Previous Article | Next Article ![]()
Journal of Bacteriology, May 2000, p. 2811-2822, Vol. 182, No. 10
Center of Marine Biotechnology, University of
Maryland Biotechnology Institute, Baltimore, Maryland 21202
Received 27 September 1999/Accepted 17 February 2000
The luminescence (lux) operon (luxICDABEG)
of the symbiotic bacterium Vibrio fischeri is regulated by
the transcriptional activator LuxR and two acyl-homoserine lactone
(acyl-HSL) autoinducers (the luxI-dependent
3-oxo-hexanoyl-HSL [3-oxo-C6-HSL] and the ainS-dependent
octanoyl-HSL [C8-HSL]) in a population density-responsive manner
called quorum sensing. To identify quorum-sensing-regulated (QSR)
proteins different from those encoded by lux genes, we
examined the protein patterns of V. fischeri quorum-sensing
mutants defective in luxI, ainS, and
luxR by two-dimensional polyacrylamide gel electrophoresis.
Five non-Lux QSR proteins, QsrP, RibB, AcfA, QsrV, and QSR 7, were
identified; their production occurred preferentially at high population
density, required both LuxR and 3-oxo-C6-HSL, and was inhibited by
C8-HSL at low population density. The genes encoding two of the QSR
proteins were characterized: qsrP directs cells to
synthesize an apparently novel periplasmic protein, and ribB is a homolog of the Escherichia coli gene
for 3,4-dihydroxy-2-butanone 4-phosphate synthase, a key enzyme for
riboflavin synthesis. The qsrP and ribB
promoter regions each contained a sequence similar to the
lux operon lux box, a 20-bp region of dyad
symmetry necessary for LuxR/3-oxo-C6-HSL-dependent activation of
lux operon transcription. V. fischeri qsrP and
ribB mutants exhibited no distinct phenotype in culture.
However, a qsrP mutant, in competition with its parent strain, was less successful in colonizing Euprymna
scolopes, the symbiotic host of V. fischeri. The
newly identified QSR genes, together with the lux operon,
define a LuxR/acyl-HSL-responsive quorum-sensing regulon in V. fischeri.
Quorum sensing is a regulatory
mechanism by which gram-negative bacteria control gene expression in
response to population density (13, 31). Quorum sensing
involves acyl-homoserine lactone (acyl-HSL) signal molecules, produced
by members of the LuxI family of acyl-HSL synthases, and proteins of
the LuxR family of transcriptional activators, which mediate the
response to local concentrations of acyl-HSLs (37, 40). The
first acyl-HSL, 3-oxo-hexanoyl-HSL (3-oxo-C6-HSL) and the
luxI and luxR genes were first identified in the
marine bioluminescent bacterium Vibrio fischeri (20,
23). At present, LuxI/LuxR quorum-sensing systems have been
identified in over 25 species of gram-negative bacteria from diverse
habitats, including both marine and terrestrial bacteria and several
pathogens of plants and animals (13, 37, 65).
Quorum sensing controls various different activities in these different
bacteria, including luminescence, the production of extracellular
enzymes, plasmid transfer, antibiotic synthesis, and biofilm formation
(13, 31, 65). In some species, quorum sensing coordinates
the expression of several unlinked genetic loci. For example, in the
opportunistic human pathogen Pseudomonas aeruginosa, two
LuxI/LuxR homolog pairs, LasI/LasR and RhlI/RhlR, regulate more than 40 genes via a complex quorum-sensing network (39, 52, 68). The
coordinated production of multiple proteins of diverse function
suggests that quorum sensing is an adaptational response to conditions
of high population density, such as those encountered in association
with plant and animal hosts (13, 52, 65).
In V. fischeri, quorum sensing controls luminescence; LuxR
and 3-oxo-C6-HSL direct a population density-responsive transcriptional activation of the lux operon (luxICDABEG; genes
for 3-oxo-C6-HSL synthase and light production) (reviewed in reference
14). Luminescence, which plays a defining role in
the symbiosis formed by this bacterium with certain squids and fishes
(16, 56), is dependent also on 3':5'-cyclic AMP and GroESL,
which influence the production and activity of LuxR, respectively.
Furthermore, various physiological factors, including oxygen, carbon
source, and iron, control luminescence, apparently by influencing the
quorum-sensing mechanism (reviewed in reference 13).
The complexity of control over lux operon expression and the
apparent integration of quorum sensing with cellular physiology suggest
that luminescence is part of a coordinated adaptational response.
Except for luminescence, however, the nature of the quorum-sensing
response in V. fischeri, its extent and functional
significance, is presently unknown.
To begin gaining insight into these issues, we sought to identify
LuxI/LuxR quorum-sensing-regulated (QSR) genes "downstream" of the
lux operon. To do so, we used two-dimensional polyacrylamide gel electrophoresis (2-D PAGE) and quorum-sensing mutants of V. fischeri defective in production of acyl-HSLs and LuxR. In this study, we report the identification of several non-Lux QSR proteins and
their genes. The newly identified QSR genes, together with the
lux operon, define a LuxR/acyl-HSL-responsive quorum-sensing regulon in V. fischeri. At least one member of the regulon,
qsrP, apparently is involved in the ability of V. fischeri to colonize its sepiolid squid host, Euprymna
scolopes.
Bacterial strains and growth conditions.
The bacterial
strains and plasmids used in this study are described in Table
1. Escherichia coli
SM10-
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
LuxR- and Acyl-Homoserine-Lactone-Controlled Non-lux
Genes Define a Quorum-Sensing Regulon in Vibrio
fischeri
and
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
pir (provided by C. Gardel and J. Mekalanos) and
Novablue were grown on Luria-Bertani (LB) medium (58) at
37°C with antibiotics as appropriate (ampicillin, 100 µg
ml
1; chloramphenicol, 30 µg ml
1).
V. fischeri MJR1, a spontaneous rifampin-resistant
derivative of MJ-1 (57), was isolated by plating a saturated
culture of MJ-1 on LBS agar (12) containing 100 µg of
rifampin per ml. Strains of V. fischeri were maintained on
LBS agar with the appropriate antibiotics (chloramphenicol, 3 µg
ml
1; naladixic acid, 20 µg ml
1; neomycin,
200 µg ml
1; and rifampin, 100 µg ml
1).
For protein isolation, cells were grown with aeration in 3-ml cultures
of liquid LBS without antibiotics at 27°C to an absorbance of 660 nm
(A660) of 0.4 (mid-exponential phase), 0.8 (late
exponential phase), or 1.2 (early stationary phase). Cells from 1-ml
volumes were pelleted at 4°C, washed twice with an equal volume of
ice-cold artificial seawater (17), and stored frozen as a
pellet at
75°C until use.
TABLE 1.
Bacterial strains and plasmids used in this study
1. Synthetic autoinducers were
added to culture tubes as solutions in chloroform to yield a final
concentration of 100 nM. The chloroform was removed by evaporation with
a stream of sterile air prior to addition of the medium and bacteria.
Strains MJ-10X and ES-10X were tested for their ability to utilize
various carbon and energy sources in VFM, a previously described
minimal salts medium (15), containing glucose, glycerol,
ribose, mannose, or N-acetylglucosamine (20 mM).
Protein isolation for 2-D PAGE and cell fractionation.
All
preparative procedures were conducted at 4°C or on ice. Frozen cell
pellets were resuspended in 80 µl of sample buffer 1 (SB1; 40 mM
Tris-HCl [pH 8.0], 200 mM dithiothreitol, 0.3% sodium dodecyl
sulfate) and boiled for 2 min. After cooling, 8 µl of sample buffer 2 (0.5 M Tris-HCl [pH 8.0], 50 mM MgCl2, 1 mg of DNase I
per ml, 0.25 mg of RNase A per ml) was added to the mixture, which was
incubated for 30 min. Proteins were precipitated by the addition of
acetone to 80% (vol/vol), collected by centrifugation, and resuspended
in 80 µl of SB1. After a second acetone precipitation, the pellet was
air-dried for 30 min, resuspended in 60 µl of SB1 and 240 µl of
sample buffer 3 (9.9 M urea, 100 mM dithiothrietol, 4% Triton X-100,
2.2% polyampholytes [40% [wt/vol], pH 3 to 10; Genomic Sciences,
Inc.]), and stored at
75°C until use. For cell fractionation,
cells were separated into outer membrane, inner membrane, and
cytoplasmic/periplasmic (i.e., soluble) fractions as described for
Vibrio cholerae (50). Cells were treated with chloroform to isolate periplasmic proteins (1).
