This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Elsen, S.
Right arrow Articles by Bauer, C. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Elsen, S.
Right arrow Articles by Bauer, C. E.

 Previous Article  |  Next Article 

Journal of Bacteriology, May 2000, p. 2831-2837, Vol. 182, No. 10
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.

Expression of Uptake Hydrogenase and Molybdenum Nitrogenase in Rhodobacter capsulatus Is Coregulated by the RegB-RegA Two-Component Regulatory System

Sylvie Elsen,1,dagger Wanda Dischert,2 Annette Colbeau,2 and Carl E. Bauer1,*

Department of Biology, Indiana University, Bloomington, Indiana 47405,1 and UMR 5092 CEA-CNRS-UJF, Laboratoire de Biochimie et Biophysique des Systèmes Intégrés, Département de Biologie Moléculaire et Structurale, CEA/Grenoble, 38054 Grenoble cedex 9, France2

Received 2 December 1999/Accepted 16 February 2000


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Purple photosynthetic bacteria are capable of generating cellular energy from several sources, including photosynthesis, respiration, and H2 oxidation. Under nutrient-limiting conditions, cellular energy can be used to assimilate carbon and nitrogen. This study provides the first evidence of a molecular link for the coregulation of nitrogenase and hydrogenase biosynthesis in an anoxygenic photosynthetic bacterium. We demonstrated that molybdenum nitrogenase biosynthesis is under the control of the RegB-RegA two-component regulatory system in Rhodobacter capsulatus. Footprint analyses and in vivo transcription studies showed that RegA indirectly activates nitrogenase synthesis by binding to and activating the expression of nifA2, which encodes one of the two functional copies of the nif-specific transcriptional activator, NifA. Expression of nifA2 but not nifA1 is reduced in the reg mutants up to eightfold under derepressing conditions and is also reduced under repressing conditions. Thus, although NtrC is absolutely required for nifA2 expression, RegA acts as a coactivator of nifA2. We also demonstrated that in reg mutants, [NiFe]hydrogenase synthesis and activity are increased up to sixfold. RegA binds to the promoter of the hydrogenase gene operon and therefore directly represses its expression. Thus, the RegB-RegA system controls such diverse processes as energy-generating photosynthesis and H2 oxidation, as well as the energy-demanding processes of N2 fixation and CO2 assimilation.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

The purple nonsulfur photosynthetic bacterium Rhodobacter capsulatus exhibits remarkable metabolic diversity (30). This bacterium is capable of generating energy from light via photosynthesis as well as from dark aerobic and anaerobic respiration. Another feature is the capacity to grow heterotrophically as well as autotrophically. When growing autotrophically, the cells are also capable of generating cellular energy and reducing power by the oxidation of H2, which occurs at a membrane-bound [NiFe]hydrogenase complex. Several decades ago, Gest and colleagues described the presence of redox-related interrelationships among carbon assimilation, N2 fixation, and photophosphorylation (26; reviewed in reference 27). However, the nature and even the existence of specific molecular mechanisms for balancing the use of reducing equivalents have remained unclear.

Recent studies have suggested that balancing different metabolic processes could result, at least partially, from the activity of a global two-component regulatory system that regulates the synthesis of the enzymes involved in different energetic processes. Indeed, the three fundamental biological processes catalyzed by photosynthetic bacteria, i.e., photosynthesis, CO2 fixation, and N2 assimilation, are affected by the RegB-RegA global two-component transduction signal system in Rhodobacter sphaeroides (32). In R. capsulatus, the RegB-RegA system functions as a classic two-component system, with RegB being a membrane-spanning histidine kinase capable of autophosphorylating in the presence of ATP (3, 40, 47). The phosphate group is then transferred to its cognate partner, the cytosolic response regulator RegA (3, 31, 47). Phosphorylation of RegA increases its DNA-binding to the puf and puc photosynthesis promoters where it functions as an activator of transcription (3, 15). Homologous systems have been found in many species of the alpha  proteobacteria, including such photosynthetic species as R. sphaeroides, Rhodovulum sulfidophilum, and Roseobacter denitrificans (21, 22, 37), as well as in nonphotosynthetic species such as Bradyrhizobium japonicum and Rhizobium meliloti (2, 49). RegA and its homologs exhibit an unprecedented 79% degree of conservation, especially in the C-terminal DNA-binding helix-turn-helix structure, which is 100% conserved (37). This suggests that the RegB-RegA system plays a fundamental role in this group of bacteria.

Originally the RegB-RegA system was discovered for its role in anaerobic activation of the puf, puc, and puh photosynthetic gene operons from R. capsulatus (40, 47). In addition to its involvement in photosynthesis, a related RegB-RegA system from R. sphaeroides (PrrB-PrrA) has been implicated in the positive regulation of the cbbI and cbbII operons that encode enzymes of the Calvin cycle CO2 fixation pathway (45; J. M. Dubbs, T. H. Bird, C. E. Bauer, and F. R. Tabita, submitted for publication). The R. sphaeroides system was also shown to be involved in the nitrogen fixation process, since the derepression of nitrogenase synthesis that occurs in the absence of the CO2 fixation pathway requires a functional regB gene (32). It has also been shown that inactivation of a RegA homolog in the nonphotosynthetic bacterium B. japonicum (RegR) reduces nitrogen fixation to a level where nodules are ineffective in fixing nitrogen. This effect on nitrogen fixation is caused by a dependence of RegR for optimal expression of NifA, which is a nif-specific transcriptional activator of nitrogenase structural genes (2). However, to date, direct binding of RegR to the nifA promoter has not been established.

