechocystis sp. strain PCC 6803 cph1 mutants.
The Synechocystis sp. mutant
strain SPHY1 was created by interrupting the cph1 gene with
a neomycin phosphotransferase (npt)-containing cassette
(C.K1) (8), which confers kanamycin resistance
(Kmr). The C.K1 cassette was isolated as a 1.3-kb
HincII DNA fragment and inserted into the unique
HpaI site of cph1 in both orientations. Transformation of Synechocystis sp. strain PCC 6803 cells
was carried out as previously described (4).
A His538-to-Arg site-directed mutant of Cph1 was created by a two-step
strategy. First, a region of the
Synechocystis sp.
strain
PCC 6803
cph1 rcp1 operon was deleted and replaced by a
kanamycin resistance cassette, to generate strain SPHY5 (see Fig.
6B).
The site-directed mutant strain (SPHY6) was then generated
by replacing
the kanamycin resistance cassette with a construct
containing the
previously deleted region with the site-directed
mutation. A
chloramphenicol resistance (Cm
r) gene was also introduced
downstream of the
rcp1 coding region
in order to be used as
selectable marker (see Fig.
6B).
The SPHY5 strain was created by replacing a 1,580-bp
BstEII-
BsmI DNA fragment with a C.K1 cassette
(Km
r). The site-directed mutation plasmid pHR3 was
generated by changing
the His538 CAT codon to an Arg CGG codon by
standard PCR techniques.
The point mutation created a
SmaI
site, which was used to test
the mutants. The C.C1 cassette
(Cm
r) (
8) was then inserted at the
BsmI site located 228 bp downstream
of the
rcp1
STOP codon, in the same orientation as the operon.
Plasmid pHR3 was
used to transform
Synechocystis sp. strain PCC
6803 SPHY5
cells. Cm
r Km
s cells were selected.
Recombinants that have incorporated the
C.C1 cassette in strain SPHY5
also introduce the His538Arg mutation,
involving the loss of the C.K1
cassette. Whole segregation of
the mutants was checked by Southern
blotting.
 |
RESULTS |
Expression of cph1 rcp1 mRNA is upregulated by
darkness.
In higher plants, the phytochromes are encoded by a gene
family of up to five members (named PHYA-E) (6,
32). In most plants, PHYA mRNA is synthesized in
etiolated tissue and down-regulated rapidly in the light, whereas
PHYB-E mRNAs are not affected by light (for example, see
reference 6). To determine if light-dark transitions
also affect the cyanobacterial phytochrome transcript levels, Northern
blot hybridizations of total RNA from exponentially growing
Synechocystis sp. strain PCC 6803 cultures under
illumination conditions or after 0.25, 1, 2, 4, or 8 h of darkness
were carried out. Only one band of about 3 kb was observed when filters
were hybridized with probes of cph1 or rcp1
genes, demonstrating that both genes are cotranscribed, forming an
operon. As shown in Fig. 1A, cph1
rcp1 mRNA levels were upregulated (about a fivefold increase) after transfer of the cultures to the dark. Maximal levels of expression were obtained after 15 min of darkness. Thereafter, the
quantity of the transcript decreased slowly, reaching, after 8 h,
levels similar to those present under continuous illumination. When
cultures that have been maintained in the dark for 1 h were reilluminated, cph1 rcp1 mRNA levels decreased dramatically,
becoming almost undetectable (Fig. 1B, lane 4). However, 30 min after
reillumination, cph1 rcp1 mRNA steady-state light levels
were restored (Fig. 1B, lanes 1 and 5). The same pattern was observed
when an rcp1 gene probe was used (Fig. 1B).

View larger version (57K):
[in this window]
[in a new window]
|
FIG. 1.
Dark-dependent upregulation of cph1 rcp1 mRNA
levels. (A) Total RNA was isolated from mid-log-phase
Synechocystis sp. strain 6803 cells growing under normal
illumination conditions (white light, 50 µE m 2
s 1) (L) or after transfer of the culture to the dark for
0.25, 1, 2, 4, or 8 h. (B) Synechocystis sp. strain
6803 cells growing under illumination (lane 1) were transferred to the
dark for 1 h (lane 2), and then the culture was divided into two
fractions; one of them was subjected to an additional 30-min period of
darkness (lane 3), while the other one was reilluminated for 5 min
(lane 4) or 30 min (lane 5). Fifteen micrograms of total RNA was
subjected to Northern blot analysis with internal cph1 or
rcp1 probes (see Materials and Methods). The filters were
stripped and rehybridized with an rnpB gene probe.
Transcript size was estimated by comparison with 23S, 16S, and 5S
rRNAs.
|
|
Redox- and glucose-dependent control of cph1 rcp1 mRNA
expression.
