Previous Article | Next Article ![]()
Journal of Bacteriology, May 2000, p. 2761-2770, Vol. 182, No. 10
Max-Planck-Institut für Molekulare
Genetik, D-14195 Berlin, Germany1;
Institute for Molecular Plant Sciences, Clusius
Laboratory, Leiden University, 2333 AL Leiden, The
Netherlands2; and Departamento de Biologia
Molecular, Facultad de Medicina, Universidad de Cantabria, s/n
39011 Santander, Spain3
Received 13 December 1999/Accepted 1 March 2000
Type IV secretion systems direct transport of protein or
nucleoprotein complexes across the cell envelopes of prokaryotic donor
and eukaryotic or prokaryotic recipient cells. The process is mediated
by a membrane-spanning multiprotein assembly. Potential NTPases
belonging to the VirB11 family are an essential part of the
membrane-spanning complex. Three representatives of these NTPases
originating from the conjugative transfer regions of plasmids RP4
(TrbB) and R388 (TrwD) and from the cag pathogenicity
island of Helicobacter pylori (HP0525) were overproduced
and purified in native form. The proteins display NTPase activity with
distinct substrate specificities in vitro. TrbB shows its highest
specific hydrolase activity with dATP, and the preferred substrate for HP0525 is ATP. Analysis of defined TrbB mutations altered in motifs conserved within the VirB11 protein family shows that there is a
correlation between the loss or reduction of NTPase activity and
transfer frequency. Tryptophan fluorescence spectroscopy of TrbB and
HP0525 suggests that both interact with phospholipid membranes,
changing their conformation. NTPase activity of both proteins was
stimulated by the addition of certain phospholipids. According to our
results, Virb11-like proteins seem to most likely be involved in the
assembly of the membrane-spanning multiprotein complex.
Translocation of macromolecules
across the cell envelope of gram-negative bacteria is facilitated by
multiprotein complexes classified in four major families and designated
as type I to type IV secretion systems (for recent reviews, see
references 4, 8, 20, and 34).
Type IV systems are characterized by their unique ability to transfer
both DNA and protein molecules unidirectionally to recipient cells.
Interestingly, type IV transfer of DNA is apparently always coupled to
protein secretion, whereas protein transfer takes place independently
and thus is not coupled to DNA transfer. In fact, several type IV
systems that are apparently exclusively dedicated to protein transfer
have been recently discovered (9, 38, 39a, 43).
Type IV systems comprise the DNA transfer systems specified by
conjugative plasmids (29), the agrobacterial T-DNA transfer system (14), and the pertussis toxin secretion system
encoded by Bordetella pertussis (Ptl) (43). In
the course of the last 2 years, other pathogenicity-related type IV
secretion systems have been discovered: Legionella
pneumophila Dot/Mrc, which is required for intracellular
propagation of the bacterium but also catalyzes the transfer of DNA
(39, 42), and the Helicobacter pylori cag
pathogenicity island (9), which is involved in the induction
of the inflammatory response of infected epithelial cells. Recently,
the genome sequence of the obligate intracellular pathogen
Rickettsia prowazekii (1) and
Actinobacillus actinomycetemcomitans revealed the presence
of a gene cluster that evidently encodes another representative of type
IV secretion systems. In addition, a type IV secretion system homologue
essential for intracellular multiplication has been found in
Brucella suis (11).
The presence of gene products with nucleoside triphosphate (NTP)
binding motifs in all four families of secretion systems reflects a
common requirement for an energy source to drive the macromolecular
transport reaction or to assemble the membrane-spanning transport
complex. That also underscores the general importance of these proteins
for understanding macromolecule secretion. Whereas traffic nucleoside
triphosphate hydrolases (NTPases) of type I systems are integral inner
membrane proteins, those from types II, III, and IV have been found in
peripheral association at the cytoplasmatic side of the inner membrane
or, at least partially, in the cytoplasm (10, 16, 26, 31-34, 36,
41).
Interestingly, NTPases encoded by type II and type IV systems are
evolutionary related, as suggested by a high degree of sequence relationship (31, 33).
Here, we report the purification of three potential NTPases from type
IV systems: the TrbB and TrwD proteins, encoded by the conjugative
plasmids RP4 (IncP This study was organized by using three prototype proteins of
well-defined systems in order to settle some controversies raised in
previous publications. For instance, VirB11 solubilized under denaturing conditions (10) and GST (glutathione
S-transferase)(226-230)-TrwD (33) were reported
as active ATPases while MBP (maltose binding protein)-VirB11
(40) was reported not to hydrolyze ATP (10, 40).
Here, we report on the enzymology of the purified proteins, all three
displaying NTPase activity in vitro. cag HP0525 and RP4 TrbB
interact with phospholipid membranes as demonstrated by fluorescence
spectroscopy. Possible functions of transport NTPases within the
process of assembly of the transport complex or in energizing the
translocation reaction are discussed.
Bacterial strains, plasmids, and medium.
E. coli K-12
strains SCS1 (18) and HB101 (6) were used as
hosts for plasmids. HB101 Nxr is a spontaneous nalidixic
acid-resistant derivative of HB101 that served as a recipient in
conjugative experiments. Cells were grown in YT medium (27)
buffered with 3-(N-morpholino)propanesulfonic acid (sodium
salt, pH 8.0) and supplemented with 0.1% glucose and 25 µg of
thiamin hydrochloride per ml. When appropriate, antibiotics were added
as follows: ampicillin (sodium salt), 100 µg/ml; chloramphenicol, 10 µg/ml; and nalidixic acid, 30 µg/ml. Plasmids used in this study
are listed in Table 1.
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Enzymology of Type IV Macromolecule Secretion
Systems: the Conjugative Transfer Regions of Plasmids RP4 and R388 and
the cag Pathogenicity Island of Helicobacter
pylori Encode Structurally and Functionally Related Nucleoside
Triphosphate Hydrolases

![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
) and R388 (IncW), respectively, and the
cag HP0525 protein specified by the cag
pathogenicity island of H. pylori. All three proteins were
overproduced in soluble form in Escherichia coli and were
purified by conventional column chromatography. Purification procedures
were carried out under native conditions and with the unmodified proteins.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
TABLE 1.