In this study, we have demonstrated that the RegB-RegA system from R. capsulatus indirectly activates the synthesis of nitrogenase. Indeed, our in vivo and in vitro studies demonstrate that RegA binds to and activates expression of the nifA2 gene, which encodes one of the two functional copies of the NifA transcriptional activator of the nitrogenase structural genes. We also demonstrate that RegA directly represses [NiFe]hydrogenase structural gene expression by binding to the hupSLC promoter.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Bacterial strains, media, and culture conditions. The R. capsulatus strains used in the study are wild-type strain SB1003 (55), the regA-disrupted strain MS01 (47), and the regB-disrupted strain SD01 (15). R. capsulatus strains were grown at 34°C in minimal salts medium (RCV) (54) supplemented with 30 mM DL-malate as a carbon source and either 7 mM L-glutamate (MG medium) or 7 mM ammonium sulfate (MN medium) as a nitrogen source. RCV malate without a nitrogen source was used as a nitrogen-free (NF) medium. For hydrogenase studies, strains were grown either under aerobic dark conditions or under anaerobic photosynthetic conditions in the light (about 2,500 lx) as previously described by Colbeau et al. (10). For the nitrogenase studies, cells were grown anaerobically overnight in MN medium, washed in NF medium, and induced in MG or MN medium aerobically or anaerobically for 12 to 14 h as described previously by Fostner-Hartnett and Kranz (25). Escherichia coli strains were grown aerobically in Luria-Bertani medium at 37°C (46). Antibiotics were added at the following concentrations (milligrams per liter) : 100 (ampicillin), 100 (spectinomycin), 50 (trimethoprim), and 10 (tetracycline) for E. coli, and 10 (kanamycin), 10 (spectinomycin), and 1 (tetracycline) for R. capsulatus.

Plasmids and plasmid mobilization. Mobilization of plasmids pNF:Q-ZOmega (nifH::lacZ) (43) from E. coli to R. capsulatus was accomplished with mobilizing strain Tec5 (48) as described by Young et al. (56). Plasmids pDFH100Bcl (nifA1::lacZ) (25), pDFH200T (nifA2::lacZ) (25), and pAC142 (hupS::lacZ) (12) were mated into R. capsulatus recipient strains using the triparental mating system of Ditta et al. (14) using conditions described by Colbeau et al. (9).

Enzyme assays. Hydrogenase activity was assayed in whole cells as previously described with 0.15 mM methylene blue as the electron acceptor (11). Nitrogenase assays were performed as reported by Meyer et al. (39). beta -Galactosidase activity was assayed as described by Elsen et al. (20).

DNase I footprint analysis. RegA* was overexpressed and purified as previously described by Du et al. (15). Probes were prepared by PCR amplification as follows. Amplification of the hupSLC promoter utilized primers HOse31 (5'-CGACAATTGTCCCTCCCTTGC) and HOse38 (5'-GCGGCGGCAAAATTGGAAAGC), and plasmid pAC142 (12) previously digested with BamHI was used as a template. Primers FOse36 (5'-GGAAGCGCCATTTTTTTCGGC) and FOse37 (5'CATGTCGAGACTTGGTCAAGC) were used for amplification of the nifA2 promoter, with genomic DNA as the template. For selective labeling of DNA strands, one of the primers of the PCR amplification was 5'-end labeled with 32P prior to amplification and the amplified DNA fragments were purified as described previously (19). A 10-µl binding reaction mixture was first prepared, containing 1 µl of DNA (50 fmol), 7 µl of H2O, and 2 µl of 5× footprint binding buffer composed of 125 mM HEPES (pH 8.0), 300 mM potassium acetate, 25 mM magnesium actetate, 10 mM calcium chloride, 5 mM dithiothreitol, and 125 µg of bovine serum albumin per ml. The reaction mixture was then added to a 10-µl solution composed of 2 volumes of 1× footprint binding buffer and 1 volume of protein dialysis buffer (15) containing various amounts of RegA*. Digestion with DNase I and subsequent termination of the assays were carried out as previously described by Bird et al. (4). A modified Maxam and Gilbert G+A chemical sequencing reaction was used to determine the location of DNase I protection (38).


    RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

The RegB-RegA two-component regulatory system is involved in nitrogenase gene regulation. We assessed whether biosynthesis of the R. capsulatus molybdenum nitrogenase was affected by the RegB-RegA signal transduction cascade by assaying nitrogenase enzyme activity in the wild-type parent strain SB1003, the regA-disrupted mutant strain MS01, and the regB-disrupted mutant strain SD01. As shown in Table 1, nitrogenase activity was high in SB1003 cells that were grown in MG medium. There was no significant nitrogenase activity when these cells were grown in MN medium (Table 1) or when oxygen was present (data not shown). This pattern is similar to that reported by Pollock et al. (43), which reflects the regulation of nitrogenase synthesis in response to fixed nitrogen availability by the ntr system and to the oxygen sensitivity of the NifA proteins which function as transcriptional activators of the nifHDK operon (reviewed in reference 35). The data in Table 1 also demonstrate that nitrogenase activity was significantly affected by regA and regB disruptions, as evidenced by five- and fourfold reductions observed in MS01 and SD01 cells, respectively, under derepressing conditions.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   Nitrogenase and beta -galactosidase activities of the wild-type (SB1003), regA-disrupted (MS01), and regB-disrupted (SD01) strains harboring plasmid pNF:Q-ZOmega  (nifH::lacZ)

We also assayed beta -galactosidase activities in strains SB1003, MS01, and SD01 that contained a nifH::lacZ fusion (pNF:Q-ZOmega ) to determine if the observed reduction in nitrogenase activity reflected reduced transcription rates. The beta -galactosidase activities shown in Table 1 demonstrate that the nitrogenase activities observed for various strains and growth conditions are also reflected by a similar pattern of nifH::lacZ expression. Thus, the R. capsulatus RegB-RegA two-component system appears to be affecting nitrogenase biosynthesis.

RegA indirectly activates nitrogenase gene expression. We next addressed whether RegA directly controls nitrogenase expression by binding to the nifHDK promoter region, by performing DNase I protection assays on both DNA strands of a 321-bp fragment that contains the nifHDK promoter region (from bp -264 to +57). Using the RegA* protein, which exhibits constitutive activity in vivo (15) and high DNA-binding affinity in vitro (3), we observed no RegA*-mediated protection of either strand of the nifHDK promoter region (data not shown). This suggests that RegA may indirectly regulate nitrogenase gene expression.

In species where it has been tested, the direct activator of nifHDK expression under conditions of fixed nitrogen and oxygen limitation is the NifA protein (reviewed in references 23 and 35). Two identical copies of nifA, termed nifA1 and nifA2, are present in R. capsulatus, and the product of either gene is sufficient for diazotrophic growth (36). To determine whether RegB-RegA indirectly controls nifHDK expression by affecting the transcription of nifA1 and/or nifA2, we introduced nifA1::lacZ (pDFH100Bcl) and nifA2::lacZ (pDFH200T) fusion plasmids into SB1003, MS01, and SD01 cells and subsequently measured beta -galactosidase activities under different growth conditions. As shown in Table 2, nifA1 and nifA2 expression in the wild-type strain SB1003 had a similar pattern of high expression in MG medium and an approximate 10-fold reduction in activity when the cells were grown in presence of ammonium (MN medium). The reduction of activity observed in MN medium-grown cells is in agreement with a role of the transcriptional activator NtrC, which activates nifA expression only in ammonium-free medium (25, 29).