Activity of the photosynthetic apparatus is likely to
exert a feedback regulatory role on the expression of photosynthetic genes. In fact, the expression of many cyanobacterial genes has been
shown to be affected by redox signals (12, 22, 28). Figure
2A shows that inhibition of
photosynthetic flow by DCMU (which blocks transfer of electrons between
the PSII complex and the plastoquinone pool [35]) or
DBMIB (which prevents the oxidation of plastoquinone by the cytochrome
b6f complex
[29]) did not upregulate cph1 rcp1 mRNA
levels. These data suggest that it is the absence of light per se, and
not the absence of photosynthetic flow, that mediates the
dark-dependent increase in cph1 rcp1 mRNA levels. This was
demonstrated by transferring DCMU- or DBMIB-treated cells to the dark.
Under these conditions, cph1 rcp1 mRNA levels increased in a
way similar to that in nontreated cells (Fig. 2B).

View larger version (50K):
[in this window]
[in a new window]
|
FIG. 2.
Effects of photosynthetic inhibitors and glucose on
cph1 rcp1 mRNA levels. (A) Light-growing
Synechocystis sp. strain 6803 cells were incubated either in
the absence (L) or in the presence of 5 µM DCMU or DBMIB. RNA was
isolated after 1 h and processed and hybridized as for Fig. 1. (B)
Synechocystis sp. strain 6803 cells grown under illumination
conditions (lane 1) were treated with DCMU (lane 2) or DBMIB (lane 5)
and transferred to the dark for 1 h or maintained in the light for
1 h (lanes 3 and 6, respectively) and then subjected to darkness
for 1 h (lanes 4 and 7, respectively). Northern blot
hybridizations were performed with RNA from cells grown under the
different conditions. (C) Total RNA was isolated from mid-log-phase
Synechocystis sp. strain 6803 cells growing under
illumination conditions (L) or after 1 or 4 h of darkness in the
presence or absence of 10 mM glucose. RNA was subjected to Northern
blot analysis with an internal cph1 probe.
|
|
Synechocystis sp. strain PCC 6803 is a heterotrophic
facultative cyanobacterium that can utilize glucose as a source of
energy,
redox power, and carbon (
30). Interestingly, when
Synechocystis sp. strain PCC 6803 cells grown in the light
and in the presence
of glucose (mixotrophic growth) were transferred to
the dark,
the level of
cph1 rcp1 mRNA remained constant
(Fig.
2C). This
suggests that not only the absence or the presence of
light but
also other metabolic signals are involved in the control of
the
expression of the
cph1 rcp1 operon.
Determination of the cph1 rcp1 promoter region.
As
a first step in the characterization of the cyanobacterial phytochrome
promoter, we have determined the transcription start point of the
cph1 rcp1 operon. Reverse primer extension of total RNA from
light-grown cultures or from cultures subjected to 1 h of darkness
was carried out. The transcription start point was localized at
150
bp with respect to the first translated nucleotide (Fig.
3A, lanes 3 and 4).
10 (TAGGAT) and
35 (TTGGAA) sequences with four of six sites matching the
10
(TATAAT) and
35 (TTGACA) boxes of the Escherichia coli
70-like consensus promoters (14) were found
upstream of the cph1 rcp1 first transcribed nucleotide (Fig.
3B). cDNA was more abundant when primer extension was carried out with
RNA isolated from dark-treated wild-type Synechocystis sp.
strain PCC 6803 cells than with RNA isolated from continuously
illuminated cells (Fig. 3A). A direct nucleotide repetition in the form
CGTTGN5CGTTG centered at position
45 was found (Fig. 3B).
To determine whether the cph1 rcp1 5'-upstream region
contains all of the cis-regulatory elements responsible for
the observed light-dark regulation, we subcloned the
245 to +168
region of the cph1 gene into pFF11, a promoter-probe plasmid based on the cat reporter gene and constructed for testing
promoters in Synechocystis sp. strain PCC 6803 (11). In vivo cph1 rcp1 promoter activity was
monitored by determining CAT activity of the cyanobacterial reporter
strain under normal illumination conditions or after 3 h of
darkness. The
245 to +168 region of the cph1 gene
displayed a significant promoter activity, and strong dark induction of
the reporter gene activity was not observed. However, a 1.5- to
1.8-fold increase in CAT activity was consistently observed after
3 h of darkness (4.66 ± 1 mU/mg under normal illumination conditions, versus 8.3 ± 1.1 mU/mg in darkness). CAT activity levels of control strains harboring a promoterless cat gene
or a cat gene driven by its own promoter were not affected
by light-dark changes (data not shown).

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 3.