2-D PAGE.
Proteins were separated essentially as described
by O'Farrell (51) using the 2-D Investigator system from
Millipore and reagents from Genomic Sciences, Inc. First-dimension gels
contained 4.1% acrylamide, 9.5 M urea, 5 mM CHAPS
(3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate), 2%
Triton X-100, and 5.8% polyampholytes. A 10-µl amount of sample was
loaded at the basic end of the gel for analytical gels (50 µl for
preparative gels) and electrophoresed for 18,000 volt-hours. After
completion of the run, gels were incubated in equilibration buffer
(0.375 M Tris-HCl [pH 9.2], 50 mM dithiothreitol, 0.01% bromophenol
blue) for 2 min or stored frozen in 10% glycerol at
75°C.
Peptide sequencing. For amino-terminal sequencing, conducted at the Massachusetts Institute of Technology Biopolymers Laboratory, excised proteins were subjected to automated Edman degradation on an Applied Biosystems model 477A protein sequencer with an on-line model 120 phenylthiohydantoin amino acid analyzer. For internal sequencing, conducted at the Harvard Microchemistry Facility, protein bound to the polyvinylidene difluoride membrane was digested in situ with endoproteinase LysC (Wako) (24). The resulting peptide mixture was separated by microbore high-performance liquid chromatography (HPLC) using a Zorbax C18 reverse-phase column (1.0 by 150 mm) on a Hewlett-Packard 1090 HPLC/1040 diode array detector. Optimum fractions from the chromatogram were chosen based on differential UV absorption at 205, 277, and 292 nm, peak symmetry, and resolution. Peaks were further screened for length and homogeneity by matrix-assisted laser desorption time-of-flight mass spectrometry on a Finnigan Lasermat 2000, and selected fractions were subjected to automated Edman degradation. Details of strategies for the selection of peptide fractions and their microsequencing have been described previously (44). The internal peptide sequences were: 10-PK12, NVPQIGDTYK; 10-PK39, DRVSIPPIYVELSDNRFSGLHVSGMK; 10-PK51, YGNLFFELIK; 12-PK32, KGVTTGVSATDR; and 12-PK78, LAELTPAGVLCEVTN.
Isolation of qsrP and ribB, the genes encoding QSR 10 and QSR 12. QSR 10 was extracted from gels and subjected to internal proteolytic digestion. Three of the resulting peptides, 10-PK12, 10-PK39, and 10-PK51, were separated by reversed-phase HPLC and sequenced. Primers corresponding to regions of peptides 10-PK12 and 10-PK39 (10-12F, 10-12R, 10-39F, and 10-39R) were combined as appropriate in two separate PCRs using MJ-100 chromosomal DNA as the template. From the reaction with 10-12F and 10-39R as the primers, a single product of 209 bp was obtained. Attempts to use the 209-bp portion as a probe to isolate the complete gene for QSR 10 from a plasmid-borne genomic library of MJ-100 DNA (15) were unsuccessful, possibly because of underrepresentation of this DNA region in the library. As an alternative, we used PCR to amplify the DNA flanking the 209-bp region and subsequently PCR amplified the intact gene using primers designed from the flanking DNA sequence. To facilitate PCR amplification of the DNA flanking the 209-bp fragment, MJ-100 chromosomal DNA was digested to completion with CfoI, the 4-bp recognition sequence of which is not present in the fragment. The chromosomal fragments were then circularized by ligation, and primers 10-210R and 10-210F were used to amplify the regions flanking the 209-bp fragment, which were joined at the CfoI sites, making them contiguous on the circular molecule. The resulting 760-bp fragment was cloned and sequenced. From the sequences adjacent to the CfoI site, primers 10-826F and 10-826R were designed and used to PCR-amplify the intact qsrP gene.
To isolate the ribB gene, QSR 12 was digested, and two internal fragments were sequenced. Primers corresponding to regions of peptides 12-PK32 and 12-PK78 (12-32F, 12-32R, 12-78F, and 12-78R) were used to amplify a portion of the genome that codes for the protein. From the reaction using 12-32F and 12-78R as the primers, a single product of 215 nucleotides was obtained. Sequencing of the resultant 215-nucleotide fragment confirmed that it was part of the coding region for QSR 12. The intact gene was then isolated from a plasmid-borne library of MJ-1 chromosomal DNA in E. coli (15), using PCR analysis as a screen. Plasmids from 2,000 colonies representing the library were initially pooled in groups of 50, and DNA from these 40 groups served as the template for individual PCRs using primers 12-32F and 12-78R. One of the reactions generated a 215-bp fragment. Each plasmid from the pool of 50 for that reaction was then screened individually to identify a single positive clone, which contained approximately 7.5 kb of chromosomal insert DNA. The sequence of the region containing the QSR 12 open reading frame was obtained using a primer walk strategy.PCR amplification, cloning, and sequencing of DNA. PCR amplifications were performed in an Idaho Technology Rapidcycler using 50-µl glass capillary tubes. The following oligonucleotides were used as primers (* denotes degenerate primers; Y is T or C; R is A or G; H is A, T, or C; D is A, T, or G; and N is A, T, C, or G): 10-12F*, AAYGTNCCNCARATHGGNGAYACRTA; 10-12R*, TAYGTRTCNCCDATYTGNGGNACRTT; 10-39F*, ATHTAYGTNGARCTNAGYGAYAAYCG; 10-39R*, CGRTTRTCRCTNAGYTCNACRTADAT; 12-32F*, ACIACIGGDGTWAGYGCWACIGAYAG; 12-32R*, CTRTCIGTWGCTCTWACHCCIGTIGT; 12-78F*, GCWGGDGTWTTDTGYGARGTWACIAA; 12-78R*, TTIGTWACYTCRCAHAAWACHCCWGC; 10-210F, CTGTAGAGGCTTGCTCTATTGGATCT; 10-210R, TCAGAAGAAGC-TCTCTACGACCCTTG; 10-826F, ATCAAGAAACCTCGACGAGATAAACG; 10-826R, GTCCTAAAGAGGAAATGCTAAGTGGT; R6KR, GGCTTTTAAAGCTTTTAAGGTTTAACGG; SP12-101R, CGACAGTCCCTTCTGTATGTCCTC; and P12S-2, CACTTATTATCGAAACATCTATCATTA. Standard conditions were used except for the initial reactions with degenerate primers, which used 4 mM MgCl2 in the buffer and 30 cycles, with denaturation at 94°C for 2 s, annealing at 40°C for 10 s, and elongation at 50°C for 10 s. PCR products were purified from agarose gels with a QIAquick gel extraction kit (Qiagen) and cloned into pT7-Blue using the Perfectly Blunt cloning kit (Novagen).
DNA sequencing, conducted at the CRC DNA Sequencing Facility, University of Chicago, used the dideoxy nucleotide chain termination method of Sanger et al. (58) with dye terminator labeling.Construction of qsrP and ribB
mutants.