                              
View this table:
[in this window]
[in a new window]
 
TABLE 2.   beta -Galactosidase activity measurements of nifA1::lacZ and nifA2::lacZ reporter gene fusions in wild-type strain SB1003, regA-disrupted strain MS01, and regB-disrupted strain SD01

When nifA1::lacZ expression was measured in the regA- and regB-disrupted strains MS01 and SD01, respectively, no effect on beta -galactosidase activities in cells grown in all of the tested media was observed (Table 2). There was also no evidence of RegA* binding to the nifA1 promoter region as measured by DNase I protection assays (data not shown). On the other hand, expression of nifA2 is significantly reduced in both MS01 and SD01 cells relative to the level observed in wild-type cells under all of the tested growth conditions (Table 2). Specifically, nifA2 expression in MS01 was reduced 8.3-fold in MG medium and 17-fold in MN medium under anaerobiosis. Similarly, strain SD01 exhibited a 7.5-fold reduction in MG medium and a 10.6-fold reduction in MN medium. The RegB-RegA system also appears to control nifA2 expression in the presence of oxygen, as illustrated by a 5.5- and 7-fold reduction of expression in MG and MN media, respectively, in the regA-disrupted strain under aerobic growth conditions (Table 2). Furthermore, expression of nifA2 is still under the control of nitrogen availability, as evidenced by higher beta -galactosidase activities in MG than MN medium. The strong effect of regB and regA inactivation on nifA2 expression could explain the reduction in nifHDK gene expression in the mutants described above.

nifA2 expression is directly controlled by RegA. DNase I protection analyses of RegA* binding to the nifA2 promoter were undertaken to determine if RegA directly regulates nifA2 expression. As illustrated by a protected region from bp -43 to -61 on the top strand (Fig. 1A) and from bp -43 to -72 on the bottom strand (Fig. 1B), RegA does indeed bind to the nifA2 promoter. A hypersensitive site was also observed on each strand, which corresponds to position -61. As shown in Fig. 2A, RegA binds to the nifA2 promoter between the transcription start sites and the previously mapped NtrC DNA-binding sites (24, 25). These results indicate that RegA indirectly activates nifHDK gene expression by participating in the activation of nifA2 gene expression.


View larger version (98K):
[in this window]
[in a new window]
 
FIG. 1.   DNase I footprint analysis of RegA* binding to the nifA2 and hupSLC promoters. RegA*-mediated DNase I protection patterns to the top (A) and bottom (B) strands of the nifA2 promoter and to the top (C) and bottom (D) strands of the hupSLC promoter are presented. G+A indicates a Maxam-Gilbert sequencing ladder. Each of the subsequent lanes are protection patterns generated in the presence of increasing micromolar concentrations of purified RegA*. The thick and thin vertical bars represent the major and minor RegA* DNA-binding sites, respectively. The arrows show the start and direction of transcription of the genes. DNase I-hypersensitive sites are indicated by asterisks.


View larger version (24K):
[in this window]
[in a new window]
 
FIG. 2.   Features of the nifA2 (A) and hupSLC (B) promoters. Horizontal arrows in nifA2 (25) and hupSLC (51) indicate previously published transcription start sites. Putative -35 and -10 promoter sequences are underlined. Black boxes indicate regions of top- and bottom-strand protection from DNase I digestion by RegA*, and asterisks correspond to DNase I-hypersensitive sites. Also indicated are the DNA-binding sites of NtrC (gray boxes) (24), HupR (white box) (13), and IHF (bracket) (50).

RegB-RegA controls hydrogenase biosynthesis. Nitrogenase is capable of generating hydrogen as a by-product of N2 fixation. Thus, there appears to be a metabolic link between nitrogenase and hydrogenase synthesis, since the presence of hydrogen stimulates synthesis of the H2 uptake hydrogenase (reviewed in reference 53). Consequently, we also addressed whether disruption of regB or regA could directly or indirectly affect the expression of the uptake hydrogenase. For this analysis, we assayed hydrogenase activity and hup expression patterns in wild-type and regB- and regA-disrupted strains that contained the hupS::lacZ reporter plasmid, pAC142 (12). The data in Table 3 show that hydrogenase activity values and beta -galactosidase measurements of hupS::lacZ expression varied in parallel for each of the various strains and growth conditions tested. In the wild-type strain, SB1003, activity was high when H2 was evolved from nitrogenase, which occurs under anaerobic growth conditions in MG medium. In contrast, activity was low when the hydrogen concentration was low or absent, which occurs when cells are grown in MN medium under aerobic or anaerobic conditions, when nitrogenase does not evolve hydrogen. However, activity was restored to high levels when 10% hydrogen was exogenously added to MN medium. This demonstrates that there is a dependence of hup expression on hydrogen, and not simply on synthesis of nitrogenase. The pattern of H2 dependence of hup expression in SB1003 is very similar to that previously reported by Colbeau and Vignais (12) with wild-type strain B10 of R. capsulatus. An involvement of RegA and RegB in the control of hydrogenase synthesis is evidenced by a strong increase in beta -galactosidase and hydrogenase activities in the reg mutants under all growth conditions tested (Table 3). Indeed, disruption of regA or regB both led to the same three- to sixfold increase in hupS::lacZ expression and hydrogenase enzyme activity under the various tested growth conditions. Interestingly, hydrogenase synthesis is still regulated by H2 in the regA- and regB-disrupted strains, as evidenced by the stimulation of hup expression in the presence of endogenously produced (MG medium) or exogenously added H2 in strains MS01 and SD01 (Table 3). Thus, the RegB-RegA signal transduction system represses hydrogenase synthesis by a mechanism that is independent of the HupT-HupR system, which activates hupSLC synthesis in response to the presence of H2 (13, 51). Interestingly, the RegB-RegA system appears to be modulating hup expression under both aerobic and anaerobic growth conditions even though RegB kinase activity is thought to be affected by the oxygen status of the cell.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 3.   Hydrogenase and beta -galactosidase activities of the wild-type (SB1003), regA-disrupted (MS01), and regB-disrupted (SD01) strains harboring plasmid pAC142 (hupS::lacZ)