Primer extension analysis of the cph1 rcp1
transcript. (A) Total RNA (20 µg) from illuminated (white segment) or
1-h-dark-incubated (black segment) Synechocystis sp. strain
6803 wild-type (WT) and SPHY1 mutant cells was annealed to the pht3
oligonucleotide and extended with reverse transcriptase as described
previously (15). A sequencing ladder used with the same
primer is also shown. An arrow indicates extension products. The
transcription start nucleotide is marked with an asterisk on the
sequence. These results were confirmed for three times with RNAs from
three independent sets of cultures. (B) Sequence of the promoter region
of the cph1 rcp1 operon. The transcription start point is
indicated by a bent arrow. 10 and 35 sequences based on the
transcriptional start site are boxed. The translation start codon is in
lowercase. The putative Shine-Dalgarno sequence is underlined. The
nucleotides are numbered with respect to the first nucleotide of the
translation start codon. Direct repeat sequences are noted by arrows.
|
|
Light-decreased stability of cph1 rcp1 mRNA.
In
order to investigate whether light affects cph1 rcp1 mRNA
stability, we have determined the half-life of the cph1 rcp1 transcript under dark conditions or upon reillumination. For that purpose, rifampin (400 µg/ml) was added to 15-min-dark-treated cells,
and cultures were kept in the dark. Aliquots were taken at 0, 1, 2, 3, 5, and 8 min after the addition of rifampin, and total RNA was isolated
and subjected to Northern blotting. The data showed that, under these
conditions, the half-life of cph1 rcp1 mRNA was close to 2 min (Fig. 4). However, when dark-treated cells were exposed to light in the absence of rifampin, a rapid decrease in transcript level was seen, with a half-life of about 30 s.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 4.
Light-decreased stability of cph1 rcp1 mRNA.
(A) Rifampin (400 µg/ml) was added to 15-min-dark-treated cells, and
cultures were kept in the dark. Aliquots were taken at the indicated
times, and total RNA was isolated. Alternatively, 15-min-dark-treated
cultures were reilluminated (light), and aliquots were taken at the
indicated times for total RNA isolation. Fifteen micrograms of total
RNA was subjected to Northern blot analysis with internal
cph1 probes. (B) Band intensity was determined with an
InstantImager, normalized with respect to the rnpB RNA
level, and plotted against time. Values are the averages of two
independent experiments. Symbols: , reilluminated cells; ,
rifampin-treated cells.
|
|
Effect of spectral quality on expression of the cph1
rcp1 operon.
The results presented above suggest that redox
signals from the photosynthetic apparatus are not involved in the
upregulation of the expression of cph1 rcp1 operon, and
therefore a photoreceptor might be involved in such regulation. As a
first approach to identify this putative photoreceptor, the effect of
spectral quality on expression of the cph1 rcp1 operon was
analyzed. For that analysis, Synechocystis sp. strain PCC
6803 cells grown under normal illumination conditions were transferred
to darkness for 15 min and then exposed to a 3-min pulse (20 µE
m
2 s
1) of blue (
max = 455 nm), green (
max = 500 nm), red
(
max = 650 nm), or far-red (
max = 725 nm) light. As previously shown, dark-treated cells displayed high
cph1 rcp1 mRNA levels. Exposure of the cells to 20 µE of
blue, green, red, or far-red filtered light m
2
s
1 resulted in a drastic decrease in the cph1
rcp1 transcript level (Fig. 5A). In
a second set of experiments, exponentially growing Synechocystis sp. strain PCC 6803 cultures were transferred
to darkness for 15 min, followed by one pulse of 3 min of red
(
max = 650 nm) light (20 µE m
2
s
1). The cells were then harvested or incubated for
another 10 min in the presence of far-red (
max = 725 nm) light (20 µE m
2 s
1). As shown
above, 3 min of red light was enough to elicit a drastic reduction in
the quantity of cph1 rcp1 mRNA. This effect was not reversed
by far-red light (Fig. 5B), suggesting that cph1 rcp1 mRNA
levels do not respond in a typical phytochrome-mediated way.

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 5.
Effect of spectral quality on expression of cph1
rcp1 operon. (A) Northern blot hybridization of total RNA from
Synechocystis sp. strain 6803 cultures grown under normal
illumination conditions (lane 1 [L]), transferred to darkness for 15 min (lane 2 [D]), and then divided into four aliquots that were
illuminated with a 3-min pulse of red (lane 3 [R]), blue (lane 4 [B]), green (lane 5 [G]), or far-red (lane 6 [FR]) light. (B)
Northern blot hybridization of total RNA from Synechocystis
sp. strain 6803 cultures grown under normal illumination conditions
(lane 1), transferred to darkness for 15 min (lane 2), and then given a
red light pulse of 3 min (lane 3), followed by a far-red light pulse of
10 min (lane 4).
|
|
Cph1 kinase activity is not involved in control of cph1
rcp1 mRNA levels.