Plasmids used in this study
Reagents and buffers. Heparin-Sepharose CL-6B, HiTrap heparin, HiTrap Q, and Superose-12 columns were obtained from Pharmacia Biotech. Hydroxylapatite HT gel was from Bio-Rad. Unlabeled nucleoside triphosphates were from Roche Molecular Biochemicals. Radioactive nucleotides were obtained from Amersham Corp. All enzymes were obtained from New England Biolabs and used under the conditions recommended by the manufacturer. Buffer A consisted of 20 mM Tris-HCl (pH 7.6), 0.1 M NaCl, 1 mM dithiothreitol, 0.1 mM EDTA, and 10% glycerol. Buffer B, used for hydroxylapatite chromatography, was made of 20 mM potassium phosphate (pH 6.9), 50 mM KCl, 1 mM dithiothreitol, and 10% glycerol. Buffer C was used for NTPase assays and contained 50 mM 2-(cyclohexylamino)ethanesulfonic acid (CHES) (pH 9.5), 2 mM MgCl2, 50 mM KCl, 1 mM dithiothreitol and 50 µg of bovine serum albumin per ml.
DNA techniques.
Standard molecular cloning techniques were
performed by the methods described in Sambrook et al. (35).
PCR fragments were generated by using DeepVentR DNA
polymerase under the condition recommended by the manufacturer. Plasmid
pSK126 is an in-frame deletion mutant of trbB based on
plasmid pDB126 (2). For its construction, pDB126 was
digested with EcoRI and NdeI, and the resulting
1,130-bp fragment was isolated and digested with BsrI. The
22.6-kb fragment from pDB126, the 171-bp
BsrI-NdeI fragment from the BsrI
digestion, and an EcoRI-BsrI linker
(AATTCGTAGGGGTTACTGAAAAGTGAGC [18,825 to 18,830 bp]) and TCACTTTTCAGTAACCCCTACG [18,825 to
18,828 bp]) were used for a ligation reaction, yielding pSK126. The
RP4 sequence is shown in italics; the numbers in brackets refer to sequence coordinates of RP4 (accession no. M93696). The construction was verified by sequencing. DNA fragments containing trwD
were generated by the PCR with pSU4116 plasmid DNA (33) as
the template by applying two different primer pairs
(GGGAATTCATATGTCTACAGTCTCGAAAGC [8,355 to 8,374 bp] [ATG start] or GGGAATTCATATGGCGCAACTCCTGCG [8,419 to 8,434 bp] [GTG start] and
GGGTTTAAGCTTCCCCGATACAGCCG [9,449 to 9,464 bp]
[R388, accession no. X81123]). The resulting PCR fragments were
treated with NdeI and HindIII and were
inserted into the multicloning site of pMS470
8 (3),
yielding pMS55.1 (ATG start) and pMS55.2 (GTG start). Application of
the PCR with a primer pair
(GGAATAAGCATATGACTGAAGACAGATTGAG
[complementary to the sequence with accession no. AC1000108] [28,041
to 28,071 bp]; nucleotides in italics deviate from those in the
AC1000108 sequence] and
GGTGTTATACAAAAAAGCTTCCATTGGCC [29,047 to 29,076 bp])
and H. pylori NCTC11638 chromosomal DNA (generously
provided by Antonello Covacci, Siena, Italy) resulted in the generation of a PCR fragment (1,036 bp) containing the complete HP0525
reading frame. Restriction sites NdeI and
HindIII were introduced with the primers so that the
NdeI-HindIII-treated PCR fragment could be
inserted into the multicloning site of the expression vector pMS470
8, resulting in pWP4760.
Mutagenesis of the RP4 trbB coding region.
Three
trbB point mutations were generated by using the QuickChange
site-directed mutagenesis kit (Stratagene) under the conditions recommended by the manufacturer. pMS54 (28) was used as the template. Oligonucleotide primers applied for K161A were
GGTACTGGCTCGGGCGCGACCACGCTCGTC (19,290 to 19,320 bp) and GACGAGCGTGGTCGCGCCCGAGCCAGTACC (19,290 to 19,320 bp), primers applied for D186A were
CGTCATCATCGAGGGCCTCGATGATGACG (19,367 to 19,395 bp]), and primers applied for R217T were
CAAGACAACGCTGACTATGCGCCCCGACC (19,460 to 19,489 bp) and GGTCGGGGCGCATAGTCAGCGTTGTCTTG (19,460 to
19,489 bp). Deviations from the wild-type (wt) trbB sequence are underlined. Plasmids were digested with KpnI and
HindIII, and fragments containing the mutations were
subcloned into pMS470
8 (3), resulting in the plasmids
pMS54K161A, pMS54D186A, and pMS54R217T. Base exchanges introduced in
trbB were verified by nucleotide sequencing. For the
complementation assay, the SphI and KpnI
fragments of the plasmids pMS54K161A, pMS54D186A, and pMS54R217T
containing the mutation were used to replace the SphI and
KpnI fragment in pDB179.
Complementation assay. Conjugation experiments employed E. coli HB101 Nxr as the recipient and E. coli HB101 carrying pSK126 and pDB179 as the donor. With a donor-to-recipient cell ratio of 1:10, mixed cultures were filtered on Millipore type HA filters (0.45-µm pore size) and the filters were incubated on YT agar plates without selection for 45 min at 37°C and were washed in 10 mM MgSO4. Serial dilutions were plated onto selective media. Transfer frequencies were expressed as the number of transconjugants per donor cell. Conjugation experiments involving the R388 trwD overexpression plasmids pMS55.1 and pMS55.2 were performed on solid media as described previously (33).
Protein purification.
All operations were carried out at
4°C unless noted otherwise. Protein concentration was analyzed by
using the Bradford reagent (7) obtained commercially from
Bio-Rad. The results from typical preparations of RP4 TrbB,
cag HP0525, and R388 TrwD are summarized in Table
2. Cultures (1.2 liters in 5-liter
flasks) of SCS1 (pMS54), SCS1 (pWP4760), or SCS1 (pMS55.1) were grown
by shaking at 37°C to an A600 of 0.5. Isopropyl-
-D-thiogalactopyranoside (IPTG) was added to a
final concentration of 1 mM, and growth was continued for 5 h.
Cells were harvested by centrifugation at 20°C, were resuspended in 5 ml of spermidine solution (100 mM spermidine · 3 HCl, 200 mM
NaCl, 2 mM EDTA) per g of [wet weight] of cells, and were stored in
liquid nitrogen at
70°C.
|
Purification of RP4 TrbB.