To construct a suicide plasmid, pSMC300, effective in
V. fischeri, which is naturally resistant to ampicillin, the
ampicillin resistance locus of pGP704 (50) was replaced by a
gene encoding resistance to chloramphenicol. pGP704, which contains the
R6K origin of replication and the mob region of pRP4, was
digested with PstI, and the 1.1-kb cat gene,
supplied as a control insert in the pCR-Script cloning kit
(Stratagene), was blunt-end cloned in place of the 5' end of the gene
for
-lactamase to form pSMC300. This vector can be conjugated from
E. coli SM10-
pir to V. fischeri, but it cannot replicate independently; it therefore confers resistance to chloramphenicol only if it has recombined into the chromosome. To
promote recombination between the vector and qsrP, a 150-bp PCR fragment corresponding to nucleotides 119 to 269 of the coding regions from MJ-100 and ESR1 was cloned into the XbaI and
SacI sites of pSMC300 to yield p300-10XM and p300-10XE,
respectively. For ribB, a 257-bp PCR fragment that
corresponds to nucleotides 194 to 450 of the coding region was cloned
into the XbaI and SphI sites of pSMC-300 to yield
p300-12XM. Conjugation of the vectors from SM10-
pir to
V. fischeri strains MJR1 and ESR1 was performed as described
previously (18). Transconjugants were selected for their
ability to grow on LBS containing rifampin and chloramphenicol.
Colonization of E. scolopes.
Colonization of the light
organs of juvenile E. scolopes was performed in general
according to previously published procedures (49). Adult
animals were maintained and mated and egg clutches were handled as
previously described (6). Within 24 h of hatching, juvenile aposymbiotic squids were placed individually in 10 ml of
filter-sterilized artificial seawater in 30-ml glass scintillation vials, and bacterial cells grown to mid-exponential phase in VFM medium
with 20 mM ribose as the sole carbon source were added to a final
concentration of 104 cells ml
1 per strain.
After a 3-h exposure to the bacteria and at 12-h intervals, the squid
were transferred to vials containing fresh filter-sterilized artificial
seawater. Luminescence was used as an indicator of development of the
symbiosis (49). At 48 h postinoculation, the animals
were rinsed in filter-sterilized artificial seawater and homogenized to
release the bacteria within the light organs. Dilutions of the
homogenate were spread-plated on LBS agar containing rifampin
(LBSrif). For platings from each animal, approximately 200 colonies were transferred from LBSrif to LBSrif
containing chloramphenicol to distinguish between ESR1 (chloramphenicol
sensitive) and ES-10X (chloramphenicol resistant). A similar plating
procedure was used for the in vitro growth competition experiment, with 50 colonies screened; the ratio of the mutant to the parent strain was
determined from cultures grown to an A660 of
0.6.
Nucleotide sequence accession numbers. The nucleotide sequences of the qsrP and ribB genes from MJ-100 and qsrP from ESR1 have been deposited in GenBank under accession numbers AF233626, AF233627, and AF233628, respectively. Preliminary sequence data for V. cholerae RibB were obtained from The Institute for Genomic Research website at http://www.tigr.org.
| |
RESULTS |
|---|
|
|
|---|
Identification of non-Lux QSR proteins.
To identify V. fischeri QSR proteins distinct from those encoded by the
lux operon, we used 2-D PAGE and quorum-sensing mutants of
V. fischeri MJ-100. MJ-100, derived from the wild-type
fish-symbiotic strain MJ-1, was chosen for this work because, like
MJ-1, it strongly expresses luminescence and produces a high level of
acyl-HSL in laboratory culture. In contrast, the luminescence of the
squid-symbiotic strain ES114 is weak in laboratory culture, due
apparently to underproduction of 3-oxo-C6-HSL (4, 17, 35).
We first analyzed the cellular proteins of MJ-100 to determine what
proteins V. fischeri might produce in a population
density-dependent manner. MJ-100 was grown to mid-exponential phase
(A660 = 0.4), at which point luminescence
is uninduced or just beginning to induce, to late exponential phase
(A660 = 0.8), at which point luminescence induction is strongly under way, and to early stationary phase (A660 = 1.2), at which point MJ-100 is
fully induced for luminescence. Visual comparison of gels revealed
eight proteins not apparent or weakly detectable at mid-exponential
phase that increased in their abundance during growth of MJ-100 through
late exponential phase to early stationary phase (Fig. 1A, B, and
C).
|
|
Requirement for LuxR and 3-oxo-C6-HSL.
To determine whether
the newly identified QSR proteins required LuxR for their production,
we examined the protein pattern of MJ-208, a luxR deletion
mutant. MJ-208 is unable to induce lux operon transcription
regardless of the presence of 3-oxo-C6-HSL (42). MJ-208
failed to produce LuxA, LuxB, and LuxE and also produced none of the
five non-Lux QSR proteins (Fig. 2).
Therefore, LuxR is required for the production of the newly identified
QSR proteins, as it is for production of the Lux proteins.
|
luxI ainS) (Fig. 1D) are consistent with a requirement for either 3-oxo-C6-HSL or C8-HSL or both, via LuxR for the
production of the QSR proteins. To determine which of the V. fischeri acyl-HSLs fulfills that requirement, we took two approaches. First, we examined the protein patterns of the single autoinducer synthase mutants MJ-211 (
luxI) and MJ-216
(ainS). MJ-211, which is unable to synthesize 3-oxo-C6-HSL
but does synthesize C8-HSL, failed to produce substantial amounts of
LuxA, LuxB, LuxE, or any of the five non-Lux QSR proteins (Fig.
3A). In contrast, MJ-216, which is unable
to synthesize C8-HSL but does synthesize 3-oxo-C6-HSL, produced all
eight of these proteins (Fig. 3B). Next, we compared the protein
patterns of MJ-215 grown to early stationary phase in the presence of
exogenously added acyl-HSLs (100 nM). In the presence of 3-oxo-C6-HSL,
production of the three Lux and the five non-Lux QSR proteins was
restored (Fig. 3C), whereas the presence of C8-HSL did not restore the
production of these proteins (Fig. 3D). These results demonstrate that
3-oxo-C6-HSL is required for production of the QSR proteins.
Furthermore, they demonstrate that C8-HSL is neither sufficient for the
production of detectable levels of these proteins nor necessary for
their high-level production.
|
Absence of positive regulation of QSR proteins by C8-HSL.
We
previously hypothesized that C8-HSL activates the production of non-Lux
quorum-regulated proteins in V. fischeri via LuxR or another
regulatory protein (42). The results presented above provide
a test of that hypothesis by comparison of the protein patterns of
MJ-216 (ainS), which makes no C8-HSL, and MJ-100. For cells
grown to the early stationary phase, the protein pattern of MJ-216 was
essentially indistinguishable from that of MJ-100 (Fig. 3B and 1C). A
further test of the hypothesis is provided by the results of the double
autoinducer synthase mutant MJ-215 (
luxI ainS) grown in
the presence and absence of exogenously added C8-HSL to the early
stationary phase. Regardless of the presence or absence of C8-HSL, the
protein patterns of MJ-215 appeared identical (Fig. 3D and 1D). Thus,
neither the absence nor the presence of C8-HSL had a discernible effect
on the proteins produced by V. fischeri at high population
density. Either no proteins in V. fischeri are produced
under positive control by C8-HSL or they are not revealed by the 2-D
PAGE conditions used here.
Negative regulation of QSR proteins by C8-HSL.
In contrast to
a positive role, C8-HSL has been demonstrated to negatively modulate
lux operon transcription. That negative modulation
apparently operates by a competitive inhibition by C8-HSL of the
interaction between 3-oxo-C6-HSL and LuxR, inhibiting production of the
Lux proteins at low population density (21, 42, 43).
Consistent with that inhibitory activity, MJ-216 (ainS)
induces luminescence at a substantially lower population density than
MJ-100 (43). We therefore asked whether C8-HSL might operate
similarly on the newly identified QSR proteins, inhibiting their
production at low population density. To examine that possibility, the
protein patterns of MJ-100 and MJ-216 grown to mid-exponential phase
(A660 = 0.4) were compared. For MJ-216, LuxA, LuxB, and LuxE and each of the five non-Lux QSR proteins were
readily observed (Fig. 4), whereas all
eight proteins were less abundant or not detected from MJ-100 at this
population density (Fig. 1A). Thus, in the absence of C8-HSL,
production of the QSR proteins is enhanced at low population density.