In monocots, it has been extensively shown
that transcription of the phyA gene is phytochrome dependent
(3, 19). In order to investigate whether Cph1 is responsible
for the light-dark-dependent regulation of the cph1 rcp1
operon expression, we constructed a cph1 mutant strain of
Synechocystis sp. strain PCC 6803 (SPHY1) by interrupting
the cph1 gene with a neomycin phosphotransferase (npt)-containing cassette (C.K1). The cassette was inserted
into the HpaI site localized 712 bp downstream of the
cph1 ATG codon (Fig. 6A).
Complete segregation of the mutation was confirmed by Southern blot
analysis (data not shown). Mutant cells were viable under normal
illumination conditions, and growth rates were similar to those of the
wild-type strain. The study of the expression of cph1 rcp1
operon in SPHY1 mutant cells was carried out by reverse primer
extension of total RNA by using the oligonucleotide pht3, which is
complementary to a region of the cph1 gene upstream of the
cassette integration site. In the SPHY1 mutant cells, the cph1 transcription start point was localized in the same
position as in the wild-type cells (Fig. 3A, lanes 1 and 2). Analysis
of RNA from light- or dark-treated cells indicated that the
cph1 transcript was not induced by darkness in the
Cph1-deficient cells (Fig. 3A, lanes 1 and 2). Similar results were
observed by Northern blotting with a DNA fragment upstream of the C.K1
insertion point as a probe (data not shown). These data might suggest
that Cph1 is the photoreceptor responsible for the light-dark-dependent regulation of cph1 rcp1 mRNA levels. We have shown above
that cph1 rcp1 transcript levels are regulated, at least in
part, by controlling cph1 rcp1 mRNA stability. Since
insertion of the C.K1 cassette into the cph1 rcp1 operon
strongly modifies the structure of the cph1 rcp1 transcript,
this mutation might dramatically change the stability of the
transcript. Therefore, we have constructed, by site-directed
mutagenesis, a Synechocystis strain with a more subtle
inactivation of Cph1 that does not affect cph1 rcp1 mRNA structure. It has been shown previously that the His538 residue of Cph1
is essential for autophosphorylation and phosphotransfer to Rcp1 and,
therefore, for transduction of the light signal (37). We
have constructed an H538R mutant strain of Cph1
(Synechocystis sp. strain SPHY6) by replacing the endogenous
wild-type locus by the mutated variant as described in Materials and
Methods (Fig. 6B). Complete segregation of the mutation was confirmed
by Southern blot analysis (data not shown). Mutant cells were viable
under normal illumination conditions, and growth rates were similar to
those of the wild-type strain. SPHY6 mutant cells displayed a wild-type
phenotype with respect to the light-dark-dependent regulation of the
cph1 rcp1 mRNA levels (Fig. 6C).

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 6.
Inactivation of cph1 in
Synechocystis sp. strain 6803. (A) Structure of the
cph1 rcp1 operon genomic region in the SPHY1 mutant strain.
(B) Structure of the cph1 rcp1 operon genomic region in the
wild-type (WT), SPHY5, and SPHY6 mutant strains. Restriction sites used
for the construction of the mutants are marked. The position of the CAT
codon corresponding to the His538 residue is also marked. Nucleotides
are numbered with respect to the translation start site. (C) Total RNA
was isolated from mid-log-phase Synechocystis wild-type and
SPHY6 mutant cells growing under normal illumination conditions (L) or
subjected to 15 min (L15) or 30 min (L30) in the dark or 30 min after
reillumination (L30). RNA was subjected to Northern blot analysis by
using an internal cph1 probe (see Materials and Methods).
|
|
 |
DISCUSSION |
The sequencing of the complete genome of the cyanobacterium
Synechocystis sp. strain PCC 6803 has uncovered the presence
of a two-component regulatory system (Cph1-Rcp1) whose sensor component shows very significant amino acid identity to the plant phytochrome (20). Our data demonstrate that cph1 and
rcp1 are cotranscribed and that cph1 rcp1
transcript expression is controlled by light.
Yeh et al. have demonstrated that only Cph1-Pr exhibits kinase
activity, suggesting that Cph1-Pr is the active form that transduces the light signal by phosphate transfer to Rcp1 (37). Since
Pfr is supposed to be the active form in plants (27), this
is an important difference between the cyanobacterial system and the plant signal transduction system. Our results indicate that Cph1 and
Rcp1 are expressed mostly under dark conditions. Since Cph1 is de novo
synthesized in the form Pr and in the absence of light is not
photoconverted to Cph1-Pfr (37), our current hypothesis is
that, in the dark, Rcp1 would be phosphorylated. In contrast, in the
light, the low level of Cph1-Pr synthesized is immediately converted
into Pfr, and Rcp1 would be mostly unphosphorylated.