Cells (wet weight, 7 g) were
thawed, supplemented with 40 ml of a solution containing 10% sucrose,
100 mM Tris-HCl [pH 7.6], 0.6 ml of lysozyme (50 mg/ml), and 1.4 ml
of 10% Brij-58 and 29 ml of a solution containing 5% sucrose, 100 mM
Tris-HCl [pH 7.6], and 100 mM NaCl. The mixture was stirred for 90 min. After centrifugation at 100,000 × g for 90 min,
supernatant I was kept, the pellet was resuspended in 100 ml of buffer
A supplemented with 1 M NaCl (final concentration), and the mixture was
stirred for 90 min. The resulting lysate was centrifuged at
100,000 × g for 90 min. Supernatant II was combined
with supernatant I (fraction I, 164 ml). Fraction I was saturated with
(NH4)2SO4 to 60% and was stirred for 2 h. Precipitated proteins were collected by centrifugation at
100,000 × g for 45 min and were resuspended in 100 ml
of buffer A with 500 mM NaCl (fraction II, 100 ml). Fraction II was
dialyzed against buffer A until a conductivity equivalent to that of
buffer A was reached and was applied at a flow rate of 50 ml/h to a
heparin-Sepharose column (15 by 110 mm) equilibrated with buffer A and
50 mM NaCl. Proteins were eluted with 400 ml of a linear gradient from
50 mM to 600 mM NaCl in buffer A. TrbB eluted at 375 mM NaCl. The peak
fractions were pooled (fraction III, 45 ml). Fraction III was applied
directly, at a flow rate of 50 ml/h, to a hydroxylapatite column (15 by
100 mm) equilibrated with buffer B. The column was washed with 60 ml of
buffer B and then with 60 ml of buffer B containing 250 mM potassium
phosphate. Proteins were eluted with 60 ml of buffer B with 500 mM
potassium phosphate, and fractions containing TrbB were pooled
(fraction IV, 29 ml). To concentrate fraction IV, it was dialyzed
against buffer A with 200 mM NaCl and 20% polyethylene glycol (PEG)
20,000. TrbB has been stored in 50% glycerol in buffer A with 200 mM
NaCl at
20°C without loss of activity for 3 years.
Purification of H. pylori cag HP0525.
Cells (13 g [wet weight] in spermidine solution, 80 ml) were lysed at 0°C in
a solution containing 5% sucrose, 100 mM Tris-HCl [pH 7.6], 100 mM
NaCl, 0.25% Brij-35, and 0.2 mg of lysozyme per ml (final
concentrations are given) (final volume, 325 ml). After 90 min, the
highly viscous lysate was centrifuged at 100,000 × g
for 90 min. Proteins in the supernatant (300 ml) were precipitated by
the addition of (NH4)2SO4 (60%
saturation at 0°C). Following stirring at 0°C for 2 h, the
precipitate was collected by centrifugation for 30 min at
10,000 × g. Pellets were resuspended in 80 ml of buffer A containing 0.01% Brij-35 and were dialyzed against several changes of the same buffer (fraction I, 80 ml). Fraction I (two aliquots of 40 ml each) was applied to a 5-ml HiTrap Q column equilibrated in buffer A-0.01% Brij-35. Using Pharmacia fast protein liquid chromatography equipment, proteins were eluted with a 40-ml linear gradient of 100 to 600 mM NaCl in buffer A-0.01% Brij-35, and
5-ml fractions were collected. HP0525 eluted at approximately 400 mM
NaCl (fraction II, 10 ml). Fraction II (two aliquots of 5 ml each) was
applied to a 5-ml hydroxylapatite column equilibrated in buffer B. Proteins were eluted with a 30-ml linear gradient from 20 to 350 mM
potassium phosphate in buffer B, and 2.5-ml fractions were collected.
HP0525 eluted at 190 mM potassium phosphate (fraction III, 15 ml).
Prior to gel filtration, fraction III was concentrated by dialysis
against 20% PEG 20,000 in buffer A-0.01% Brij-35. When a final
volume of 3.5 ml was reached, several 200-µl aliquots, each
containing 1 mg of protein, were applied to a Superose 12 column (10 by
300 mm) preequilibrated in buffer A-0.01% Brij-35. Proteins were
eluted at a flow rate of 0.5 ml/min, and 0.5-ml fractions were
collected. Fractions containing HP0525 were pooled, were concentrated
by dialysis against 20% PEG 20,000 in buffer A-0.01% Brij-35, and
were finally dialyzed against 50% glycerol in buffer A-0.01% Brij-35
(fraction IV, 2 ml). Fraction IV was stored at
20°C without loss of
activity for 1 year.
Purification of R388 TrwD.
Cells (10 g [wet weight] of
bacterial pellet) were thawed and supplemented with 52 ml of a solution
containing 10% sucrose, 100 mM Tris-HCl [pH 7.6], 1.75 ml of
lysozyme (50 mg/ml), 3.92 ml of 10% Brij-58, 20 ml of 5 M NaCl, and
123 ml of 5% sucrose-100 mM Tris-HCl [pH 7.6]-100 mM NaCl and were
stirred for 90 min. Following centrifugation at 100,000 × g for 90 min, supernatant I was kept and the pellet was
resuspended in 40 ml of buffer A supplemented with 1 M NaCl (final
concentration) and was stirred for 90 min. The resulting lysate was
centrifuged at 100,000 × g for 90 min, and supernatant
II was combined with supernatant I (fraction I, 212 ml). Fraction I was
saturated with (NH4)2SO4 to 60%
and was stirred for 2 h. Precipitated proteins were collected by
centrifugation at 100,000 × g for 45 min and were
resuspended in 35 ml of buffer A with 500 mM NaCl (fraction II, 35 ml).
Fraction II was dialyzed against buffer A-150 mM NaCl to a conductivity equivalent to that of buffer A-150 mM NaCl and was applied, at a flow
rate of 50 ml/h, to a heparin-Sepharose column (15 by 280 mm)
equilibrated with buffer A-150 mM NaCl. Proteins were eluted with 500 ml of a linear gradient of 150 to 600 mM NaCl in buffer A. TrwD eluted
at 220 mM NaCl. The peak fractions were pooled (fraction III, 150 ml).
Fraction III was applied directly, at a flow rate of 50 ml/h, to a
hydroxylapatite column (15 by 140 mm) equilibrated with buffer B. The
column was washed with 150 ml of buffer B. Proteins were eluted with
250 ml of a linear gradient of 20 to 500 mM potassium phosphate in
buffer B, and fractions containing TrwD were pooled (fraction IV, 120 ml). To concentrate fraction IV, it was dialyzed against buffer A with
500 mM NaCl and 20% PEG 20,000. TrwD has been stored in 50% glycerol
in buffer A with 500 mM NaCl at
20°C without loss of activity for 1 year.