RegA directly represses hydrogenase gene expression. We also tested whether RegA affects hup expression by direct binding to the hupSLC promoter region, by performing a DNase I protection analysis with RegA*. A RegA* DNA-binding site, which extends from bp -37 to -58 on the top strand (Fig. 1C) and from bp -44 to -61 on the bottom strand (Fig. 1D), was observed with as little as 5 µM RegA*. As also indicated in Fig. 1, when the RegA* concentration was increased from 10 to 30 µM, a second protected region was detected from bp -79 to -98 on the top strand and from bp -78 to -103 on the bottom strand. This second RegA*-protected region overlaps with a previously described integration host factor (IHF) DNA-binding site (50) that is located from bp -93 to -81 (Fig. 2B). Expression of hupSLC is known to be strongly activated in the presence of IHF (50), indicating that RegA may function as a repressor of hydrogenase gene expression in R. capsulatus by competing with IHF for binding to this region. Hydrogenase expression is also highly dependent on the presence of H2, which is mediated by the two-component transcriptional regulator HupR, which binds upstream from the IHF-binding site, as indicated in Fig. 2B (13, 51).


    DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Hydrogenase and nitrogenase syntheses are coregulated by the RegB-RegA system. In the present study, we have identified two important new elements of the reg regulon controlled by the RegB-RegA two-component regulatory system in R. capsulatus (Fig. 3). Using in vitro footprint analysis and in vivo lacZ fusion studies, we have demonstrated that the response regulator RegA indirectly activates the nifHDK nitrogenase genes and directly represses the hupSLC hydrogenase structural genes. Uptake hydrogenase and nitrogenase synthesis are coregulated in Rhizobium leguminosarum bv. viciae by the nitrogen fixation regulator NifA (7) and two FnrN proteins (28). However, no genetic relationship had yet been established between nitrogenase and hydrogenase in R. capsulatus. This study is the first demonstration of coregulation between hydrogenase and nitrogenase synthesis in R. capsulatus which occurs by the RegB-RegA two-component regulatory system.


View larger version (29K):
[in this window]
[in a new window]
 
FIG. 3.   The reg regulon of R. capsulatus. The RegB-RegA signal transduction system activates photosynthesis (puf, puh, and puc), nitrogen fixation (nifA2), and carbon assimilation (cbb) genes and represses hydrogenase structural genes (hupSLC) and its own expression. References are given in the text.

The nif genes required for biosynthesis and assembly of the molybdenum nitrogenase are activated under conditions of both fixed nitrogen and oxygen limitation (reviewed in reference 35). Under nitrogen limitation, the ntr system activates the expression of the two functional copies of nifA in R. capsulatus. It has been demonstrated that NtrC binds to two tandem sites centered more than 100 bp upstream of the nifA1 and nifA2 transcriptional start sites and that NtrC~P activates the sigma 70-containing RNA polymerase holoenzyme (6, 24). The two NifA proteins then activate the expression of all the other nif genes in the absence of oxygen (35). Our results indicate that RegA enhances nifA2 expression under all growth conditions tested. Since it has previously been shown that NtrC is absolutely required for nifA2 expression (25), RegA appears to function as a coactivator with NtrC to ensure optimal nifA2 expression.

The membrane-bound [NiFe]hydrogenase, encoded by the hupSLC operon, catalyzes hydrogen oxidation in R. capsulatus. This enzyme allows cells to grow autotrophically, with hydrogen as an electron source. Under photoheterotrophic growth conditions, hupSLC expression is activated by hydrogen gas evolved by nitrogenase as a by-product of nitrogen assimilation (reviewed in reference 53). Hydrogenase synthesis is known to be activated in the presence of hydrogen by the two-component system HupT-HupR. The HupU and HupV proteins have been proposed to sense the hydrogen stimulus and to transfer information to the histidine protein kinase HupT (17, 18, 52). HupT is then thought to control the phosphorylated state of the response regulator HupR, which activates hupSLC transcription by directly binding to the promoter (13, 51). Another regulatory factor required for hupSLC expression is the histone-like IHF protein that binds to a region between RNA polymerase and HupR DNA-binding sites (13, 50). Our results indicate that the RegB-RegA two-component regulatory system is involved in repression of hydrogenase gene expression under heterotrophic growth conditions. We have also observed that RegA* binds to a region that overlaps the IHF DNA-binding site. Presumably, competition between IHF and RegA for binding to this region is the reason for the repressing effect of RegA.

In earlier studies, RegB and RegA were demonstrated to be required for direct activation of transcription of the photosynthesis genes (reviewed in reference 1). It has also recently been demonstrated that RegA directly activates the cbb operons that code for enzymes of the Calvin CO2 fixation cycle in R. capsulatus (P. Vichivanives, C. E. Bauer, and R. Tabita, submitted). Furthermore a functional regB gene is required for the derepression of nitrogenase synthesis that occurs in R. sphaeroides when the Calvin cycle is mutationally disrupted, even in the presence of ammonium (32). Recent studies have shown that the system also regulates aerobic respiration, by controlling the biosynthesis of the two identified terminal oxidases in R. capsulatus, as well as the electron transfer system shared by respiration and photosynthesis processes (L. Swem, S. Elsen, T. H. Bird, H. Myllykallio, F. Daldal, and C. E. Bauer, unpublished data). Therefore, the RegB-RegA system appears to control energy-generating and energy-consuming metabolisms involved in the consumption and production of reduced equivalents. Specifically, this two-component system represses hydrogenase synthesis that catalyzes H2 oxidation, which is a net generator of reducing equivalents, and activates CO2 assimilation and N2 fixation, which are processes that utilize reducing equivalents. RegB-RegA appears to function in a manner that would lower the reducing-equivalent level in the cell. The system appears to be a master cellular redox regulator that ensures that cells do not become overreduced.