Absence of light seems to be the signal that triggers the accumulation
of cph1 rcp1 transcript. Two obvious possible pathways for
sensing the absence of light can be imagined: directly by a
photoreceptor or indirectly through photosynthetic electron transport
and the redox state of intermediate carriers. Our experiments with the
photosynthetic inhibitors DCMU and DBMIB indicate that complete
cessation of photosynthetic electron transport does not elicit the
accumulation of cph1 rcp1 transcript. Furthermore, the
presence of these inhibitors does not impair the dark effect. These
data suggest that the redox state of photosynthetic electron carriers
is not involved in the regulation of cph1 rcp1 expression and therefore support a direct photoreceptor-dependent-mediated mechanism. In order to investigate what kind of photoreceptor may be
involved in the control of cph1 rcp1 expression,
reillumination experiments were carried out with light of four
different spectral qualities. Light that was red, far-red, blue, or
green was able to downregulate the levels of cph1 rcp1
transcript, suggesting that more than one photoreceptor pathway could
be involved in downregulation of cph1 rcp1 transcript
levels. One obvious possibility is that Cph1 is able to autoregulate
its own mRNA levels. In monocots, it has been shown extensively that
transcription of the phyA gene is phytochrome dependent
(3, 19). However, the results shown in Fig. 5 suggest that
the pattern of cph1 rcp1 accumulation under red and far-red
light does not follow a typical phytochrome-dependent response. Two
Synechocystis cph1 mutant strains were generated in order to
further investigate this possibility: a cph1::C.K1 insertion mutant (SPHY1) and an H538R point mutation (SPHY6) that produces a Cph1 protein unable to phosphorylate Rcp1 and, therefore, unable to transduce the light signal (37). SPHY1 cells
showed uninducible levels of the 5' region of the cph1 rcp1
transcript (Fig. 3A). In contrast, in SPHY6 cells, a normal
dark-dependent induction of the cph1 rcp1 transcript was
observed. While the results obtained with the SPHY1 mutant are
consistent with an autoregulatory mechanism, the results obtained with
the SPHY6 mutant exclude this hypothesis. We propose the following
interpretation for our results. The cph1::C.K1
mutation (SPHY1) results in gross alterations of the cph1
mRNA. The short half-life of the cph1 rcp1 transcript upon
reillumination suggests the existence of a specific degradation
mechanism controlling cph1 rcp1 transcript levels in the
light (Fig. 1B and Fig. 4). The molecular mechanism by which light
controls cph1 rcp1 transcript stability remains to be
elucidated. Thus, it is possible that the interruption of the
cph1 mRNA by the C.K1 cassette affects elements within the cph1 mRNA coding region that confer stability to the message
in darkness. Light-dependent control of mRNA stability determined by
coding region elements has been reported recently for the
psbAI and psbAII genes in the cyanobacterium
Synechococcus sp. strain PCC 7942 (17). In the
SPHY6 strain, we have introduced a point mutation that abolishes the
kinase activity of Cph1 without affecting the structure of the
cph1 rcp1 transcript. Since this strain shows a normal
regulation of cph1 rcp1 transcript levels, we conclude that
the Cph1 signal transduction pathway is not involved in the light-dark-mediated regulation of the cph1 rcp1 transcript levels.
In addition to the control of cph1 rcp1 transcript
stability, we have investigated the possibility that cph1
rcp1 operon transcription is upregulated by absence of light.
Transcriptional fusion experiments with a cat reporter gene
driven by the promoter and leader regions of cph1 showed
only a minor (1.8-fold in the best case) dark-dependent induction, in
contrast to the 5-fold increase in the amount of cph1 rcp1
mRNA promoted by darkness. Furthermore, a transcriptional fusion of the
245 to +168 cph1 region with the green fluorescent protein
gene was also used as a reporter mRNA. The amount of this chimeric mRNA
was only slightly increased by darkness (1.3- to 1.7-fold, depending on
the experiment) (data not shown). Therefore, our experiments suggest
that dark-dependent transcriptional induction represents a minor
contribution to the regulation of the cph1 rcp1 operon expression.
Our results demonstrate that cph1 rcp1 mRNA levels are also
affected by other factors in addition to light. In fact, accumulation of cph1 rcp1 mRNA in dark-incubated Synechocystis
sp. strain PCC 6803 cells is completely inhibited by the presence of
exogenous glucose. Evidence for a specific interaction between plant
phytochrome signaling and carbohydrate metabolism has also been
reported in plants. For example, sucrose can inhibit PhyA-dependent
far-red light-mediated inhibition of greening (1, 7). A
number of anabolic Synechocystis sp. strain PCC 6803 genes
have been shown to be switched off in the dark; however, glucose is
able to abolish this dark-mediated inhibition of expression (12,
21, 22, 28). Since glucose is a source of energy, redox power,
and carbon for Synechocystis sp. strain PCC 6803, it seems
reasonable to imagine that the presence or absence of glucose could
change the way that Synechocystis sp. strain PCC 6803 adapts
to dark conditions.