NTPase Assay.
NTP hydrolysis reactions (20 µl) were
performed with 1.5 µM purified protein at 30°C for 20 min in buffer
C containing 0.1 µCi of [
-32P]- or
[
-32P]NTP and 0.2 mM unlabeled NTP. Reaction products
were separated by thin-layer chromatography on cellulose MN300
polyethyleneimine from Macherey-Nagel (37), and radioactive
NTP and nucleoside diphosphate (NDP) or Pi were quantified
by using storage phosphor technology (22) and the ImageQuant
software (Molecular Dynamics).
Preparation of phospholipid membranes. Phospholipids were purchased from Sigma as 10-mg/ml solutions in chloroform-methanol (9:1). The required amount was dried under a nitrogen stream and was suspended at a concentration of 1 mg/ml in the appropriate volume of 20 mM Tris-HCl [pH 7.6] and 100 mM NaCl. Samples were sonicated for 15 min at 10°C and were used immediately for further experiments.
| |
RESULTS |
|---|
|
|
|---|
Heterologous overexpression of RP4 trbB, cag
HP0525, and R388 trwD in E. coli results
in overproduction of a soluble protein.
The trbB
structural gene was obtained via NdeI restriction of RP4
(28). HP0525 and trwD structural genes
were obtained from PCR fragments. The trwD open reading
frame contains two potential start codons: an ATG initiation codon and
a GTG located 22 codons downstream. Rivas et al. (33) have
demonstrated that an N-terminal GST fusion to Ser-2 of TrwD was fully
active in vivo. To test whether trwD starts with the ATG or
the GTG initiation codon, two corresponding PCR fragments were
generated, resulting in pMS55.1 (ATG start) and pMS55.2 (GTG start).
Genes were placed under transcriptional control by the tac
promoter and under translational control by the T7 gene 10 Shine-Dalgarno sequence by insertion into the vector pMS470
8 (Fig.
1). The insertions were sequenced after
molecular cloning. Induction of the resulting strains SCS1(pMS54),
SCS1(pWP4760), SCS1(pMS55.1), and SCS1(pMS55.2) with 1 mM IPTG for
5 h resulted in overproduction of additional polypeptides with
apparent molecular masses of 32, 35, 44, and 41 kDa, respectively.
These values are in good agreement with the calculated masses for TrbB
(34,995.1 Da) and HP0525 (37,579.5 Da), respectively. The mass of the
protein produced by SCS1(pMS55.1) differs significantly from the
calculated molecular mass of TrwD (38,002.4 Da), but the mass of the
protein produced in SCS1(pMS55.2) is in good agreement with the
calculated mass. However, the latter protein was not functional in vivo
(vide infra). Given the rather acidic calculated pI of TrwD of 5.9, the
difference of the mass of TrwD and the calculated molecular mass is not
unexpected. All three proteins could be identified in Coomassie
blue-stained sodium dodecyl sulfate (SDS)-polyacrylamide gels
representing approximately 52% of the SDS-soluble proteins in
SCS1(pMS54), approximately 12% of the SDS-soluble proteins in
SCS1(pWP4760), and approximately 62% of the SDS-soluble proteins in
SCS1(pMS55.1) (Fig. 2). Solubility
studies indicated that at least 50% of the overproduced proteins were
soluble under low-salt conditions (50 mM NaCl) in buffers containing
0.1% of the nonionic detergent Brij-35 or Brij-58. These soluble
protein fractions served as the starting material for purification of
TrbB, HP0525, and TrwD.
|
|
Overproduced proteins are functional in complementing corresponding mutants in vivo. pDB179 (trbB, trbC) was able to complement an in-frame deletion mutation of trbB in vivo as shown by a complementation assay. TrbB alone was not able to restore the wt transfer efficiency of the trbB deletion mutant (data not shown). This phenomenon was also observed for the complementation of a multiple reading frame insertion linker insertion mutation in trbB (17, 25). pMS55.1 (trwD, ATG start) was shown to be active in vivo by applying a complementation assay. pMS55.2 (trwD, GTG start) could not complement a trwD mutant (data not shown), indicating that the trwD gene starts with an ATG. A corresponding complementation assay for the overexpressed HP0525 gene was not performed. However, it is known that nonpolar knockout mutants in HP0525 are impaired in eliciting interleukin-8 production, and hence the inflammatory response in infected mammalian cells, demonstrating the functional importance of HP0525 for the H. pylori cag region (A. Covacci, personal communication).
Purification of RP4 TrbB. The purification of TrbB from an extract of the overproducing strain SCS1 (pMS54) is summarized in Table 2. TrbB was purified by heparin-Sepharose chromatography followed by hydroxylapatite chromatography. With a sodium chloride gradient, TrbB eluted as a single peak at 375 mM NaCl from heparin-Sepharose (data not shown). This protein solution consisted mainly of TrbB and lysozyme (the latter was used to break up the cells). Lysozyme was separated from TrbB by hydroxylapatite chromatography. TrbB eluted as a single peak when the column was washed with 500 mM potassium phosphate. The preparation of purified TrbB (fraction IV) was 99.8% pure as judged by Coomassie blue staining of an SDS-15% polyacrylamide gel (Fig. 2, lane c).
Purification of cag HP0525. HP0525 was purified to near homogeneity by a fast protein liquid chromatography-based three-step procedure (Table 2). Surprisingly, HP0525 did not bind to heparin columns under low-salt conditions, as did TrbB or TrwD. Therefore, anion-exchange chromatography on HiTrap Q was chosen as the first purification step. A second chromatography step on hydroxylapatite yielded an almost pure protein fraction. Remaining impurities were removed by gel filtration on Superose 12, resulting in a 98.3% pure preparation of HP0525 (Table 2 and Fig. 2, lane f).
Purification of R388 TrwD. The purification of TrwD from an extract of the overproducing strain SCS1(pMS55.1) is summarized in Table 2. TrwD was purified by applying the same two-step procedure as for TrbB. However, TrwD was found to bind less tightly than TrbB to both heparin-Sepharose and hydroxylapatite. Elution from heparin-Sepharose took place at 220 mM NaCl and from hydroxylapatite at 160 mM potassium phosphate when a linear potassium phosphate gradient was applied. The preparation of TrwD (fraction IV) was 93.4% pure as judged by Coomassie blue staining of an SDS-15% polyacrylamide gel (Fig. 2, lane i).