The RegB-RegA system functions as a global regulator. A common occurrence among many RegB-RegA-controlled genes is the presence of additional activators and/or repressors that regulate their expression. Indeed, RegA activity appears to involve competition or synergy at its target promoters, with a broad range of transcription factors such as histone-like proteins (IHF), LysR family proteins (CbbR), and response regulators (HupR, NtrC). For example, expression of the light-harvesting photosystem II apoproteins encoded by the puc operon is anaerobically activated by RegA as well as aerobically repressed by CrtJ (15, 19, 44). For H2 oxidation, hup expression is activated by the presence of H2 via the response regulator HupR (13, 51) and repressed by RegA. In N2 fixation, nifA2 expression is clearly dependent on limitation of fixed nitrogen via activation by NtrC (24; reviewed in reference 35), as well as activation by RegA. In carbon fixation, regulation of the cbb operons that code for Calvin cycle enzymes involves activation by CbbR in response to fixed carbon levels as well as activated by RegA (16; J. M. Dubbs, T. H. Bird, C. E. Bauer, and F. R. Tabita, submitted for publication). Hence, the RegB-RegA two-component system appears to function as a secondary regulator that provides an overlying layer of control on these otherwise specifically regulated processes. In many respects, the global nature of the reg regulon is similar to what has been observed for the ArcB-ArcA two-component system in E. coli. The ArcB-ArcA global system provides redox-responsive regulation of a variety of metabolic genes, many of which are also regulated by additional transcription factors (reviewed in reference 33).

A question that is currently being addressed involves the mechanisms that allow RegA to interact with such diverse transcription factors to control target gene expression. Recently, Bowman et al. (5) demonstrated that RegA and CrtJ proteins compete for overlapping DNA-binding sites on the puc promoter. As suggested above, one could envision that repression exerted by RegA on hupS expression may also result from competition with IHF for binding to the hup promoter, since IHF and RegA DNA-binding sites overlap. Bowman et al. (5) also demonstrated that RegA recruits RNA polymerase-sigma 70 to the puf and puc promoters by establishing protein-protein interactions. It is interesting that the nifA1 and nifA2 promoters in R. capsulatus are atypical in that, although they do require NtrC for activation, they are recognized by the housekeeping RNA polymerase-sigma 70 rather than RNA polymerase-sigma 54 (6). As observed for puc and puf, RegA could play a role in recruiting RNA polymerase-sigma 70 to the nifA2 promoter, with NtrC then playing a role in promoting activation. In such a case, RegA would not directly activate transcription but instead would increase expression by providing more RNA polymerase bound to the promoter region that would then be activated by NtrC. Clearly, continued studies of the mechanism of RegA activities on these target promoters are warranted, given the diversity of promoter types that RegA regulates.

Oxygen is not a direct inhibitor of the histidine protein kinase, RegB. The RegB-RegA system was first identified as being responsible for anaerobic activation of photosynthesis gene expression (40, 47). Oxygen was originally thought to directly inhibit RegB kinase activity, but this has never been directly demonstrated. The results of this study indicate that RegB and RegA are capable of repressing hup gene expression even under conditions where oxygen is present (chemoheterotrophic conditions), suggesting that RegB may be phosphorylating RegA in the presence of oxygen (Table 3). This conclusion is supported by a previous study by Madigan and Gest (34), which demonstrated that R. capsulatus cells exhibited full pigment production under chemoautotrophic conditions where O2, H2, and CO2 are present. The current model is that the RegB-RegA system responds to the overall redox state of the cell rather than to oxygen directly. This model is supported by studies which demonstrate that R. capsulatus and R. sphaeroides mutants lacking cbb3-type cytochrome c oxidase exhibit elevated photosynthesis gene expression under both aerobic and anaerobic conditions (8, 41). Presumably electron flow through a functional cbb3-type cytochrome c oxidase is required for a normal regulation of photosystem synthesis by transmitting a redox signal to RegB. The redox pathway in R. sphaeroides appears to involve the protein CcoQ, one of the cytochrome c oxidase components, and the protein RdxB (41, 42). However, it is not yet clear if these proteins are also involved in RegB sensing in R. capsulatus. A better understanding of the redox-sensing pathway is needed to elucidate how RegB-RegA is able to control the expression of such different metabolic processes in R. capsulatus.


    ACKNOWLEDGMENTS

We thank Howard Gest, Fevzi Daldal, and Terry Bird for stimulating discussions and Robert Kranz for the nifA1 and nifA2 reporter plasmids.

This work is supported by NIH grant GM53940 (to C.E.B.) and CEA-CNRS-UJF grant (UMR 5092) (to A.C.).


    FOOTNOTES

* Corresponding author. Mailing address: Department of Biology, Indiana University, Jordan Hall, Bloomington, IN 47405. Phone: (812) 855-6595. Fax: (812) 855-6705. E-mail: cbauer{at}bio.indiana.edu.