The fact that cph1 rcp1 mRNA levels are upregulated in
darkness suggests that Synechocystis sp. strain PCC 6803 phytochrome might be involved in the regulation of functions required
for the adaptation from light to dark conditions and vice versa. The expression of many cyanobacterial genes has been shown to be dependent on the circadian rhythms (for a review, see reference
13). A role for the Cph1-Rcp1 system in setting the
circadian clock might also be speculated. Finally, cyanobacterial
phytochrome might be required only under specific stress conditions. In
this regard, preliminary experiments indicate that cph1 rcp1
mRNA levels increase under conditions of nitrogen deficiency (data not
shown). Characterization of cph1 and rcp1 mutants
will be required in order to identify the biological functions
controlled by the cyanobacterial phytochrome.
 |
ACKNOWLEDGMENTS |
We thank F. Chauvat for providing pFF11 plasmid and strains SFF16
and SFC57. We are grateful to J. Weitzman for critical reading of the manuscript.
This work was supported by grants from DGESID (PB97-0732) (Spain) and
by Junta de Andalucía (CVI-0112). M.G.-D. was the recipient of
a predoctoral fellowship from M.E.C. (Spain).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Instituto de
Bioquímica Vegetal y Fotosíntesis, Universidad de
Sevilla-CSIC, Centro de Investigaciones Científicas Isla de la
Cartuja, Av. Américo Vespucio s/n, Isla de la Cartuja, E-41092
Sevilla, Spain. Phone: 34-5-4489518. Fax: 34-5-4620154. E-mail:
floren{at}cica.es.
 |
REFERENCES |
| 1.
|
Barnes, S. A.,
N. K. Nishizawa,
R. B. Quaggio,
G. C. Whitelam, and N. H. Chua.
1996.
Far-red light blocks greening of Arabidopsis seedlings via a phytochrome A-mediated change in plastid development.
Plant Cell
8:601-615[Abstract].
|
| 2.
|
Bradford, M. M.
1976.
A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding.
Anal. Biochem.
72:248-254[CrossRef][Medline].
|
| 3.
|
Bruce, W. B., and P. H. Quail.
1990.
Cis-acting elements involved in photoregulation of an oat phytochrome promoter in rice.
Plant Cell
2:1081-1089[Abstract/Free Full Text].
|
| 4.
|
Chauvat, F.,
L. De Vries,
A. Van der Ende, and G. A. Van Arkel.
1988.
A host vector system for gene cloning in the cyanobacterium Synechocystis PCC 6803.
Mol. Gen. Genet.
204:165-191.
|
| 5.
|
Chauvat, F.,
J. Labarre, and F. Ferino.
1988.
Development of gene transfer system for the cyanobacterium Synechocystis PCC 6803.
Plant Physiol. Biochem.
26:629-637.
|
| 6.
|
Clack, T.,
S. Mathews, and R. A. Sharrock.
1994.
The phytochrome apoprotein family in Arabidopsis is encoded by five genes: the sequences and expression of PHYD and PHYE.
Plant Mol. Biol.
25:413-427[CrossRef][Medline].
|
| 7.
|
Dijkwel, P. P.,
C. Huijser,
P. J. Weisbeek,
N. H. Chua, and S. C. Smeekens.
1997.
Sucrose control of phytochrome A signaling in Arabidopsis.
Plant Cell
9:583-595[Abstract].
|
| 8.
|
Elhai, J., and C. P. Wolk.
1988.
A versatile class of positive-selection vectors based on the nonviability of palindrome-containing plasmids that allows cloning into long polylinkers.
Gene
68:119-138[CrossRef][Medline].
|
| 9.
|
Elich, T. D., and J. Chory.
1997.
Phytochrome: if it looks and smells like a histidine kinase, is it a histidine kinase?
Cell
91:713-716[CrossRef][Medline].
|
| 10.
|
Fankhauser, C., and J. Chory.
1997.
Light control of plant development.
Annu. Rev. Cell Dev. Biol.
13:203-229[CrossRef][Medline].
|
| 11.
|
Ferino, F., and F. Chauvat.
1989.
A promoter-probe vector-host system for the cyanobacterium, Synechocystis PCC6803.
Gene
84:257-266[CrossRef][Medline].
|
| 12.
|
García-Domínguez, M., and F. J. Florencio.
1997.