Therefore, C8-HSL apparently operates in vivo to inhibit production of
both the Lux proteins and the newly identified QSR proteins.
|
Characteristics of qsrP, the gene encoding QSR 10. To gain insight into the functions of the newly identified QSR proteins, we isolated the genes for QSR 10, QSR 12, QSR 6, and QSR 8. In this report, we describe the genes for QSR 10 and QSR 12, which were given primary attention because of the abundance and ease of isolation of these proteins and because QSR 10 apparently is produced by V. fischeri in symbiosis with E. scolopes (see below). We note parenthetically here that the deduced translation products for the genes specifying QSR 6 and QSR 8, provisionally designated acfA and qsrV, respectively, exhibited sequence similarity to AcfA from Vibrio cholerae (53) and to hypothetical proteins F130 from E. coli and 1709 from Haemophilus influenzae, respectively. The characteristics of acfA and qsrV will be presented elsewhere.
The gene for QSR 10, designated qsrP, for quorum-sensing-regulated periplasmic, was isolated from a genomic library of MJ-100 DNA by a PCR amplification approach, with primers based on internal sequences of the protein (Materials and Methods). Neither the qsrP nucleotide sequence nor its deduced amino acid sequence exhibited significant similarity with known genes or gene products; apparently, qsrP is a novel gene. The 129-amino-acid QsrP precursor protein has a calculated molecular size of 14,746 Da. Consistent with the periplasmic location of QsrP (QSR 10), a 19-amino-acid sequence typical of prokaryotic leader peptides (67) is absent from the amino terminus of the mature protein, which begins at K20 of the deduced translation product. The mature 110-amino-acid protein has a calculated molecular weight of 12,660 and a calculated isoelectric point of 4.9, attributes consistent with the mobility of the protein on 2-D PAGE (Fig. 1C). The qsrP coding region was bounded by a promoter with similarity to the lux operon promoter, including the presence of a probable lux box, and by a strong putative transcriptional terminator. The qsrP lux box, a 20-bp region of dyad symmetry, was found centered at 73 nucleotides upstream of the start of the qsrP coding region (Fig. 5A). This sequence matches 14 of the 20 nucleotides of the lux operon lux box (Table 3), which serves as the binding site for the LuxR/3-oxo-C6-HSL transcriptional activator complex (2, 22, 62). The lux operon promoter lacks a
35 region
(23), and the location where a
35 region would occur is
overlapped by the lux box (9, 24). With the
positioning of the qsrP lux box as a guide, a similarly
located
10 Pribnow box (TAATAT) can be discerned in the
qsrP promoter region, 17 nucleotides downstream from the end
of the qsrP lux box. As also seen for the lux
operon promoter, no
35 region was apparent. A likely ribosome-binding site (GGA) was identified 5 bases upstream of the ATG translation initiation codon. Following the QsrP coding region, 23 bases after its
translational stop codon, a probable rho-independent transcriptional terminator was identified. The stem-and-loop structure consists of a
perfect 11-base stem and a 5-base loop, followed by a poly(T) region.
Thus, the qsrP gene appears to be monocistronic, and its promoter region contains a lux box, which is consistent with
direct transcriptional control of qsrP by LuxR/3-oxo-C6-HSL.
|
|
Comparison of qsrP from MJ-100 and ESR1. To examine the role of QsrP in the bioluminescent symbiosis of V. fischeri with the sepiolid squid E. scolopes, we isolated qsrP from strain ESR1, a derivative of the squid-symbiotic strain ES114. ESR1 was chosen for this work because it is fully competent to establish symbiosis with the squid (34). In contrast, the fish-symbiotic strain MJ-1 and its derivatives, reported on above, are not effective for analysis of V. fischeri genes involved in squid symbiosis; they fail to colonize E. scolopes or do so inconsistently (10; unpublished data). Motivating our interest in QsrP as a possible symbiosis determinant is the observation that a protein similar in size to MJ-100 QsrP, but with a more basic isoelectric point, is one of the more abundant proteins revealed by 2-D PAGE of proteins from V. fischeri cells taken directly from light organs of adult E. scolopes. Like the Lux proteins of ESR1, this protein is not produced by squid-symbiotic strains grown in culture (unpublished data), indicating that it, like the Lux proteins, is subject to a quorum-sensing control apparently specific to the symbiotic state.
The qsrP gene was isolated from ESR1 by PCR amplification from chromosomal DNA with oligonucleotides 10-826F and 10-826R. Sequence analysis of the cloned PCR product revealed that the DNA flanking the QsrP coding region was essentially identical in MJ-100 and ESR1, whereas the QsrP coding region itself differed in the two strains. Specifically, of 234 nucleotides preceding the lux box, 233 were identical in the two strains. Furthermore, 17 of the 20 lux box nucleotides were the same in the two strains (Table 3). For the QsrP coding region, however, only 84% of the nucleotides and 78% of the deduced amino acids were identical. Notable differences in the coding region included the addition of amino acid residues R and S between D63 and F64 of the MJ-100 sequence. The mature QsrP protein from ESR1 had a calculated molecular weight of 12,908 and a calculated pI of 7.0. The higher calculated isoelectric point of the ESR1 protein is consistent with the position of the putative QsrP protein on 2-D PAGE of proteins from V. fischeri cells taken from the E. scolopes light organ. Mutants of MJR1, a spontaneous rifampin-resistant derivative of MJ-100, and of ESR1 defective in qsrP were constructed by a plasmid integration procedure (Materials and Methods). To ascertain whether the mutation in qsrP resulted in an obvious phenotype in laboratory culture, the mutants, MJ-10X and ES-10X, were examined for differences from their parent strains under a variety of growth conditions. Regardless of the growth condition or the attribute tested (Materials and Methods), however, the mutants grew and behaved very similarly to their parent strains.Diminished symbiosis competence of a qsrP mutant. With the construction of a qsrP mutant of ESR1, we were in a position to examine the involvement of QsrP in the ability of V. fischeri to colonize its symbiotic host, E. scolopes. First, to determine if the mutant had any obvious defect in its ability to grow compared with the parent, we used an in vitro growth competition assay. ES-10X and ESR1 were inoculated together at equal numbers into laboratory medium and allowed to grow for several doublings, and then the numbers of mutant and parent cells were quantified (Materials and Methods). A ratio of mutant to parent close to 1 was obtained (ES-10X/ESR1 = 1.17 in each of three replicates), indicating that the two strains were apparently competitively equal in vitro. Next, to determine whether the mutant exhibited any obvious defect in its ability to colonize the squid, juvenile aposymbiotic E. scolopes were presented separately with the qsrP mutant and its parent strain in a squid colonization assay (Materials and Methods). Separately, the mutant and the parent colonized equally well (ES-10X, 2.8 × 105 ± 1.0 × 105 CFU/light organ, n = 10; ESR1, 2.9 × 105 ± 1.3 × 105 CFU/light organ, n = 10, at 48 h postinoculation). These results indicate that the mutant had no obvious difference from the parent in its ability to grow or to colonize the squid.
In competition with the parent, however, the qsrP mutant was less successful in colonizing the squid. For the colonization competition assay, aposymbiotic juveniles of E. scolopes were presented with a 1:1 mix of ES-10X and ESR1, and the symbiosis was allowed to develop; the numbers of mutant and parent cells present in the E. scolopes light organs were then determined at 48 h postinoculation. Compared to the parent strain, lower numbers of the qsrP mutant were present in nearly all of the animals (Fig. 6). Of the 15 animals tested (three separate trials of 5 animals each), the parent dominated the colonizing population in 12 animals, and in half of those cases it constituted more than 80% of the symbiont population. For the other three animals, one had a ratio of parent to mutant near 50%, the expected average value if no difference existed in the competitive ability of the two strains, and two animals had a higher percentage of mutant than parent. These results indicate a distinct dominance of the parent strain over the mutant in the colonizing population, similar to that observed in competition assays between ESR1 and a katA mutant of V. fischeri (66). We nonetheless sought a statistical assessment of the results, using the sign-rank test (62), a two-tailed nonparametric test. The null hypothesis, equal ability of the parent and mutant strains to colonize, was rejected at a high level of confidence, P = 0.01. We interpret these results as indicating that the defect in qsrP confers a competitive disadvantage in the symbiosis. The QsrP protein therefore apparently contributes to the ability of V. fischeri to establish bioluminescent symbiosis with E. scolopes.
|
Isolation of ribB, the gene encoding QSR 12. We next isolated the gene encoding QSR 12 (Materials and Methods). The deduced amino acid sequence of QSR 12 was 55 and 56% identical to RibB of E. coli (55) and H. influenzae (27), respectively, 65% identical to LuxH of Vibrio harveyi (64), and 67% identical to RibB of Vibrio cholerae (The Institute for Genomic Research [TIGR] database; J. F. Heidelberg, personal communication). The E. coli RibB protein is a 3,4-dihydroxy-2-butanone 4-phosphate synthase, which catalyzes a key step in riboflavin synthesis (55). We therefore designated the gene for QSR 12 ribB. In V. harveyi, luxH occurs downstream of luxG as the last gene of the lux operon (64), whereas in V. fischeri, ribB is not part of the lux operon, which ends after luxG with a strong bidirectional rho-independent terminator (63). A luxH gene has not been identified previously in V. fischeri.