dagger Present address: UMR 5092 CEA-CNRS-UJF, Laboratoire de Biochimie et Biophysique des Systèmes Intégrés, Département de Biologie Moléculaire et Structurale, CEA/Grenoble, 38054 Grenoble cedex 9, France.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Bauer, C. E., and T. H. Bird. 1996. Regulatory circuits controlling photosynthesis gene expression. Cell 85:5-8[CrossRef][Medline].
2. Bauer, E., T. Kaspar, H. M. Fischer, and H. Hennecke. 1998. Expression of the fixR-nifA operon in Bradyrhizobium japonicum depends on a new response regulator, RegR. J. Bacteriol. 180:3853-3863[Abstract/Free Full Text].
3. Bird, T. H., S. Du, and C. E. Bauer. 1999. Autophosphorylation, phosphotransfer and DNA-binding properties of the RegB/RegA two-component regulatory system in Rhodobacter capsulatus. J. Biol. Chem. 274:16343-16348[Abstract/Free Full Text].
4. Bird, T. H., J. K. Grimsley, J. A. Hoch, and G. B. Spiegelman. 1996. The Bacillus subtilis response regulator Spo0A stimulates transcription of the spoIIG operon through modification of RNA polymerase promoter complexes. J. Mol. Biol. 256:436-448[CrossRef][Medline].
5. Bowman, W. C., S. Du, C. E. Bauer, and R. G. Kranz. 1999. In vitro activation and repression of photosynthesis gene transcription in Rhodobacter capsulatus. Mol. Microbiol. 33:429-437[CrossRef][Medline].
6. Bowman, W. C., and R. G. Kranz. 1998. A bacterial ATP-dependent, enhancer binding protein that activates the housekeeping RNA polymerase. Genes Dev. 12:1884-1893[Abstract/Free Full Text].
7. Brito, B., M. Martinez, D. Fernandez, L. Rey, E. Cabrera, J. M. Palacios, J. Imperial, and T. Ruiz-Argüezo. 1997. Hydrogenase genes from Rhizobium leguminosarum bv. viciae are controlled by the nitrogen fixation regulatory protein NifA. Proc. Natl. Acad. Sci. USA 94:6019-6024[Abstract/Free Full Text].
8. Buggy, J., and C. E. Bauer. 1995. Cloning and characterization of senC, a gene involved in both aerobic respiration and photosynthesis gene expression in Rhodobacter capsulatus. J. Bacteriol. 177:6958-6965[Abstract/Free Full Text].
9. Colbeau, A., A. Godfroy, and P. M. Vignais. 1986. Cloning of DNA fragments carrying hydrogenase genes of Rhodopseudomonas capsulata. Biochimie 68:147-155[Medline].
10. Colbeau, A., B. C. Kelley, and P. M. Vignais. 1980. Hydrogenase activity in Rhodopseudomonas capsulata: relationship with nitrogenase activity. J. Bacteriol. 144:141-148[Abstract/Free Full Text].
11. Colbeau, A., and P. M. Vignais. 1983. The membrane-bound hydrogenase of Rhodopseudomonas capsulata is inducible and contains nickel. Biochim. Biophys. Acta 748:128-138.
12. Colbeau, A., and P. M. Vignais. 1992. Use of hupS::lacZ gene fusion to study regulation of hydrogenase expression in Rhodobacter capsulatus: stimulation by H2. J. Bacteriol. 174:4258-4264[Abstract/Free Full Text].
13. Dischert, W., P. M. Vignais, and A. Colbeau. 1999. The synthesis of Rhodobacter capsulatus HupSL hydrogenase is regulated by the two-component HupT/HupR system. Mol. Microbiol. 34:995-1006[CrossRef][Medline].
14. Ditta, G., S. Stanfield, D. Corbin, and D. R. Helinski. 1980. Broad host range DNA cloning system from Gram-negative bacteria: construction of a gene bank of Rhizobium meliloti. Proc. Natl. Acad. Sci. USA 77:7347-7351[Abstract/Free Full Text].
15. Du, S., T. H. Bird, and C. E. Bauer. 1998. DNA binding characteristics of RegA*. A constitutively active anaerobic activator of photosynthesis gene expression in Rhodobacter capsulatus. J. Biol. Chem. 273:18509-18513[Abstract/Free Full Text].
16. Dubbs, J. M., and F. R. Tabita. 1998. Two functionally distinct regions upstream of the cbbI operon of Rhodobacter sphaeroides regulate gene expression. J. Bacteriol. 180:4903-4911[Abstract/Free Full Text].
17. Elsen, S., A. Colbeau, J. Chabert, and P. M. Vignais. 1996. The hupTUV operon is involved in negative control of hydrogenase synthesis in Rhodobacter capsulatus. J. Bacteriol. 178:5174-5181[Abstract/Free Full Text].
18. Elsen, S., A. Colbeau, and P. M. Vignais. 1997. Purification and in vitro phosphorylation of HupT, a regulatory protein controlling hydrogenase gene expression in Rhodobacter capsulatus. J. Bacteriol. 179:968-971[Abstract/Free Full Text].
19. Elsen, S., S. N. Ponnampalam, and C. E. Bauer. 1998. CrtJ bound to distant binding sites interacts cooperatively to aerobically repress photopigment biosynthesis and light harvesting II gene expression in Rhodobacter capsulatus. J. Biol. Chem. 273:30762-30769[Abstract/Free Full Text].
20. Elsen, S., P. Richaud, A. Colbeau, and P. M. Vignais. 1993. Sequence analysis and interposon mutagenesis of the hupT gene, which encodes a sensor protein involved in repression of hydrogenase synthesis in Rhodobacter capsulatus. J. Bacteriol. 175:7404-7412[Abstract/Free Full Text].
21. Eraso, J. M., and S. Kaplan. 1994. prrA, a putative response regulator involved in oxygen regulation of photosynthesis gene expression in Rhodobacter sphaeroides. J. Bacteriol. 176:32-43[Abstract/Free Full Text].
22. Eraso, J. M., and S. Kaplan. 1995. Oxygen-insensitive synthesis of the photosynthetic membranes of Rhodobacter sphaeroides: a mutant histidine kinase. J. Bacteriol. 177:2695-2706[Abstract/Free Full Text].
23. Fisher, H. M. 1994. Genetic regulation of nitrogen fixation in rhizobia. Microbiol. Rev. 58:352-386[Abstract/Free Full Text].
24. Fostner-Hartnett, D., P. J. Cullen, E. M. Monika, and R. G. Kranz. 1994. A new type of NtrC transcriptional activator. J. Bacteriol. 176:6175-6187[Abstract/Free Full Text].
25. Fostner-Hartnett, D., and R. G. Kranz. 1992. Analysis of the promoters and upstream sequences of nifA1 and nifA2 in Rhodobacter capsulatus: activation requires ntrC but not rpoN. Mol. Microbiol. 6:1049-1060[CrossRef][Medline].
26. Gest, H. 1972. Energy conversion and generation of reducing power in bacterial photosynthesis. Adv. Microb. Physiol. 7:243-282.
27. Gest, H. 1999. Bioenergetic and metabolic process patterns in anoxyphototrophs, p. 11-19. In G. A. Pescheck, W. Löffelhardt, and G. Schmetterer (ed.), The phototrophic prokaryotes. Kluwer Academic/Plenum Publishers, New York, N.Y.
28. Gutiérrez, D., Y. Hernando, J. M. Palacios, J. Imperial, and T. Ruiz- Argüeso. 1997. FnrN controls symbiotic nitrogen fixation and hydrogenase activities in Rhizobium leguminosarum biovar viciae UPM791. J. Bacteriol. 179:5264-5270[Abstract/Free Full Text].
29. Hübner, P., J. C. Willison, P. M. Vignais, and T. A. Bickle. 1991. Expression of regulatory nif genes in Rhodobacter capsulatus. J. Bacteriol. 173:2993-2999[Abstract/Free Full Text].