R388 TrwD forms ring-shaped oligomers. Image processing of TrbB and HP0525 micrographs showed that both proteins form hexameric ring-shaped assemblies (23). Electron microscopy was applied to purified TrwD to verify that the oligomeric structure most likely hexameric is also common to TrwD. Experiments were carried out as described previously (23).
As already demonstrated for TrbB, TrwD also formed ring-shaped complexes in the presence of ATP and Mg2+. Similar to TrbB, TrwD oligomers were not very stable, resulting in partially disassembled protein complexes such as open rings and lower oligomers that were detectable among the familiar ring-shaped assemblies (Fig. 3). We were not able to stabilize the TrwD structure by using glutaraldehyde, as it was possible for TrbB since TrwD tends to aggregate under these conditions. Interestingly, tube-like structures were also observed (Fig. 3).
|
RP4 TrbB, cag HP0525, and R388 TrwD display NTPase
activity in vitro.
The most prominent feature in the amino acid
sequences of PulE family proteins is the presence of a conserved NTP
binding motif. To explore the functional significance of this element, we tested purified preparations of TrbB and HP0525 for NTPase activity
in vitro. TrbB NTPase activity was characterized under standard
conditions (see Materials and Methods) when not indicated otherwise.
Purified TrbB protein hydrolyzed [
-32P]dATP,
[
-32P]GTP, and [
-32P]ATP to the
corresponding nucleoside diphosphate and Pi as shown by
thin-layer chromatography. The dATPase activity coincided with the
protein peak when purified TrbB was subjected to glycerol gradient
centrifugation, indicating that the detected activity is not due to
impurities (23). At pH 7.5 and 2 mM Mg2+, GTP
and ATP were found to be poorer substrates than dATP since the rate of
hydrolysis was one-third and 1/10, respectively, that of dATP. dATPase
activity was assayed in the presence of 200 µM dATP, and the other
ribo- or deoxyribonucleoside triphosphates were added to the assay to
determine whether they can compete for binding to TrbB (Fig.
4A). None of the tested nucleotides was
found to be a better substrate for this enzyme. dATPase, GTPase, and
ATPase activities were also determined when each of the two other
nucleotides was competing for binding to TrbB. Thus, a decrease of the
hydrolyzing activity compared to the activity with the labeled
nucleotide alone would indicate a better binding of the added unlabeled
nucleotide to the active site of TrbB. This assay showed that TrbB
bound ATP more tightly than GTP and dATP; however, it hydrolyzed dATP
with the highest efficiency. Native single-stranded DNA of
bacteriophage M13 mp19 did not stimulate the dATPase, ATPase, or GTPase
activity.
|
Phospholipids stimulate NTP hydrolase activity of RP4 TrbB and
cag HP0525.
Neither TrbB nor HP0525 or TrwD contain
apparent membrane-spanning domains. However, several VirB11-like
proteins colocalize with the inner membrane fraction in sedimentation
experiments (10, 16, 32, 33). Linked to this observation, it
was found that the ATP hydrolase activity of GST(226-230)-TrwD was
enhanced by phospholipids (33). Therefore, the influence of
phospholipids, the main constituents of the inner bacterial membrane,
on the NTP hydrolase activity of both TrbB and HP0525 was analyzed.
Phospholipid membrane suspensions were incubated at various
concentrations with TrbB and HP0525, and the amount of hydrolyzed input
(d)ATP was determined after incubation for 30 min at 30°C (Fig.
5). Both TrbB and HP0525 are stimulated
up to about twofold at 0.25 µg of cardiolipin (CL) and
phosphatidylglycerol (PG) per µl. In both proteins, higher
concentrations (0.5 µg/µl) do not lead to a significantly different
stimulatory effect. Phosphatidylethanolamine (PE) had no significant
effect on either protein (Fig. 5).
|
RP4 TrbB and cag HP0525 undergo conformational changes in the presence of phospholipids. Tryptophan fluorescence spectroscopy was applied to see whether the stimulation of NTP-hydrolase activity that is observed with HP0525 and TrbB in the presence of phospholipids is reflected by conformational changes of the proteins. Both TrbB and HP0525 contain only two tryptophan residues each, which served as convenient probes to monitor polarity changes in the environment of the corresponding protein domains. The tryptophan residues within TrbB are well separated (Trp-47 to Trp-240), thus occupying different domains of the protein, whereas the tryptophan residues in HP0525 are separated by only six amino acids (Trp-57 to Trp-64).
The fluorescence spectrum of TrbB shows a peak with a maximum at 336 nm and a shoulder that corresponds to an estimated peak maximum around 325 nm (Fig. 6). Addition of PE resulted in a moderate quench of fluorescence intensity by about 50%. The maximum of fluorescence intensity in the presence of PE was shifted to 342 nm (Fig. 6A), indicating an increase of the polarity in the environment of the respective tryptophan residue (24). The position of the shoulder remained unaffected. Hexameric rings of TrbB are known to be stabilized by nucleotides and Mg2+ (23); therefore, the influence of ATP and Mg2+ on the fluorescence spectrum of TrbB was tested. Subsequent addition of ATP in the presence of Mg2+ had no effect on the TrbB fluorescence spectrum (data not shown). However, the shift of the peak maximum that was caused by addition of PE was not observed when TrbB was preincubated with ATP and Mg2+ (Fig. 6B). Incubation of TrbB with CL or PG under the same conditions gave virtually identical results (data not shown). Therefore, Fig. 6 illustrates only the data obtained with PE, the most abundant phospholipid in the E. coli cytoplasmic membrane (15).
|
|
The nucleotide binding site type A of RP4 TrbB is essential for conjugative transfer. Four highly conserved motifs are common among the members of the VirB11 family: a nucleotide binding site type A (Walker A Box), an aspartate box (Asp Box), a nucleotide binding site type B (Walker B Box), and a histidine box (His Box) (23, 33). For functional and structural studies of TrbB, we chose lysine 161 in the Walker A Box, aspartate 186, and arginine 217 in the Walker Box as targets for site-directed mutagenesis. Rules for amino acid replacements were followed to minimize structural distortions in the protein (5).