Nitrogen availability and electron transport control the expression of glnB gene (encoding PII protein) in the cyanobacterium Synechocystis sp. PCC 6803.
Plant. Mol. Biol.
35:723-734[CrossRef][Medline].
|
| 13.
|
Golden, S. S.,
M. Ishiura,
C. H. Johnson, and T. Kondo.
1997.
Cyanobacterial circadian rhythms.
Annu. Rev. Plant Physiol. Plant Mol. Biol.
48:327-354[CrossRef].
|
| 14.
|
Hawley, D. K., and W. R. McClure.
1983.
Compilation and analysis of Escherichia coli promoter DNA sequences.
Nucleic Acids Res.
11:2237-2255[Abstract/Free Full Text].
|
| 15.
|
Hoch, J. A., and T. J. Silhavy (ed.).
1995.
Two-component signal transduction.
American Society for Microbiology Press, Washington, D.C.
|
| 16.
|
Hughes, J.,
T. Lamparter,
F. Mittmann,
E. Hartmann,
W. Gartner,
A. Wilde, and T. Borner.
1997.
A prokaryotic phytochrome.
Nature
386:663[CrossRef][Medline].
|
| 17.
|
Kulkarni, R. D., and S. S. Golden.
1997.
mRNA stability is regulated by a coding-region element and the unique 5'untranslated leader sequences of the three Synechococcus psbA transcripts.
Mol. Microbiol.
24:1131-1142[CrossRef][Medline].
|
| 18.
|
Lamparter, T.,
F. Mittmann,
W. Gartner,
T. Borner,
E. Hartmann, and J. Hughes.
1997.
Characterization of recombinant phytochrome from the cyanobacterium Synechocystis.
Proc. Natl. Acad. Sci. USA
94:11792-11797[Abstract/Free Full Text].
|
| 19.
|
Lissemore, J. L., and P. H. Quail.
1988.
Rapid transcriptional regulation by phytochrome of the genes for phytochrome and chlorophyll a/b-binding protein in Avena sativa.
Mol. Cell. Biol.
8:4840-4850[Abstract/Free Full Text].
|
| 20.
|
Mizuno, T.,
T. Kaneko, and S. Tabata.
1996.
Compilation of all genes encoding bacterial two-component signal transducers in the genome of the cyanobacterium, Synechocystis sp. strain PCC 6803.
DNA Res.
3:407-414[Abstract].
|
| 21.
|
Mohamed, A., and C. Jansson.
1989.
Influence of light on accumulation of photosynthesis-specific transcripts in the cyanobacterium Synechocystis 6803.
Plant. Mol. Biol.
13:693-700[CrossRef][Medline].
|
| 22.
|
Mohamed, A., and C. Jansson.
1991.
Photosynthetic electron transport controls degradation but not production of psbA transcripts in the cyanobacterium Synechocystis 6803.
Plant. Mol. Biol.
16:891-897[CrossRef][Medline].
|
| 23.
|
Parkinson, J. S., and E. C. Kofoid.
1992.
Communication modules in bacterial signaling proteins.
Annu. Rev. Genet.
26:71-112[CrossRef][Medline].
|
| 24.
|
Pepper, A. E.
1998.
Molecular evolution: old branches on the phytochrome family tree.
Curr. Biol.
8:R117-R120[CrossRef][Medline].
|
| 25.
|
Quail, P. H.
1994.
Photosensory perception and signal transduction in plants.
Curr. Opin. Genet. Dev.
4:652-661[CrossRef][Medline].
|
| 26.
|
Quail, P. H.
1997.
The phytochromes: a biochemical mechanism of signaling in sight?
Bioessays
19:571-579[CrossRef][Medline].
|
| 27.
|
Quail, P. H.,
M. T. Boylan,
B. M. Parks,
T. W. Short,
Y. Xu, and D. Wagner.
1995.
Phytochromes: photosensory perception and signal transduction.
Science
268:675-680[Abstract/Free Full Text].
|
| 28.
|
Reyes, J. C., and F. J. Florencio.
1995.
Electron transport controls transcription of the glutamine synthetase gene (glnA) from the cyanobacterium Synechocystis sp. PCC 6803.
Plant Mol. Biol.
27:789-799[CrossRef][Medline].
|
| 29.
|
Rich, P. R.,
A. E. Jeal,
S. A. Madgwick, and A. J. Moody.
1990.
Inhibitor effects on redox-linked protonations of the b haems of the mitochondrial bc1 complex.
Biochim. Biophys. Acta
1018:29-40[Medline].
|
| 30.
|
Rippka, R.,
J. Deruelles,
J. B. Waterbury,
M. Herman, and R. Y. Stanier.
1979.
Genetics assignments, strain histories and properties of pure cultures of cyanobacteria.