The V. fischeri ribB coding region directs the synthesis of a 217-amino-acid protein of 23,616 Da with an estimated pI of 5.26. Like that of qsrP, the ribB coding region was bounded by a promoter region containing a lux box and by a probable transcriptional terminator. The lux box is centered 133 nucleotides upstream of the translational start (Fig. 5B) and is identical in 12 of the MJ-1 lux operon lux box nucleotides and 17 of the MJ-1 qsrP lux box nucleotides (Table 3). A possible
10 Pribnow box sequence (TAAAAT)
starts 11 nucleotides downstream from the end of the ribB
lux box, a spacing that is somewhat less than that between the
lux box and
10 sequences in the promoter regions of the
MJ-1 lux operon (19 nucleotides) and qsrP (17 nucleotides). However, the ribB promoter region also
contains a
35 (TTGTCA) sequence and an additional
10
(TTAAAT) sequence, separated by 18 nucleotides, which occur
between the lux promoter elements and the ribB
coding region. The putative
35 region overlaps the lux
box-associated
10 region by a single nucleotide (Fig. 5B). A likely
ribosome-binding site (GGAG) is positioned 10 bases upstream of the
proposed ATG translation initiation codon. Amino-terminal sequencing of
the protein (Table 2) confirmed that the indicated Met residue was the
translational start. The coding region is followed by a putative stem-and-loop rho-independent terminator, which begins 128 nucleotides after the ribB stop codon. Therefore, ribB, like
qsrP, appears to be monocistronic, and its transcription
appears to be regulated directly by LuxR/3-oxo-C6-HSL.
Construction and characterization of a ribB mutant. Induction of luminescence presumably leads to a strongly increased demand for the luciferase substrate FMNH2, but how cells cope with that demand is not known and little is presently known about the generation of reduced flavin mononucleotide in V. fischeri (11, 32, 48, 69). To attempt to gain insight into these issues, we constructed a mutant of MJR1 defective in ribB, using a plasmid integration procedure (Materials and Methods), and examined the mutant for altered growth and luminescence in comparison with its parent strain. The ribB mutant MJ-ribBX, however, exhibited no obvious phenotype. MJ-ribBx grew normally, produced a high level of light, and induced luminescence in a fashion similar to that of MJR1, regardless of the presence or absence of exogenously supplied riboflavin. Therefore, RibB apparently is not required for and does not play a significant role in normal light production by V. fischeri, at least in routine laboratory culture.
To assess the role of RibB in symbiosis, we attempted to isolate ribB from the squid-symbiotic strain ESR1. However, the primers used to isolate ribB from the MJ-1 genomic library (Materials and Methods) and several combinations of primers used in sequencing of the MJ-1 ribB gene all gave negative results when used with ESR1 chromosomal DNA as the template. In contrast, all tested primer combinations were positive with MJR1 DNA. Either a ribB gene is absent from ESR1 or its sequence has diverged substantially from that in the fish-symbiotic strain MJ-1.| |
DISCUSSION |
|---|
|
|
|---|
This study reports the identification in the bioluminescent symbiotic bacterium V. fischeri of five QSR proteins, QsrP, RibB, AcfA, QsrV, and QSR 7, distinct from those encoded by the luminescence operon luxICDABEG. Identification of the QSR proteins was facilitated by the availability of genetically defined mutants of V. fischeri defective in production of the quorum-sensing transcriptional activator LuxR and the quorum-sensing signals 3-oxo-C6-HSL and C8-HSL (33, 42, 43). The production of the QSR proteins occurs preferentially at high population density, requires both LuxR and 3-oxo-C6-HSL, and apparently is inhibited by C8-HSL at low population density. These regulatory attributes are the same as those controlling production of the proteins for luminescence. Consistent with LuxR/acyl-HSL-dependent control, the promoter regions of the qsrP and ribB genes contain a lux box, a regulatory site necessary for LuxR/3-oxo-C6-HSL-dependent activation of lux operon transcription. The genes for the newly identified QSR proteins, together with the genes for luminescence, define a LuxR/acyl-HSL-responsive quorum-sensing regulon in V. fischeri.
We hypothesized previously that C8-HSL, via LuxR or another regulatory
protein, represents a second quorum-sensing system in V. fischeri, one with target genes distinct from those regulated by
3-oxo-C6-HSL and LuxR (42). No protein whose production was dependent on C8-HSL was revealed, however, through 2-D PAGE analysis of
MJ-216 (ainS) in comparison with its parent strain, or of
MJ-215 (
luxI ainS) grown in the presence or absence of
C8-HSL. If C8-HSL does positively regulate the production of proteins
in V. fischeri, then the conditions necessary for their
detection apparently differ from the conditions used in this study.
Conversely, the results of this study support and extend an inhibitory role in vivo for C8-HSL (43). The presence of C8-HSL in V. fischeri delays lux operon expression in a LuxR-dependent manner, apparently through a competitive inhibition of the interaction between 3-oxo-C6-HSL and LuxR (21, 43). In the present study, we used the observation that the ainS mutant MJ-216 induces luminescence at a lower population density than the parent strain (43). The mutation, by eliminating the ability of cells to synthesize C8-HSL, apparently relieves the inhibitory effect of C8-HSL, thereby allowing lux operon induction to occur at a lower concentration of 3-oxo-C6-HSL, i.e., at a lower population density. We therefore expected that MJ-216 would produce higher levels of the Lux proteins at a lower population density than its parent strain, MJ-100. 2-D PAGE analysis confirmed that expectation for the Lux proteins detected here, LuxA, LuxB, and LuxE, and revealed that higher levels of the five newly identified QSR proteins also were produced at a lower density. Thus, the new QSR proteins are subject to the same regulatory control, both positive and negative, as the proteins of the lux operon. We therefore believe that C8-HSL plays a global role in V. fischeri, inhibiting premature induction of QSR genes (i.e., induction at an inappropriately low population density). This in vivo inhibitory role is not unexpected. The inhibitory activity of C8-HSL supports the notion (see, for example, reference 13) that the production of QSR proteins is adaptive specifically at high population density. Furthermore, analogous mechanisms for inhibiting the expression of quorum-regulated genes exist in other bacteria, including LuxO in V. harveyi (3, 28), TraM in Agrobacterium tumefaciens (29), and RsaL in P. aeruginosa (8). In each of these other quorum-sensing systems, the inhibitor is a protein, whereas in V. fischeri the inhibitor is an acyl-HSL. Despite that difference, inhibition of QSR gene expression at low population density might be a common regulatory theme in bacterial quorum sensing.
The presence of a lux box in the promoter regions of
qsrP and ribB is consistent with the requirement
for LuxR and 3-oxo-C6-HSL for production of QsrP and RibB. LuxR and
3-oxo-C6-HSL presumably control transcription of these genes directly.