For measuring conjugative plasmid transfer, the complementation assay system employed strains carrying pSK126(
trbB) and
pDB179 or deviates of pDB179 (see Materials and Methods). A mutation in
the Walker A Box of TrbB (K161A) abolished the capacity to restore
conjugation in the complementation assay, whereas the other two
mutations in the Asp Box (D186A) and in the Walker B Box (R217T) only
slightly affected transfer (Table 3).
|
| |
DISCUSSION |
|---|
|
|
|---|
We have overproduced and purified three representatives from the VirB11 family of transport NTPases. All three proteins were obtained in substantial amounts in E. coli, and the majority of the material appeared as soluble protein in the cytoplasmatic fraction, allowing purification under native conditions. Thus, a comparative study of the enzymatic properties of three related NTPases encoded by type IV secretion systems was possible.
TrbB, GST(226-230)-TrwD (33), TrwD (data not shown), and HP0525 display a rather weak NTPase activity in vitro within an order of magnitude, similar to chaperons like DnaK (44) and ClpA (21). It is therefore very suggestive that NTP hydrolysis is used by these proteins to energize a chaperone-like process involved in the assembly of the membrane-spanning multiprotein complex. Interestingly, the substrate spectra of TrbB and HP0525 differ considerably in vitro. Substrates for TrbB are dATP, GTP, and ATP, whereas HP0525 has a much wider spectrum with a preference for ATP and dATP. In contrast to TrbB, GTP does not compete for ATP hydrolysis by HP0525. The biological significance of these differences remains to be elucidated.
Mutant protein TrbB K161A was deficient in restoring wt transfer frequency in a trbB0 mutant strain and did not hydrolyze any of the nucleotide substrates used by TrbB. The analyses of the NTPase activity of TrbB D186A and TrbB R217T, which were both able to mediate conjugation, did not allow a clear-cut conclusion because some of the NTPase activities of the mutant proteins were close to the detection level of the method. There is a correlation between loss or reduction of NTPase activity and transfer frequency, but, surprisingly, transfer has decreased only to levels of 25% (TrbB D186A) or 50% (TrbB R217T) of the wt level. This might indicate that the conserved aspartate and arginine residues in E. coli do not seem to play an important role for the structure or function of TrbB in vivo. Another explanation could be that TrbB and its homologues are indeed involved only in the assembly of the type IV transporter, and once this complex has formed it is fully functional without requiring the activity of TrbB anymore. Thus, a very low residual activity of the mutant TrbB could still account for rather high levels of DNA transfer.
Incubation of HP0525 and TrbB with the phospholipids CL and PG resulted in a significant stimulation of the NTPase activity. Stimulation of NTPase activity by phospholipids has also been reported earlier for GST(226-230)-TrwD (33). These findings are in accordance with the described association of VirB11-like proteins with the inner membrane (10, 16, 32, 33). An association with the inner membrane was also indicated by fluorescence spectroscopy, since the conformations of TrbB and HP0525 are changed in the presence of certain phospholipids.
Incubation of HP0525 with CL, and to a lesser extent with other phospholipids, resulted in a strong quench of tryptophan fluorescence and a shift of the emission maximum to shorter wavelengths. The shift is indicative of a less polar environment of the tryptophan residues in the presence of phospholipid (24). A tight interaction of the N-terminal domain harboring the two HP0525 tryptophan residues (Trp-57 and Trp-64) with the phospholipid membranes, possibly by integration or peripheral association, might explain this polarity change.
In contrast to HP0525, different fluorescence spectra were observed when TrbB was first incubated with ATP and Mg2+ followed by incubation with PE versus when the incubation order was reversed. A much lesser quenching of tryptophan fluorescence was observed with HP0525 and no shift of the emission maximum was detected with TrbB when preincubated with ATP and Mg2+, conditions known to stabilize the hexameric structure of TrbB. Thus, neither of the TrbB tryptophan residues (Trp-47 and Trp-240) in a TrbB hexamer seem to interact with phospholipid membranes as shown for HP0525. This is not surprising, since the positions of the tryptophan residues in TrbB differ from those in HP0525.
On the other hand, when TrbB was incubated with PE first, a shift of the emission maximum to longer wavelengths, indicative of a more polar environment, was observed. The exposure of at least one of the two TrbB tryptophan residues to a more polar environment might be due to a conformational change of TrbB, e.g., dissociation into single subunits. Subsequent addition of ATP plus Mg2+ had no further effect on the fluorescence spectrum, indicating that once the PE-induced change of the TrbB conformation has occurred it cannot be influenced or reversed by ATP plus Mg2+.
In contrast to the phospholipid-induced changes in the HP0525 fluorescence spectrum, changes observed in TrbB obviously do not reflect the interactions responsible for phospholipid-induced NTPase stimulation. Changes in the TrbB spectrum in the absence of ATP plus Mg2+ are independent of the type of phospholipid applied. However, NTPase is only stimulated by CL and PG. Moreover, in the presence of ATP, no changes in the emission maximum of the TrbB spectrum are observed. The opposite is true for HP0525, where only those phospholipid species which stimulate NTPase shift the emission maximum, and changes in the fluorescence spectrum are observed both in the presence and absence of ATP plus Mg2+.
Nevertheless, the interaction of TrbB with the inner membrane in vivo might be dependent on the ATP concentration in the cell. In this context, it is interesting to mention that no functional receptor for donor-specific phages is detectable after arsenate addition (13). This indicates an energy requirement in the form of ATP to keep the Mpf complex active since the entire Mpf complex is needed to present the receptor on the cell surface.
As it was already shown for TrbB and HP0525, TrwD forms ring-like structures which are stabilized by NTPs and Mg2+, similar to TrbB (23). Additionally, TrwD tends to form tube-like aggregates, but the significance of these structures for the function of TrwD remains to be elucidated.
The existence of ring-shaped oligomers is a very common feature in NTP-hydrolyzing enzymes that catalyze repetitive reactions or need a high concentration of active sites, allowing a simultaneous interaction at different places of a substrate. Examples include DNA helicases, chaperones like GroEL or ClpX, and motor-like proteins such as the F0F1-ATPase (19).