J. Gen. Microbiol.
111:1-61.
|
| 31.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 32.
|
Sharrock, R. A., and P. H. Quail.
1989.
Novel phytochrome sequences in Arabidopsis thaliana: structure, evolution, and differential expression of a plant regulatory photoreceptor family.
Genes Dev.
3:1745-1757[Abstract/Free Full Text].
|
| 33.
|
Shaw, W. V.
1975.
Chloramphenicol acetyltransferase from chloramphenicol-resistant bacteria.
Methods Enzymol.
43:737-755[Medline].
|
| 34.
|
Smith, H.
1994.
Phytochrome transgenics: functional, ecological and biotechnological applications.
Semin. Cell Biol.
5:315-325[CrossRef][Medline].
|
| 35.
|
Trebst, A.
1980.
Inhibitors in electron flow: tools for the functional and structural localization of carriers and energy conservation sites.
Methods Enzymol.
69:675-715.
|
| 36.
|
Vioque, A.
1992.
Analysis of the gene encoding the RNA subunits of ribonuclease P from cyanobacteria.
Nucleic Acids Res.
20:6331-6337[Abstract/Free Full Text].
|
| 37.
|
Yeh, K. C.,
S. H. Wu,
J. T. Murphy, and J. C. Lagarias.
1997.
A cyanobacterial phytochrome two-component light sensory system.
Science
277:1505-1508[Abstract/Free Full Text].
|
Journal of Bacteriology, January 2000, p. 38-44, Vol. 182, No. 1
0021-9193/0/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Steinberg, D., Moreinos, D., Featherstone, J., Shemesh, M., Feuerstein, O.
(2008). Genetic and Physiological Effects of Noncoherent Visible Light Combined with Hydrogen Peroxide on Streptococcus mutans in Biofilm. Antimicrob. Agents Chemother.
52: 2626-2631
[Abstract]
[Full Text]
-
Toepel, J., Welsh, E., Summerfield, T. C., Pakrasi, H. B., Sherman, L. A.
(2008). Differential Transcriptional Analysis of the Cyanobacterium Cyanothece sp. Strain ATCC 51142 during Light-Dark and Continuous-Light Growth. J. Bacteriol.
190: 3904-3913
[Abstract]
[Full Text]
-
Patterson-Fortin, L. M., Colvin, K. R., Owttrim, G. W.
(2006). A LexA-related protein regulates redox-sensitive expression of the cyanobacterial RNA helicase, crhR. Nucleic Acids Res
34: 3446-3454
[Abstract]
[Full Text]
-
Froehlich, A. C., Noh, B., Vierstra, R. D., Loros, J., Dunlap, J. C.
(2005). Genetic and Molecular Analysis of Phytochromes from the Filamentous Fungus Neurospora crassa. Eukaryot Cell
4: 2140-2152
[Abstract]
[Full Text]
-
Singh, A. K., Sherman, L. A.
(2005). Pleiotropic Effect of a Histidine Kinase on Carbohydrate Metabolism in Synechocystis sp. Strain PCC 6803 and Its Requirement for Heterotrophic Growth. J. Bacteriol.
187: 2368-2376
[Abstract]
[Full Text]
-
Salem, K., van Waasbergen, L. G.
(2004). Light Control of hliA Transcription and Transcript Stability in the Cyanobacterium Synechococcus elongatus Strain PCC 7942. J. Bacteriol.
186: 1729-1736
[Abstract]
[Full Text]
-
Singh, A. K., McIntyre, L. M., Sherman, L. A.
(2003). Microarray Analysis of the Genome-Wide Response to Iron Deficiency and Iron Reconstitution in the Cyanobacterium Synechocystis sp. PCC 6803. Plant Physiol.
132: 1825-1839
[Abstract]
[Full Text]
-
Rott, R., Zipor, G., Portnoy, V., Liveanu, V., Schuster, G.
(2003). RNA Polyadenylation and Degradation in Cyanobacteria Are Similar to the Chloroplast but Different from Escherichia coli. J. Biol. Chem.
278: 15771-15777
[Abstract]
[Full Text]
-
Tuominen, I., Tyystjarvi, E., Tyystjarvi, T.
(2003). Expression of Primary Sigma Factor (PSF) and PSF-Like Sigma Factors in the Cyanobacterium Synechocystis sp. Strain PCC 6803. J. Bacteriol.
185: 1116-1119
[Abstract]
[Full Text]
-
Ogawa, T., Bao, D. H., Katoh, H., Shibata, M., Pakrasi, H. B., Bhattacharyya-Pakrasi, M.
(2002). A Two-component Signal Transduction Pathway Regulates Manganese Homeostasis in Synechocystis 6803, a Photosynthetic Organism. J. Biol. Chem.
277: 28981-28986
[Abstract]
[Full Text]