The lux operon lux box, to which the
qsrP and ribB lux boxes are similar (Table 3), is
essential for the LuxR/3-oxo-C6-HSL-dependent activation of
lux operon transcription (9, 22, 62). Identical
or similar sequences have been identified in the lux operon
promoters of various V. fischeri strains, the
ainSR promoter region in V. fischeri MJ-1, and
the promoters controlling expression of several genes in P. aeruginosa, traA and traI of the
octopine-type Ti plasmid, and traI of the nopaline-type
plasmid, respectively, of Agrobacterium tumefaciens,
solI of Ralstonia solanacearum, and
cepI of Burkholderia cepacia (26, 30, 33,
36, 39, 41, 45, 52, 68). Thus, both within V. fischeri
(Table 3) and among various gram-negative bacteria, the lux
box represents a conserved regulatory sequence, the presence of which
infers direct quorum-sensing control of that gene or operon by a LuxR
homolog and an acyl-HSL. The qsrP promoter region resembles
that of the lux operon, with the lux box
apparently complementing the lack of a
70-type
35
region. That arrangement, by analogy with the lux operon (9, 24), suggests regulation of qsrP solely by
LuxR/3-oxo-C6-HSL. In contrast, the ribB promoter region
differs by also containing a likely
35 region adjacent to the
lux box and a second appropriately spaced
10 region,
suggesting both quorum-sensing and "housekeeping" regulation of
ribB.
We had anticipated that comparisons between MJ-100 and MJ-215 might reveal all of the proteins of the lux operon, since the luxICDABEG genes are coordinately expressed from a single promoter under LuxR/acyl-HSL control. However, LuxI, LuxC, LuxD, and LuxG were not detected in our analysis. These proteins might comigrate on 2-D PAGE gels with more abundant proteins and thereby be masked, or differential stability might influence their abundance in the cell and, as a consequence, their detection by the 2-D PAGE conditions used here. Similar to our observations, a recent 2-D PAGE analysis of Photorhabdus luminescens lux genes luxCDABE on a recombinant plasmid identified only LuxA, LuxB, and LuxD (47). Regardless of the reason, failure to detect certain of the V. fischeri Lux proteins leads us to anticipate that a more direct approach may be necessary for the identification of additional QSR proteins and genes. Support for this notion is provided by the recent identification of 37 QSR genes in P. aeruginosa by transposon mutagenesis (68). We anticipate, therefore, that additional analysis will reveal many more QSR genes in V. fischeri.
Evidence presented here suggests that a major function of the quorum-sensing regulon in V. fischeri is to coordinate the expression of luminescence and the production of proteins involved in host association. Consistent with this notion is the high level of acyl-HSL detected in light organs of the sepiolid squid E. scolopes (5). With respect to luminescence, the ribB gene could contribute to light production through the involvement of RibB in synthesis of riboflavin, a precursor of the luciferase substrate reduced flavin mononucleotide (48, 55). However, no evidence for an essential role for RibB (QSR 12) in light production was revealed here by analysis of a V. fischeri ribB mutant in laboratory culture. Additional studies will be necessary to ascertain whether the defect in ribB is complemented in V. fischeri by another protein or is more obvious under growth conditions other than those used for routine laboratory culture. With respect to host association, QsrP, a novel protein, apparently is produced by V. fischeri in the symbiosis, and it may be involved in colonization of the squid light organ. By itself, a qsrP mutant colonized the light organs of juvenile E. scolopes to the same extent as its parent strain, whereas in competition with the parent, the mutant was less successful, suggesting that the defect in qsrP confers a competitive disadvantage in the symbiosis. Recently, a katA mutant of V. fischeri also was shown, through procedures similar to those used here, to exhibit a diminished ability to colonize E. scolopes in competition with its parent strain (66). The periplasmic location of QsrP suggests an involvement of the protein in acquisition of nutrients from the host or a response to the host environment. Also identified in this study is a second QSR protein, AcfA (QSR 6), the V. cholerae homolog of which is thought to contribute to the ability of V. cholerae to colonize the mouse intestinal epithelium (53). Furthermore, a possible role for QSR proteins in host colonization is not unexpected. Many QSR genes apparently mediate interactions between bacteria and their plant and animal hosts (13, 39, 65). Nonetheless, validation of the notion that the quorum-sensing regulon plays a major role in coordinating production of proteins involved in host association in V. fischeri must await the identification of additional QSR genes in this species.
Quorum sensing in V. fischeri serves as an important model for the response of gram-negative bacteria to population density and host association. Studies of the regulation of luminescence in V. fischeri, one of the first and presently the best understood quorum-sensing system, set the stage for the discovery of quorum sensing in other gram-negative bacteria (14, 40). The identification of non-Lux QSR genes and proteins in this species extends the significance of the V. fischeri model by making it apparent that luminescence is just one of several activities of a LuxR/acyl-HSL-controlled quorum-sensing regulon in this bacterium. Furthermore, the demonstration that a member of this regulon, qsrP, apparently is necessary for V. fischeri to efficiently colonize its sepiolid squid host highlights the value of V. fischeri as a mutualistic counterpoint to the several pathogenic bacteria whose host interactions are dependent on quorum sensing. Ongoing studies to characterize the roles of AcfA, QsrV, and QSR 7 and to identify additional QSR genes should provide further insight into the extent and significance of the quorum-sensing response in V. fischeri.
| |
ACKNOWLEDGMENTS |
|---|
We thank M. Claes for providing the E. scolopes hatchlings used in this study and for guiding the colonization assays, J. King for facilitating peptide sequencing at MIT, E. Russek-Cohen and M. Pascual for statistics advice, D. Caron for equipment and reagents used in an initial phase of this work, C. Gardel and J. Mekalanos for bacterial strains, and T. Marathe for technical assistance. We thank also the Biopolymers Laboratory at the Massachusetts Institute of Technology for amino-terminal protein sequencing, the Harvard Microchemistry Facility for internal protein sequencing, and the CRC DNA Sequencing Facility at the University of Chicago for DNA sequencing. Preliminary sequence data for V. cholerae RibB were obtained from The Institute for Genomic Research website at http://www.tigr.org.
This research was supported by grant MCB 97-229772 from the National Science Foundation.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: COMB/UMBI, Columbus Center, Suite 236, 701 East Pratt Street, Baltimore, MD 21202. Phone: (410) 234-8834. Fax: (410) 468-3903. E-mail: dunlap{at}umbi.umd.edu.
Present address: Department of Molecular Genetics and Cell Biology,
University of Chicago, Chicago, IL 60637.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Ames, G. F.-L.,
C. Prody, and S. Kustu.
1984.
Simple, rapid, and qualitative release of periplasmic proteins by chloroform.
J. Bacteriol.
160:1181-1183 |
| 2. | Baldwin, T. O., J. H. Devine, R. C. Heckel, J.-W. Lin, and G. S. Shadel. 1989. The complete nucleotide sequence of the lux regulon of Vibrio fischeri and the luxABN region of Photobacterium leiognathi and the mechanism of control of bacterial bioluminescence. J. Biolumin. Chemilumin. 4:326-341[CrossRef][Medline]. |
| 3. | Bassler, B. L., M. Wright, and M. R. Silverman. 1994. Sequence and function of LuxO, a negative regulator of luminescence in Vibrio harveyi. Mol. Microbiol. 12:403-412[Medline]. |
| 4. | Boettcher, K. J., and E. G. Ruby. 1990. Depressed light emission by symbiotic Vibrio fischeri of the sepiolid squid Euprymna scolopes. J. Bacteriol. 176:3701-3706. |
| 5. |
Boettcher, K. J., and E. G. Ruby.
1995.
Detection and quantification of Vibrio fischeri autoinducer from symbiotic squid light organs.
J. Bacteriol.
177:1053-1058 |
| 6. | Claes, M. F., and P. V. Dunlap. 2000. Aposymbiotic culture of the sepiolid squid Euprymna scolopes: role of the symbiotic bacterium Vibrio fischeri in host animal growth, development, and light organ morphogenesis. J. Exp. Zool. 286:280-296[CrossRef][Medline]. |
| 7. |
Davies, D. G.,
M. R. Parsek,
J. P. Pearson,
B. H. Iglewski,
J. W. Costerton, and E. P. Greenberg.
1998.
The involvement of cell-cell signals in the development of a bacterial biofilm.
Science
280:295-298 |
| 8. |
De Kievit, T.,
P. C. Seed,
J. Nezezon,
L. Passador, and B. H. Iglewski.
1999.
RsaL, a novel repressor of virulence gene expression in Pseudomonas aeruginosa.
J. Bacteriol.
181:2175-2184 |
| 9. |
Devine, J. H.,
G. S. Shadel, and T. O. Baldwin.
1989.
Identification of the operator of the lux regulon from the Vibrio fischeri strain ATCC7744.
Proc. Natl. Acad. Sci. USA
86:5688-5692 |
| 10. | Doino, J. A., and M. J. McFall-Ngai. 1995. A transient exposure to symbiosis-competent bacteria induces light organ morphogenesis in the host squid. Biol. Bull. 189:347-355[Abstract]. |
| 11. | Doudoroff, M. 1938. Lactoflavin and bacterial luminescence. Enzymologia 4:239-243. |
| 12. |
Dunlap, P. V.
1989.
Regulation of luminescence by cyclic AMP in cya-like and crp-like mutants of Vibrio fischeri.
J. Bacteriol.
171:1199-1202 |
| 13. | Dunlap, P. V. 1997. N-Acyl-L-homoserine lactone autoinducers in bacteria: unity and diversity, p. 69-106. In J. A. Shapiro, and M. Dworkin (ed.), Bacteria as multicellular organisms. Oxford University Press, New York, N.Y. |
| 14. | Dunlap, P. V. 1999. Quorum regulation of luminescence in Vibrio fischeri. J. Mol. Microbiol. Biotechnol. 1:5-12[Medline]. |
| 15. |
Dunlap, P. V., and S. M. Callahan.
1993.
Characterization of a periplasmic 3':5'-cyclic nucleotide phosphodiesterase gene, cpdP, from the marine symbiotic bacterium Vibrio fischeri.
J. Bacteriol.
175:4615-4624 |
| 16. | Dunlap, P. V., and E. P. Greenberg. 1991. Role of intercellular chemical communication in the Vibrio fischeri-monocentrid fish symbiosis, p. 219-253. In M. Dworkin (ed.), Microbial cell-cell interactions. American Society for Microbiology, Washington, D.C. |
| 17. | Dunlap, P. V., K. Kita-Tsukamoto, J. B. Waterbury, and S. M. Callahan. 1995. Isolation and characterization of a visibly luminous variant of Vibrio fischeri ES114 from the sepiolid squid Euprymna scolopes. Arch. Microbiol. 164:194-202[CrossRef]. |
| 18. |
Dunlap, P. V., and A. Kuo.
1992.
Cell density dependent modulation of the Vibrio fischeri luminescence system in the absence of autoinducer and LuxR protein.
J. Bacteriol.
174:2440-2448 |
| 19. | Dunlap, P. V., U. Mueller, T. A. Lisa, and K. S. Lundberg. 1992. Growth of the marine luminous bacterium Vibrio fischeri on 3':5'-cyclic AMP: correlation with a periplasmic 3':5'-cyclic AMP phosphodiesterase. J. Gen. Microbiol. 138:115-123. |
| 20. | Eberhard, A., A. L. Burlingame, C. Eberhard, G. L. Kenyon, K. H. Nealson, and N. J. Oppenheimer. 1981. Structural identification of autoinducer of Photobacterium fischeri luciferase. Biochemistry 20:24444-22449. |
| 21. | Eberhard, A., C. A. Widrig, P. McBath, and J. B. Schineller. 1986. Analogs of the autoinducer of bioluminescence in Vibrio fischeri. Arch. Microbiol. 146:35-40[CrossRef][Medline]. |
| 22. | Egland, K. A., and E. P. Greenberg. 1999. Quorum sensing in Vibrio fischeri: elements of the luxI promoter. Mol. Microbiol. 31:1197-1204[CrossRef][Medline]. |
| 23. |
Engebrecht, J., and M. Silverman.
1984.
Identification of genes and gene products necessary for bacterial bioluminescence.
Proc. Natl. Acad. Sci. USA
81:4154-4158 |
| 24. |
Engebrecht, J., and M. Silverman.
1987.
Nucleotide sequence of the regulatory locus controlling expression of bacterial genes for bioluminescence.
Nucleic Acids Res.
15:10455-10467 |
| 25. | Fernandez, J., L. Andrews, and S. M. Mische. 1994. An improved procedure for enzymatic digestion of polyvinylidiene difluoride-bound proteins for internal sequence analysis. Anal. Biochem. 218:113-117. |
| 26. |
Flavier, A. B.,
L. M. Ganova-Raeva,
M. A. Schell, and T. P. Denny.
1997.
Hierarchical autoinduction in Ralstonia solanacearum: control of acyl-homoserine lactone production by a novel autoregulatory system responsive to 3-hydroxypalmitic acid methyl ester.
J. Bacteriol.
179:7089-7097 |
| 27. |
Fleischmann, R. D.,
M. D. Adams,
O. White,
R. A. Clayton,
E. F. Kirkness,
A. R. Kerlavage,
C. J. Bult,
J. F. Tomb,
B. A. Dougherty,
J. M. Merrick, et al.
1995.
Whole-genome random sequencing and assembly of Haemophilus influenzae Rd.
Science
269:496-512 |
| 28. |
Freeman, J. A., and B. L. Bassler.
1999.
Sequence and function of LuxU: a two-component phosphorelay protein that regulates quorum sensing in Vibrio harveyi.
J. Bacteriol.
181:899-906 |
| 29. |
Fuqua, C.,
M. Burbea, and S. C. Winans.
1995.
Activity of the Agrobacterium Ti plasmid conjugal transfer regulator TraR is inhibited by the product of the traM gene.
J. Bacteriol.
177:1367-1373 |
| 30. |
Fuqua, C., and S. C. Winans.
1996.
Conserved cis-acting promoter elements are required for density-dependent transcription of Agrobacterium tumefaciens conjugal transfer genes.
J. Bacteriol.
178:435-440 |
| 31. |
Fuqua, W. C.,
S. C. Winans, and E. P. Greenberg.
1994.
Quorum sensing in bacteria: the LuxR/LuxI family of cell density-responsive transcriptional regulators.
J. Bacteriol.
176:269-275 |
| 32. |
Giese, A. C.
1943.
Studies on the nutrition of dim and bright variants of a species of luminous bacteria.
J. Bacteriol.
46:323-331 |
| 33. |
Gilson, L.,
A. Kuo, and P. V. Dunlap.
1995.
AinS and a new family of autoinducer synthesis proteins.
J. Bacteriol.
177:6946-6951 |
| 34. |
Graf, J.,
P. V. Dunlap, and E. G. Ruby.
1994.
Effect of transposon-induced motility mutations on colonization of the host light organ by Vibrio fischeri.
J. Bacteriol.
176:6986-6991 |
| 35. |
Gray, K. M., and E. P. Greenberg.
1992.
Physical and functional maps of the luminescence gene cluster in an autoinducer-deficient Vibrio fischeri strain isolated from a squid light organ.
J. Bacteriol.
174:4384-4390 |
| 36. |
Gray, K. M.,
L. Passador,
B. H. Iglewski, and E. P. Greenberg.
1994.
Interchangeability and specificity of components from the quorum-sensing regulatory systems of Vibrio fischeri and Pseudomonas aeruginosa.
J. Bacteriol.
176:3076-3080 |
| 37. | Greenberg, E. G. 1997. Quorum sensing in gram-negative bacteria. ASM News 63:371-377. |
| 38. |
Hanzelka, B. L.,
M. R. Parsek,
D. L. Val,
P. V. Dunlap,
J. E. Cronan, Jr., and E. P. Greenberg.
1999.
Acylhomoserine lactone synthase activity of the Vibrio fischeri AinS protein.
J. Bacteriol.
181:5766-5770 |
| 39. | Hassett, D. J., J.-F. Ma, J. G. Elkins, T. R. McDermott, U. A. Ochsner, S. E. H. West, C.-T. Huang, J. Fredericks, S. Burnett, P. S. Stewart, G. McFeters, L. Passador, and B. H. Iglewski. 1999. Quorum sensing in Pseudomonas aeruginosa controls expression of catalase and superoxide dismutase genes and mediates biofilm susceptibility to hydrogen peroxide. Mol. Microbiol. 34:1082-1093[CrossRef][Medline]. |
| 40. |
Hastings, J. W., and E. P. Greenberg.
1999.
Quorum sensing: the explanation of a curious phenomenon reveals a common characteristic of bacteria.
J. Bacteriol.
181:2667-2668 |
| 41. |
Hwang, I.,
P.-L. Li,
L. Zhang,
K. R. Piper,
D. M. Cook,
M. E. Tate, and S. K. Farrand.
1994.
TraI, a LuxI homologue, is responsible for production of conjugation factor, the Ti plasmid N-acylhomoserine lactone autoinducer.
Proc. Natl. Acad. Sci. USA
91:4639-4643 |
| 42. |
Kuo, A.,
N. V. Blough, and P. V. Dunlap.
1994.
Multiple N-acyl-L-homoserine lactone autoinducers of luminescence in the marine symbiotic bacterium Vibrio fischeri.
J. Bacteriol.
176:7558-7565 |
| 43. |
Kuo, A.,
S. M. Callahan, and P. V. Dunlap.
1996.
Modulation of luminescence operon expression by N-octanoyl-L-homoserine lactone in ainS mutants of Vibrio fischeri.
J. Bacteriol.
178:971-976 |
| 44. | Lane, W. S., A. Galat, M. W. Harding, and S. L. Schreiber. 1991. Complete amino acid sequence of the FK506 and rapamycin binding protein, FKBP, isolated from calf thymus. J. Protein Chem. 10:151-160[CrossRef][Medline]. |
| 45. | Latifi, A., M. K. Winson, M. Foglino, B. W. Bycroft, G. S. Stewart, A. Lazdunski, and P. Williams. 1995. Multiple homologues of LuxR and LuxI control expression of virulence determinants and secondary metabolites through quorum sensing in Pseudomonas aeruginosa PAO1. Mol. Microbiol. 17:333-343[CrossRef][Medline]. |
| 46. |
Lewenza, S.,
B. Conway,
E. P. Greenberg, and P. A. Sokol.
1999.
Quorum sensing in Burkholderia cepacia: identification of the LuxRI homologs CepRI.
J. Bacteriol.
181:748-756 |
| 47. |
Manefield, M.,
R. de Nys,
N. Kumar,
R. Read,
M. Givskov,
P. Steinberg, and S. Kjelleberg.
1999.
Evidence that halogenated furanones from Delisea pulchra inhibit acylated homoserine lactone (AHL)-mediated gene expression by displacing the AHL signal from its receptor protein.
Microbiology
145:283-291 |
| 48. |
McElroy, W. D.,
J. W. Hastings,
V. Sonnenberg, and J. Coulombre.
1953.
The requirement of riboflavin phosphate for bacterial luminescence.
Science
118:385-386 |
| 49. |
McFall-Ngai, M. J., and E. G. Ruby.
1991.
Symbiont recognition and subsequent morphogenesis as early events in an animal-bacterial mutualism.
Science
254:1491-1494 |
| 50. |
Miller, V. L., and J. J. Mekalanos.
1988.
A novel suicide vector and its use in construction of insertion mutations: osmoregulation of outer membrane proteins and virulence determinants in Vibrio cholerae requires toxR.
J. Bacteriol.
170:2575-2583 |
| 51. |
O'Farrell, P. H.
1975.
High-resolution two-dimensional electrophoresis of proteins.
J. Biol. Chem.
250:4007-4021 |
| 52. | Pesci, E. C., and B. H. Iglewski. 1999. Quorum sensing in Pseudomonas aeruginosa, p. 147-155. In G. M. Dunny, and S. C. Winans (ed.), Cell-cell signaling in bacteria. American Society for Microbiology, Washington, D.C. |
| 53. |
Peterson, K. M., and J. J. Mekalanos.
1988.
Characterization of the Vibrio cholerae toxR regulon: identification of novel genes involved in intestinal colonization.
Infect. Immun.
56:2822-2829 |
| 54. | Rabilloud, T. 1992. A comparison between low background silver diammine and silver nitrate protein stains. Electrophoresis 13:429-439[CrossRef][Medline]. |
| 55. |
Richter, G.,
R. Volk,
C. Krieger,
H.-W. Lahm,
U. Rothlisberger, and A. Bacher.
1992.
Biosynthesis of riboflavin: cloning, sequencing, and expression of the gene coding for 3,4-dihydroxy-2-butanone 4-phosphate synthase of Escherichia coli.
J. Bacteriol.
174:4050-4056 |
| 56. | Ruby, E. G. 1996. Lessons from a cooperative bacterial-animal association: the Vibrio fischeri-Euprymna scolopes light organ symbiosis. Annu. Rev. Microbiol. 50:591-624[CrossRef][Medline]. |
| 57. | Ruby, E. G., and K. H. Nealson. 1976. Symbiotic association of Photobacterium fischeri with the marine luminous fish Monocentris japonica: a model of symbiosis based on bacterial studies. Biol. Bull. 141:574-586. |
| 58. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 59. |
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467 |
| 60. |
Schaefer, A. L.,
D. L. Val,
B. L. Hanzelka,
J. E. Cronan, and E. P. Greenberg.
1996.
Generation of cell-to-cell signals in quorum sensing: acyl homoserine lactone synthase activity of a purified Vibrio fischeri LuxI protein.
Proc. Natl. Acad. Sci. USA
93:9505-9509 |
| 61. | Snedecor, G. W., and W. G. Cochran. 1980. Statistical methods, 7th ed. The Iowa State University Press, Ames. |
| 62. |
Stevens, A. M., and E. P. Greenberg.
1997.
Quorum sensing in Vibrio fischeri: essential elements for activation of the luminescence genes.
J. Bacteriol.
179:557-562 |
| 63. |
Swartzman, E.,
S. Kapoor,
A. F. Graham, and E. A. Meighen.
1990.
A new Vibrio fischeri lux gene precedes a bidirectional termination site for the lux operon.
J. Bacteriol.
172:6797-6802 |
| 64. |
Swartzman, E.,
C. Miyamoto,
A. Graham, and E. A. Meighen.
1990.
Delineation of the transcriptional boundaries of the lux operon of Vibrio harveyi demonstrates the presence of two new lux genes.
J. Biol. Chem.
265:3513-3517 |
| 65. | Swift, S., P. Williams, and G. S. A. B. Stewart. 1999. N-Acylhomoserine lactones and quorum sensing in proteobacteria, p. 291-313. In G. M. Dunny, and S. C. Winans (ed.), Cell-cell signaling in bacteria. American Society for Microbiology, Washington, D.C. |
| 66. |
Visick, K. L., and E. G. Ruby.
1998.
The periplasmic, group III catalase of Vibrio fischeri is required for normal symbiotic competence and is induced both by oxidative stress and by approach to stationary phase.
J. Bacteriol.
180:2087-2092 |
| 67. | von Heijne, G. 1990. The signal peptide. J. Membr. Biol. 115:195-201[CrossRef][Medline]. |
| 68. |
Whiteley, M.,
K. M. Lee, and E. G. Greenberg.
1999.
Identification of genes controlled by quorum sensing in Pseudomonas aeruginosa.
Proc. Natl. Acad. Sci. USA
96:13904-13909 |
| 69. |
Zenno, S., and K. Saigo.
1994.
Identification of the genes encoding NAD(P)H-flavin oxidoreductases that are similar in sequence to Escherichia coli Fre in four species of luminous bacteria: Photorhabdus luminescens, Vibrio fischeri, Vibrio harveyi, and Vibrio orientalis.
J. Bacteriol.
176:3544-3551 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»