Proteins belonging to the VirB11 family are essential components of type IV secretion systems. Thus, they are involved in the assembly of the membrane-spanning transport complex and in the transfer of the cognate substrate of the transport complex which could be a protein, a nucleoprotein complex, or DNA. Since the activity of neither NTPase described here is stimulated by the addition of single-stranded DNA (data not shown), it is rather likely that a protein and not DNA or a nucleoprotein complex is the substrate for the VirB11-like proteins. Since the VirB11-like proteins are mostly localized in the cytoplasm associated with the inner membrane, it is difficult to imagine that they energize the transport process of a protein across the entire cell envelope. Furthermore, the type IV secretion systems encode another class of potential NTPases, e.g., RP4 TrbE, which is tightly membrane associated and thus an additional candidate for a traffic NTPase. Thus, it seems more likely that VirB11-like proteins energize the assembly of the membrane-spanning multiprotein complex. The similarities in the structures and NTPase activities of VirB11-like proteins to those of chaperones suggest that the binding of VirB11-like proteins to components of the transport complex might aid the translocation of the component across the inner membrane and/or the binding of the component to further components to form the entire membrane-spanning complex.
| |
ACKNOWLEDGMENTS |
|---|
S.K. and E.L. are grateful to Hans Lehrach for his generous support. The expert technical assistance of Marianne Schlicht is greatly appreciated. W.P. thanks Paul Hooykaas for generous support and stimulating discussions.
The work of S.K. was financially supported by Sonderforschungsbereich grant 344/A8 to E.L. from the Deutsche Forschungsgemeinschaft. The work of W.P. was financially supported by Biotech grant ERB4001GT963065 from the European Union. F.C. was supported by grant PB95-1269 from the DGICYT (Ministry of Education, Spain).
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Max-Planck-Institut für Molekulare Genetik, Abteilung Lehrach, Ihnestrasse 73, D-14195 Berlin, Germany. Phone: 49 30 8413 1696. Fax: 49 30 8413 1130. E-mail: lanka{at}molgen.mpg.de.
Present address: IRIS Research Center, Chiron S.p.A.,
I-53100 Siena, Italy.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Andersson, S. G. E., A. Zomorodipour, J. O. Andersson, T. Sicheritz-Pontén, U. C. M. Alsmark, R. M. Podowski, and C. G. Kurland. 1998. The genome sequence of Rickettsia prowazekii and the origin of mitochondria. Nature 396:133-140[CrossRef][Medline]. |
| 2. |
Balzer, D.,
W. Pansegrau, and E. Lanka.
1994.
Essential motifs of relaxase (TraI) and TraG protein involved in conjugative transfer of plasmid RP4.
J. Bacteriol.
176:4285-4295 |
| 3. |
Balzer, D.,
G. Ziegelin,
W. Pansegrau,
V. Kruft, and E. Lanka.
1992.
KorB protein of promiscuous plasmid RP4 recognizes inverted sequence repetitions in regions essential for conjugative plasmid transfer.
Nucleic Acids Res.
20:1851-1858 |
| 4. |
Binet, R.,
S. Letoffe,
J. M. Ghigo,
P. Delepelaire, and C. Wandersman.
1997.
Protein secretion by Gram-negative bacterial ABC exporters a review.
Gene
192:7-11[CrossRef][Medline].
|
| 5. | Bordo, D., and P. Argos. 1991. Suggestions for "safe" residue substitutions in site-directed mutageneses. J. Mol. Biol. 217:721-729[CrossRef][Medline]. |
| 6. | Boyer, H. W., and D. Roulland-Dussoix. 1969. A complementation analysis of the restriction and modification of DNA in Escherichia coli. J. Mol. Biol. 41:459-472[CrossRef][Medline]. |
| 7. | Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-254[CrossRef][Medline]. |
| 8. | Burns, D. L. 1999. Biochemistry of type IV secretion. Curr. Opin. Microbiol. 2:25-29[CrossRef][Medline]. |
| 9. |
Censini, S.,
C. Lange,
Z. Xiang,
J. E. Crabtree,
P. Ghiara,
M. Borodovsky,
R. Rappuoli, and A. Covacci.
1996.
cag, a pathogenicity island of Helicobacter pylori, encodes type I-specific and disease-associated virulence factor.
Proc. Natl. Acad. Sci. USA
93:14648-14653 |
| 10. |
Christie, P. J.,
J. E. Ward, Jr.,
M. P. Gordon, and E. W. Nester.
1989.
A gene required for transfer of T-DNA to plants encodes an ATPase with autophosphorylating activity.
Proc. Natl. Acad. Sci. USA
86:9677-9681 |
| 11. |
Covacci, A.,
J. L. Telford,
G. D. Giudice,
J. Parsonnet, and R. Rappuoli.
1999.
Helicobacter pylori virulence and genetic geography.
Science
284:1328-1333 |
| 12. | Crowther, R. A., and L. A. Amos. 1971. Harmonic analysis of electron microscope images with rotational symmetry. J. Mol. Biol. 60:123-130[CrossRef][Medline]. |
| 13. |
Daugelavi ius, R.,
J. K. H. Bamford,
A. M. Grahn,
E. Lanka, and D. H. Bamford.
1997.
IncP plasmid encoded cell envelope-associated DNA transfer complex increases the cell permeability.
J. Bacteriol.
179:5195-5202 |
| 14. | de la Cruz, F., and E. Lanka. 1998. Function of the Ti-plasmid Vir proteins: T-complex formation and transfer to the plant cell, p. 281-301. In H. P. Spaink, A. Kondorosi, and P. J. J. Hooykaas (ed.), The Rhizobiaceae. Kluwer Academic Publishers, Boston, Mass. |
| 15. | Dowhan, W. 1997. CDP-diacylglycerol synthase of microorganisms. Annu. Rev. Biochem. 66:199-232[CrossRef][Medline]. |
| 16. |
Grahn, A. M.,
J. Haase,
D. H. Bamford, and E. Lanka.
2000.
Components of the RP4 conjugative transfer apparatus form an envelope structure bridging inner and outer membranes of donor cells: implications for related macromolecule transport systems.
J. Bacteriol.
182:1564-1574 |
| 17. |
Haase, J.,
R. Lurz,
A. M. Grahn,
D. H. Bamford, and E. Lanka.
1995.
Bacterial conjugation mediated by plasmid RP4: RSF1010 mobilization, donor-specific phage propagation, and pilus production require the same Tra2 core components of a proposed DNA transport complex.
J. Bacteriol.
177:4779-4791 |
| 18. | Hanahan, D. 1983. Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166:557-580[Medline]. |
| 19. | Hingorani, M. M., and M. O'Donnell. 1998. Toroidal proteins: running rings around DNA. Curr. Biol. 8:R83-R86[CrossRef][Medline]. |
| 20. |
Hueck, C. J.