30. Imhoff, J. F., and H. G. Truper. 1992. The genus Rhodospirillum and related genera, p. 2141-2155. In A. Balows, H. G. Trüper, M. Dworkin, W. Harder, and K.-H. Schleifer (ed.), The prokaryotes: a handbook on the biology of bacteria, 2nd edition, vol. 3. Springer-Verlag, New York, N.Y.
31. Inoue, K., J. L. K. Kouadio, C. S. Mosley, and C. E. Bauer. 1995. Isolation and in vitro phosphorylation of sensory transduction components controlling anaerobic induction of light harvesting and reaction center gene expression in Rhodobacter capsulatus. Biochemistry 34:391-396[CrossRef][Medline].
32. Joshi, H. M., and F. R. Tabita. 1996. A global two-component signal transduction system that integrates the control of photosynthesis, carbon dioxide assimilation, and nitrogen fixation. Proc. Natl. Acad. Sci. USA 93:14515-14520[Abstract/Free Full Text].
33. Lynch, A. S., and E. C. C. Linn. 1996. Responses to molecular oxygen, p. 1526-1538. In F. C. Neidhardt, et al. (ed.), (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed. ASM Press, Washington, D.C.
34. Madigan, M. T., and H. Gest. 1979. Growth of the photosynthetic bacterium Rhodopseudomonas capsulata chemoautotrophically in darkness with H2 as energy source. J. Bacteriol. 137:524-530[Abstract/Free Full Text].
35. Masepohl, B., and W. Klipp. 1996. Organization and regulation of genes encoding the molybdenum nitrogenase and the alternative nitrogenase in Rhodobacter capsulatus. Arch. Microbiol. 165:80-90[CrossRef].
36. Masepohl, B., W. Klipp, and A. Pühler. 1988. Genetic characterization and sequence analysis of the duplicated nifA/nifB gene region of Rhodobacter capsulatus. Mol. Gen. Genet. 212:27-37[CrossRef][Medline].
37. Masuda, S., Y. Matsumoto, K. V. P. Nagashima, K. Shimada, K. Inoue, C. E. Bauer, and K. Matsuura. 1999. Structural and functional analyses of photosynthetic regulatory genes regA and regB from Rhodovulum sulfidophilum, Roseobacter denitrificans, and Rhodobacter capsulatus. J. Bacteriol. 181:4205-4215[Abstract/Free Full Text].
38. Maxam, A. M., and W. Gilbert. 1980. Sequencing end-labeled DNA with base-specific chemical cleavages. Methods Enzymol. 65:499-560[Medline].
39. Meyer, J., B. C. Kelley, and P. M. Vignais. 1978. Effect of light on nitrogenase function and synthesis in Rhodopseudomonas capsulata. J. Bacteriol. 136:201-208[Abstract/Free Full Text].
40. Mosley, C. S., J. Y. Suzuki, and C. E. Bauer. 1994. Identification and molecular genetic characterization of a sensor kinase responsible for coordinately regulating light harvesting and reaction center gene expression in response to anaerobiosis. J. Bacteriol. 176:7566-7573[Abstract/Free Full Text].
41. O'Gara, J. P., J. M. Eraso, and S. Kaplan. 1998. A redox-responsive pathway for aerobic regulation of photosynthesis gene expression in Rhodobacter sphaeroides 2.4.1. J. Bacteriol. 180:4044-4050[Abstract/Free Full Text].
42. Oh, J. I., and S. Kaplan. 1999. The cbb3 terminal oxidase of Rhodobacter sphaeroides 2.4.1: structural and functional implications for the regulation of spectral complex formation. Biochemistry 38:2688-2696[CrossRef][Medline].
43. Pollock, D., C. E. Bauer, and P. A. Scolnik. 1988. Transcription of the Rhodobacter capsulatus nifHDK operon is modulated by the nitrogen source. Construction of plasmid expression vectors based on the nifHDK promoter. Gene 65:269-275[CrossRef][Medline].
44. Ponnampalam, S. N., J. J. Buggy, and C. E. Bauer. 1995. Characterization of an aerobic repressor that coordinately regulates bacteriochlorophyll, carotenoid, and light-harvesting II expression in Rhodobacter capsulatus. J. Bacteriol. 177:2990-2997[Abstract/Free Full Text].
45. Qian, Y., and F. R. Tabita. 1996. A global signal transduction system regulates aerobic and anaerobic CO2 fixation in Rhodobacter sphaeroides. J. Bacteriol. 178:12-18[Abstract/Free Full Text].
46. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
47. Sganga, M. W., and C. E. Bauer. 1992. Regulatory factors controlling photosynthetic reaction center and light-harvesting gene expression in Rhodobacter capsulatus. Cell 68:945-954[CrossRef][Medline].
48. Taylor, D. P., S. N. Cohen, W. G. Clark, and B. L. Marrs. 1983. Alignment of genetic and restriction maps of the photosynthesis region of the Rhodopseudomonas capsulata chromosome by a conjugation-mediated marker rescue technique. J. Bacteriol. 154:580-590[Abstract/Free Full Text].
49. Tiwari, R. P., W. G. Reeve, M. J. Dilworth, and A. R. Glenn. 1996. Acid tolerance in Rhizobium meliloti strain WSM419 involves a two-component sensor-regulator system. Microbiology 142:1693-1704[Abstract/Free Full Text].
50. Toussaint, B., I. Delic-Attree, R. de Sury d'Aspremont, L. David, M. Vincon, and P. M. Vignais. 1993. Purification of the integration host factor homolog of Rhodobacter capsulatus: cloning and sequencing of the hipA gene, which encodes the beta -subunit. J. Bacteriol. 175:6499-6504[Abstract/Free Full Text].
51. Toussaint, B., R. de Sury d'Aspremont, I. Delic-Attree, V. Berchet, S. Elsen, A. Colbeau, W. Dischert, Y. Lazzaroni, and P. M. Vignais. 1997. The Rhodobacter capsulatus hupSLC promoter: identification of cis-acting regulatory elements and of trans-activating factors involved in H2 activation of hupSLC transcription. Mol. Microbiol. 26:927-937[CrossRef][Medline].
52. Vignais, P. M., B. Dimon, N. A. Zorin, A. Colbeau, and S. Elsen. 1997. HupUV proteins of Rhodobacter capsulatus can bind H2: evidence from the H-D exchange reaction. J. Bacteriol. 179:290-292[Abstract/Free Full Text].
53. Vignais, P. M., B. Toussaint, and A. Colbeau. 1995. Regulation of hydrogenase gene expression, p. 1175-1190. In R. E. Blankenship, M. T. Madigan, and C. E. Bauer (ed.), Anoxygenic photosynthetic bacteria. Kluwer Academic Publishers, Dordrecht, The Netherlands.
54. Weaver, P. F., J. D. Wall, and H. Gest. 1975. Characterization of Rhodopseudomonas capsulata. Arch. Microbiol. 105:207-216[CrossRef][Medline].
55. Yen, H. C., and B. L. Marrs. 1976. Map of genes for carotenoid and bacteriochlorophyll biosynthesis in Rhodopseudomonas capsulata. J. Bacteriol. 126:619-629[Abstract/Free Full Text].
56. Young, D. A., C. E. Bauer, J. C. Williams, and B. L. Marrs. 1989. Genetic evidence for superoperonal organization of genes for photosynthetic pigments and pigment-binding proteins in Rhodobacter capsulatus. Mol. Gen. Genet. 218:1-12[CrossRef][Medline].


Journal of Bacteriology, May 2000, p. 2831-2837, Vol. 182, No. 10
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Eraso, J. M., Roh, J. H., Zeng, X., Callister, S. J., Lipton, M. S., Kaplan, S. (2008). Role of the Global Transcriptional Regulator PrrA in Rhodobacter sphaeroides 2.4.1: Combined Transcriptome and Proteome Analysis. J. Bacteriol. 190: 4831-4848 [Abstract] [Full Text]  
  • Rey, F. E., Oda, Y., Harwood, C. S. (2006). Regulation of Uptake Hydrogenase and Effects of Hydrogen Utilization on Gene Expression in Rhodopseudomonas palustris.. J. Bacteriol. 188: 6143-6152 [Abstract] [Full Text]  
  • Swem, L. R., Gong, X., Yu, C.-A., Bauer, C. E. (2006). Identification of a Ubiquinone-binding Site That Affects Autophosphorylation of the Sensor Kinase RegB. J. Biol. Chem. 281: 6768-6775 [Abstract] [Full Text]  
  • Elsen, S., Swem, L. R., Swem, D. L., Bauer, C. E. (2004). RegB/RegA, a Highly Conserved Redox-Responding Global Two-Component Regulatory System. Microbiol. Mol. Biol. Rev. 68: 263-279 [Abstract] [Full Text]  
  • Laguri, C., Phillips-Jones, M. K., Williamson, M. P. (2003). Solution structure and DNA binding of the effector domain from the global regulator PrrA (RegA) from Rhodobacter sphaeroides: insights into DNA binding specificity. Nucleic Acids Res 31: 6778-6787 [Abstract] [Full Text]  
  • Dubbs, J. M., Tabita, F. R. (2003). Interactions of the cbbII Promoter-Operator Region with CbbR and RegA (PrrA) Regulators Indicate Distinct Mechanisms to Control Expression of the Two cbb Operons of Rhodobacter sphaeroides. J. Biol. Chem. 278: 16443-16450 [Abstract] [Full Text]  
  • Oh, J.-I., Ko, I.-J., Kaplan, S. (2003). Digging deeper: uncovering genetic loci which modulate photosynthesis gene expression in Rhodobacter sphaeroides 2.4.1. Microbiology 149: 949-960 [Abstract] [Full Text]  
  • Gibson, J. L., Dubbs, J. M., Tabita, F. R. (2002). Differential Expression of the CO2 Fixation Operons of Rhodobacter sphaeroides by the Prr/Reg Two-Component System during Chemoautotrophic Growth. J. Bacteriol. 184: 6654-6664 [Abstract] [Full Text]  
  • Laratta, W. P., Choi, P. S., Tosques, I. E., Shapleigh, J. P. (2002). Involvement of the PrrB/PrrA Two-Component System in Nitrite Respiration in Rhodobacter sphaeroides 2.4.3: Evidence for Transcriptional Regulation. J. Bacteriol. 184: 3521-3529 [Abstract] [Full Text]  
  • Dong, C., Elsen, S., Swem, L. R., Bauer, C. E. (2002). AerR, a Second Aerobic Repressor of Photosynthesis Gene Expression in Rhodobacter capsulatus. J. Bacteriol. 184: 2805-2814 [Abstract] [Full Text]  
  • Swem, D. L., Bauer, C. E. (2002). Coordination of Ubiquinol Oxidase and Cytochrome cbb3 Oxidase Expression by Multiple Regulators in Rhodobacter capsulatus. J. Bacteriol. 184: 2815-2820 [Abstract] [Full Text]  
  • Tichi, M. A., Tabita, F. R. (2002). Metabolic Signals That Lead to Control of CBB Gene Expression in Rhodobacter capsulatus. J. Bacteriol. 184: 1905-1915 [Abstract] [Full Text]  
  • Kappler, U., Huston, W. M., McEwan, A. G. (2002). Control of dimethylsulfoxide reductase expression in Rhodobacter capsulatus: the role of carbon metabolites and the response regulators DorR and RegA. Microbiology 148: 605-614 [Abstract] [Full Text]  
  • Comolli, J. C., Carl, A. J., Hall, C., Donohue, T. (2002). Transcriptional Activation of the Rhodobacter sphaeroides Cytochrome c2 Gene P2 Promoter by the Response Regulator PrrA. J. Bacteriol. 184: 390-399 [Abstract] [Full Text]  
  • Tichi, M. A., Meijer, W. G., Tabita, F. R. (2001). Complex I and Its Involvement in Redox Homeostasis and Carbon and Nitrogen Metabolism in Rhodobacter capsulatus. J. Bacteriol. 183: 7285-7294 [Abstract] [Full Text]  
  • Oh, J.-I., Ko, I.-J., Kaplan, S. (2001). The Default State of the Membrane-Localized Histidine Kinase PrrB of Rhodobacter sphaeroides 2.4.1 Is in the Kinase-Positive Mode. J. Bacteriol. 183: 6807-6814 [Abstract] [Full Text]  
  • Tichi, M. A., Tabita, F. R. (2001). Interactive Control of Rhodobacter capsulatus Redox-Balancing Systems during Phototrophic Metabolism. J. Bacteriol. 183: 6344-6354 [Abstract] [Full Text]  
  • Vignais, P. M., Dimon, B., Zorin, N. A., Tomiyama, M., Colbeau, A. (2000). Characterization of the Hydrogen-Deuterium Exchange Activities of the Energy-Transducing HupSL Hydrogenase and H2-Signaling HupUV Hydrogenase in Rhodobacter capsulatus. J. Bacteriol. 182: 5997-6004 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Elsen, S.
Right arrow Articles by Bauer, C. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Elsen, S.
Right arrow Articles by Bauer, C. E.