1998.
Type III protein secretion systems in bacterial pathogens of animals and plants.
Microbiol. Mol. Biol. Rev.
62:379-433 |
| 21. |
Hwang, B. J.,
K. M. Woo,
A. L. Goldberg, and C. H. Chung.
1988.
Protease Ti, a new ATP-dependent protease in Escherichia coli, contains protein-activated ATPase and proteolytic functions in distinct subunits.
J. Biol. Chem.
263:8727-8734 |
| 22. | Johnston, R. F., S. C. Pickett, and D. L. Barker. 1990. Autoradiography using storage phosphor technology. Electrophoresis 11:355-360[CrossRef][Medline]. |
| 23. | Krause, S., M. Bárcena, W. Pansegrau, R. Lurz, J. M. Carazo, and E. Lanka. Sequence related protein export NTPases encoded by the conjugative transfer region of RP4 and by the cag pathogenicity island of Helicobacter pylori share similar hexameric ring structures. Proc. Natl. Acad. Sci. USA, in press. |
| 24. | Lakowicz, J. R. 1983. Principles of fluorescence spectroscopy. Plenum Press, New York, N.Y. |
| 25. |
Lessl, M.,
D. Balzer,
K. Weyrauch, and E. Lanka.
1993.
The mating pair formation system of plasmid RP4 defined by RSF1010 mobilization and donor-specific phage propagation.
J. Bacteriol.
175:6415-6425 |
| 26. | Lory, S. 1998. Secretion of proteins and assembly of bacterial surface organelles: shared pathways of extracellular protein targeting. Curr. Opin. Microbiol. 1:27-35[CrossRef][Medline]. |
| 27. | Miller, J. H. 1972. Experiments in molecular genetics, p. 431-433. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 28. | Motallebi-Veshareh, M., D. Balzer, E. Lanka, G. Jagura-Burdzy, and C. M. Thomas. 1992. Conjugative transfer functions of broad-host-range plasmid RK2 are coregulated with vegetative replication. Mol. Microbiol. 6:907-920[CrossRef][Medline]. |
| 29. | Pansegrau, W., and E. Lanka. 1996. Enzymology of DNA transfer by conjugative mechanisms. Prog. Nucleic Acid Res. Mol. Biol. 54:197-251[Medline]. |
| 30. |
Pansegrau, W.,
E. Lanka,
P. T. Barth,
D. H. Figurski,
D. G. Guiney,
D. Haas,
D. R. Helinski,
H. Schwab,
V. A. Stanisich, and C. M. Thomas.
1994.
Complete nucleotide sequence of Birmingham IncP plasmids: compilation and comparative analysis.
J. Mol. Biol.
239:623-663[CrossRef][Medline].
|
| 31. | Possot, O., and A. P. Pugsley. 1994. Molecular characterization of PulE, a protein required for pullulanase secretion. Mol. Microbiol. 12:287-299[Medline]. |
| 32. |
Rashkova, S.,
G. M. Spudich, and P. J. Christie.
1998.
Characterization of membrane and protein interaction determinants of the Agrobacterium tumefaciens VirB11 ATPase.
J. Bacteriol.
179:583-591 |
| 33. |
Rivas, S.,
S. Bolland,
E. Cabezón,
F. M. Goni, and F. de la Cruz.
1997.
TrwD, a protein encoded by the IncW plasmid R388, displays an ATP hydrolase activity essential for bacterial conjugation.
J. Biol. Chem.
272:25583-25590 |
| 34. | Salmond, G. P. C. 1994. Secretion of extracellular virulence factors by plant pathogenetic bacteria. Annu. Rev. Phytopathol. 32:181-200[CrossRef]. |
| 35. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 36. | Sandkvist, M., M. Bagdasarin, S. P. Howard, and V. J. DiRita. 1995. Interaction between the autokinase EspE and EspL in the cytoplasmic membrane is required for extracellular secretion in Vibrio cholerae. EMBO J. 14:1664-1673[Medline]. |
| 37. |
Scherzinger, E.,
G. Ziegelin,
M. Bárcena,
J. M. Carazo,
R. Lurz, and E. Lanka.
1997.
The RepA protein of plasmid RSF1010 is a replicative DNA helicase.
J. Biol. Chem.
272:30228-30236 |
| 38. |
Segal, E. D.,
J. Cha,
J. L. S. Falkow, and L. S. Tompkins.
1999.
Altered states: involvement of phosphorylated CagA in the induction of host cellular growth changes by Helicobacter pylori.
Proc. Natl. Acad. Sci. USA
96:14559-14564 |
| 39. |
Segal, G.,
M. Purcell, and H. A. Shuman.
1998.
Host cell killing and bacterial conjugation require overlapping sets of genes within a 22-kb region of genes of the Legionella pneumophila genome.
Proc. Natl. Acad. Sci. USA
95:1669-1674 |
| 39a. |
Stein, M.,
R. Rappuoli, and A. Covacci.
2000.
Tyrosine phosphorylation of the Helicobacter pylori CagA antigen after cag-driven host cell translocation.
Proc. Natl. Acad. Sci. USA
97:1263-1268 |
| 40. |
Stephens, K. M.,
C. Roush, and E. Nester.
1995.
Agrobacterium tumefaciens VirB11 protein requires a consensus nucleotide-binding site for function in virulence.
J. Bacteriol.
177:27-36 |
| 41. | Turner, L. R., J. W. Olson, and S. Lory. 1997. The XcpR protein of Pseudomonas aeruginosa dimerizes via its N-terminus. Mol. Microbiol. 26:877-887[CrossRef][Medline]. |
| 42. |
Vogel, P. J.,
H. L. Andrews,
S. K. Wong, and R. R. Isberg.
1998.
Conjugative transfer by the virulence system of Legionella pneumophila.
Science
279:873-875 |
| 43. | Winans, S. C., D. L. Burns, and P. J. Christie. 1996. Adaptation of a conjugal transfer system for the export of pathogenic macromolecules. Trends Microbiol. 4:64-68[CrossRef][Medline]. |
| 44. |
Zylicz, M.,
J. H. LeBowitz,
R. McMacken, and C. Georgopoulos.
1983.
The DnaK-protein of Escherichia coli possesses an ATPase and autophosphorylating activity and is essential in an in vitro DNA replication system.
Proc. Natl. Acad. Sci. USA
80:6431-6435 |
This article has been cited by other articles: