Purple photosynthetic bacteria are capable of generating cellular
energy from several sources, including photosynthesis, respiration, and
H2 oxidation. Under nutrient-limiting conditions, cellular energy can be used to assimilate carbon and nitrogen. This study provides the first evidence of a molecular link for the coregulation of
nitrogenase and hydrogenase biosynthesis in an anoxygenic
photosynthetic bacterium. We demonstrated that molybdenum nitrogenase
biosynthesis is under the control of the RegB-RegA two-component
regulatory system in Rhodobacter capsulatus. Footprint
analyses and in vivo transcription studies showed that RegA indirectly
activates nitrogenase synthesis by binding to and activating the
expression of nifA2, which encodes one of the two
functional copies of the nif-specific transcriptional
activator, NifA. Expression of nifA2 but not
nifA1 is reduced in the reg mutants up to
eightfold under derepressing conditions and is also reduced under
repressing conditions. Thus, although NtrC is absolutely required for
nifA2 expression, RegA acts as a coactivator of
nifA2. We also demonstrated that in reg mutants, [NiFe]hydrogenase synthesis and activity are increased up to
sixfold. RegA binds to the promoter of the hydrogenase gene operon and
therefore directly represses its expression. Thus, the RegB-RegA system
controls such diverse processes as energy-generating photosynthesis and
H2 oxidation, as well as the energy-demanding processes of
N2 fixation and CO2 assimilation.
 |
INTRODUCTION |
The purple nonsulfur photosynthetic
bacterium Rhodobacter capsulatus exhibits remarkable
metabolic diversity (30). This bacterium is capable of
generating energy from light via photosynthesis as well as from dark
aerobic and anaerobic respiration. Another feature is the capacity to
grow heterotrophically as well as autotrophically. When growing
autotrophically, the cells are also capable of generating cellular
energy and reducing power by the oxidation of H2, which occurs at a membrane-bound [NiFe]hydrogenase complex. Several decades
ago, Gest and colleagues described the presence of redox-related interrelationships among carbon assimilation, N2 fixation,
and photophosphorylation (26; reviewed in reference
27). However, the nature and even the existence of
specific molecular mechanisms for balancing the use of reducing
equivalents have remained unclear.
Recent studies have suggested that balancing different metabolic
processes could result, at least partially, from the activity of a
global two-component regulatory system that regulates the synthesis of
the enzymes involved in different energetic processes. Indeed, the
three fundamental biological processes catalyzed by photosynthetic
bacteria, i.e., photosynthesis, CO2 fixation, and N2 assimilation, are affected by the RegB-RegA global
two-component transduction signal system in Rhodobacter
sphaeroides (32). In R. capsulatus, the
RegB-RegA system functions as a classic two-component system, with RegB
being a membrane-spanning histidine kinase capable of
autophosphorylating in the presence of ATP (3, 40, 47). The
phosphate group is then transferred to its cognate partner, the
cytosolic response regulator RegA (3, 31, 47). Phosphorylation of RegA increases its DNA-binding to the puf
and puc photosynthesis promoters where it functions as an
activator of transcription (3, 15). Homologous systems have
been found in many species of the
proteobacteria, including such
photosynthetic species as R. sphaeroides, Rhodovulum
sulfidophilum, and Roseobacter denitrificans (21,
22, 37), as well as in nonphotosynthetic species such as
Bradyrhizobium japonicum and Rhizobium meliloti (2, 49). RegA and its homologs exhibit an unprecedented 79% degree of conservation, especially in the C-terminal DNA-binding helix-turn-helix structure, which is 100% conserved (37).
This suggests that the RegB-RegA system plays a fundamental role in this group of bacteria.
Originally the RegB-RegA system was discovered for its role in
anaerobic activation of the puf, puc, and
puh photosynthetic gene operons from R. capsulatus (40, 47). In addition to its involvement in
photosynthesis, a related RegB-RegA system from R. sphaeroides (PrrB-PrrA) has been implicated in the positive regulation of the cbbI and cbbII operons that
encode enzymes of the Calvin cycle CO2 fixation pathway
(45; J. M. Dubbs, T. H. Bird, C. E. Bauer, and F. R. Tabita, submitted for publication). The R. sphaeroides system was also shown to be involved in the nitrogen
fixation process, since the derepression of nitrogenase synthesis that
occurs in the absence of the CO2 fixation pathway requires
a functional regB gene (32). It has also been
shown that inactivation of a RegA homolog in the nonphotosynthetic
bacterium B. japonicum (RegR) reduces nitrogen fixation to a
level where nodules are ineffective in fixing nitrogen. This effect on
nitrogen fixation is caused by a dependence of RegR for optimal
expression of NifA, which is a nif-specific transcriptional
activator of nitrogenase structural genes (2). However, to
date, direct binding of RegR to the nifA promoter has not
been established.
In this study, we have demonstrated that the RegB-RegA system from
R. capsulatus indirectly activates the synthesis of
nitrogenase. Indeed, our in vivo and in vitro studies demonstrate that
RegA binds to and activates expression of the nifA2 gene,
which encodes one of the two functional copies of the NifA
transcriptional activator of the nitrogenase structural genes. We also
demonstrate that RegA directly represses [NiFe]hydrogenase structural
gene expression by binding to the hupSLC promoter.
 |
MATERIALS AND METHODS |
Bacterial strains, media, and culture conditions.
The
R. capsulatus strains used in the study are wild-type strain
SB1003 (55), the regA-disrupted strain MS01
(47), and the regB-disrupted strain SD01
(15). R. capsulatus strains were grown at 34°C
in minimal salts medium (RCV) (54) supplemented with 30 mM
DL-malate as a carbon source and either 7 mM
L-glutamate (MG medium) or 7 mM ammonium sulfate (MN
medium) as a nitrogen source. RCV malate without a nitrogen source was
used as a nitrogen-free (NF) medium. For hydrogenase studies, strains
were grown either under aerobic dark conditions or under anaerobic
photosynthetic conditions in the light (about 2,500 lx) as previously
described by Colbeau et al. (10). For the nitrogenase
studies, cells were grown anaerobically overnight in MN medium, washed
in NF medium, and induced in MG or MN medium aerobically or
anaerobically for 12 to 14 h as described previously by
Fostner-Hartnett and Kranz (25). Escherichia coli
strains were grown aerobically in Luria-Bertani medium at 37°C
(46). Antibiotics were added at the following concentrations
(milligrams per liter) : 100 (ampicillin), 100 (spectinomycin), 50 (trimethoprim), and 10 (tetracycline) for E. coli, and 10 (kanamycin), 10 (spectinomycin), and 1 (tetracycline) for R. capsulatus.
Plasmids and plasmid mobilization.
Mobilization of plasmids
pNF:Q-Z
(nifH::lacZ) (43)
from E. coli to R. capsulatus was accomplished
with mobilizing strain Tec5 (48) as described by Young et
al. (56). Plasmids pDFH100Bcl (nifA1::lacZ) (25),
pDFH200T (nifA2::lacZ)
(25), and pAC142 (hupS::lacZ) (12) were mated
into R. capsulatus recipient strains using the triparental
mating system of Ditta et al. (14) using conditions
described by Colbeau et al. (9).
Enzyme assays.
Hydrogenase activity was assayed in whole
cells as previously described with 0.15 mM methylene blue as the
electron acceptor (11). Nitrogenase assays were performed as
reported by Meyer et al. (39).
-Galactosidase activity
was assayed as described by Elsen et al. (20).
DNase I footprint analysis.
RegA* was overexpressed and
purified as previously described by Du et al. (15). Probes
were prepared by PCR amplification as follows. Amplification of the
hupSLC promoter utilized primers HOse31
(5'-CGACAATTGTCCCTCCCTTGC) and HOse38
(5'-GCGGCGGCAAAATTGGAAAGC), and plasmid pAC142
(12) previously digested with BamHI was used as a
template. Primers FOse36 (5'-GGAAGCGCCATTTTTTTCGGC) and
FOse37 (5'CATGTCGAGACTTGGTCAAGC) were used for amplification
of the nifA2 promoter, with genomic DNA as the template. For
selective labeling of DNA strands, one of the primers of the PCR
amplification was 5'-end labeled with 32P prior to
amplification and the amplified DNA fragments were purified as
described previously (19). A 10-µl binding reaction mixture was first prepared, containing 1 µl of DNA (50 fmol), 7 µl
of H2O, and 2 µl of 5× footprint binding buffer composed of 125 mM HEPES (pH 8.0), 300 mM potassium acetate, 25 mM magnesium actetate, 10 mM calcium chloride, 5 mM dithiothreitol, and 125 µg of
bovine serum albumin per ml. The reaction mixture was then added to a
10-µl solution composed of 2 volumes of 1× footprint binding buffer
and 1 volume of protein dialysis buffer (15) containing
various amounts of RegA*. Digestion with DNase I and subsequent
termination of the assays were carried out as previously described by
Bird et al. (4). A modified Maxam and Gilbert G+A chemical
sequencing reaction was used to determine the location of DNase I
protection (38).
 |
RESULTS |
The RegB-RegA two-component regulatory system is involved in
nitrogenase gene regulation.
We assessed whether biosynthesis of
the R. capsulatus molybdenum nitrogenase was affected by the
RegB-RegA signal transduction cascade by assaying nitrogenase enzyme
activity in the wild-type parent strain SB1003, the
regA-disrupted mutant strain MS01, and the
regB-disrupted mutant strain SD01. As shown in Table
1, nitrogenase activity was high in
SB1003 cells that were grown in MG medium. There was no significant
nitrogenase activity when these cells were grown in MN medium (Table 1)
or when oxygen was present (data not shown). This pattern is similar to
that reported by Pollock et al. (43), which reflects the
regulation of nitrogenase synthesis in response to fixed nitrogen
availability by the ntr system and to the oxygen sensitivity
of the NifA proteins which function as transcriptional activators of
the nifHDK operon (reviewed in reference
35). The data in Table 1 also demonstrate that nitrogenase activity was significantly affected by regA and
regB disruptions, as evidenced by five- and fourfold
reductions observed in MS01 and SD01 cells, respectively, under
derepressing conditions.
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Nitrogenase and -galactosidase activities of the
wild-type (SB1003), regA-disrupted (MS01), and
regB-disrupted (SD01) strains harboring plasmid
pNF:Q-Z (nifH::lacZ)
|
|
We also assayed
-galactosidase activities in strains SB1003, MS01,
and SD01 that contained a nifH::lacZ
fusion (pNF:Q-Z
) to determine if the observed reduction in
nitrogenase activity reflected reduced transcription rates. The
-galactosidase activities shown in Table 1 demonstrate that the
nitrogenase activities observed for various strains and growth
conditions are also reflected by a similar pattern of
nifH::lacZ expression. Thus, the
R. capsulatus RegB-RegA two-component system appears to be
affecting nitrogenase biosynthesis.
RegA indirectly activates nitrogenase gene expression.
We next
addressed whether RegA directly controls nitrogenase expression by
binding to the nifHDK promoter region, by performing DNase I
protection assays on both DNA strands of a 321-bp fragment that
contains the nifHDK promoter region (from bp
264 to +57). Using the RegA* protein, which exhibits constitutive activity in vivo
(15) and high DNA-binding affinity in vitro (3), we observed no RegA*-mediated protection of either strand of the nifHDK promoter region (data not shown). This suggests that
RegA may indirectly regulate nitrogenase gene expression.
In species where it has been tested, the direct activator of
nifHDK expression under conditions of fixed nitrogen and
oxygen limitation is the NifA protein (reviewed in references
23 and 35). Two identical copies
of nifA, termed nifA1 and nifA2, are present in R. capsulatus, and the product of either gene is
sufficient for diazotrophic growth (36). To determine
whether RegB-RegA indirectly controls nifHDK expression by
affecting the transcription of nifA1 and/or
nifA2, we introduced
nifA1::lacZ (pDFH100Bcl) and
nifA2::lacZ (pDFH200T) fusion plasmids
into SB1003, MS01, and SD01 cells and subsequently measured
-galactosidase activities under different growth conditions. As
shown in Table 2, nifA1 and
nifA2 expression in the wild-type strain SB1003 had a
similar pattern of high expression in MG medium and an approximate
10-fold reduction in activity when the cells were grown in presence of ammonium (MN medium). The reduction of activity observed in MN medium-grown cells is in agreement with a role of the transcriptional activator NtrC, which activates nifA expression only in
ammonium-free medium (25, 29).
View this table:
[in this window]
[in a new window]
|
TABLE 2.
-Galactosidase activity measurements of
nifA1::lacZ and
nifA2::lacZ reporter gene fusions
in wild-type strain SB1003, regA-disrupted strain MS01,
and regB-disrupted strain SD01
|
|
When nifA1::lacZ expression was
measured in the regA- and regB-disrupted strains
MS01 and SD01, respectively, no effect on
-galactosidase activities
in cells grown in all of the tested media was observed (Table 2). There
was also no evidence of RegA* binding to the nifA1 promoter
region as measured by DNase I protection assays (data not shown). On
the other hand, expression of nifA2 is significantly reduced
in both MS01 and SD01 cells relative to the level observed in wild-type
cells under all of the tested growth conditions (Table 2).
Specifically, nifA2 expression in MS01 was reduced 8.3-fold
in MG medium and 17-fold in MN medium under anaerobiosis. Similarly,
strain SD01 exhibited a 7.5-fold reduction in MG medium and a 10.6-fold
reduction in MN medium. The RegB-RegA system also appears to control
nifA2 expression in the presence of oxygen, as illustrated
by a 5.5- and 7-fold reduction of expression in MG and MN media,
respectively, in the regA-disrupted strain under aerobic
growth conditions (Table 2). Furthermore, expression of
nifA2 is still under the control of nitrogen availability,
as evidenced by higher
-galactosidase activities in MG than MN
medium. The strong effect of regB and regA
inactivation on nifA2 expression could explain the reduction in nifHDK gene expression in the mutants described above.
nifA2 expression is directly controlled by RegA.
DNase I protection analyses of RegA* binding to the nifA2
promoter were undertaken to determine if RegA directly regulates nifA2 expression. As illustrated by a protected region from
bp
43 to
61 on the top strand (Fig.
1A) and from bp
43 to
72 on the
bottom strand (Fig. 1B), RegA does indeed bind to the nifA2 promoter. A hypersensitive site was also observed on each strand, which
corresponds to position
61. As shown in Fig.
2A, RegA binds to the nifA2
promoter between the transcription start sites and the previously
mapped NtrC DNA-binding sites (24, 25). These results
indicate that RegA indirectly activates nifHDK gene
expression by participating in the activation of nifA2 gene
expression.

View larger version (98K):
[in this window]
[in a new window]
|
FIG. 1.
DNase I footprint analysis of RegA* binding to the
nifA2 and hupSLC promoters. RegA*-mediated DNase
I protection patterns to the top (A) and bottom (B) strands of the
nifA2 promoter and to the top (C) and bottom (D) strands of
the hupSLC promoter are presented. G+A indicates a
Maxam-Gilbert sequencing ladder. Each of the subsequent lanes are
protection patterns generated in the presence of increasing micromolar
concentrations of purified RegA*. The thick and thin vertical bars
represent the major and minor RegA* DNA-binding sites, respectively.
The arrows show the start and direction of transcription of the genes.
DNase I-hypersensitive sites are indicated by asterisks.
|
|

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 2.
Features of the nifA2 (A) and
hupSLC (B) promoters. Horizontal arrows in nifA2
(25) and hupSLC (51) indicate
previously published transcription start sites. Putative 35 and 10
promoter sequences are underlined. Black boxes indicate regions of top-
and bottom-strand protection from DNase I digestion by RegA*, and
asterisks correspond to DNase I-hypersensitive sites. Also indicated
are the DNA-binding sites of NtrC (gray boxes) (24), HupR
(white box) (13), and IHF (bracket) (50).
|
|
RegB-RegA controls hydrogenase biosynthesis.
Nitrogenase is
capable of generating hydrogen as a by-product of N2
fixation. Thus, there appears to be a metabolic link between nitrogenase and hydrogenase synthesis, since the presence of hydrogen stimulates synthesis of the H2 uptake hydrogenase (reviewed
in reference 53). Consequently, we also addressed
whether disruption of regB or regA could directly
or indirectly affect the expression of the uptake hydrogenase. For this
analysis, we assayed hydrogenase activity and hup expression
patterns in wild-type and regB- and regA-disrupted strains that contained the
hupS::lacZ reporter plasmid, pAC142
(12). The data in Table 3 show
that hydrogenase activity values and
-galactosidase measurements of
hupS::lacZ expression varied in
parallel for each of the various strains and growth conditions tested.
In the wild-type strain, SB1003, activity was high when H2
was evolved from nitrogenase, which occurs under anaerobic growth
conditions in MG medium. In contrast, activity was low when the
hydrogen concentration was low or absent, which occurs when cells are
grown in MN medium under aerobic or anaerobic conditions, when
nitrogenase does not evolve hydrogen. However, activity was restored to
high levels when 10% hydrogen was exogenously added to MN medium. This
demonstrates that there is a dependence of hup expression on
hydrogen, and not simply on synthesis of nitrogenase. The pattern of
H2 dependence of hup expression in SB1003 is
very similar to that previously reported by Colbeau and Vignais
(12) with wild-type strain B10 of R. capsulatus.
An involvement of RegA and RegB in the control of hydrogenase synthesis
is evidenced by a strong increase in
-galactosidase and hydrogenase
activities in the reg mutants under all growth conditions
tested (Table 3). Indeed, disruption of regA or
regB both led to the same three- to sixfold increase in
hupS::lacZ expression and hydrogenase
enzyme activity under the various tested growth conditions.
Interestingly, hydrogenase synthesis is still regulated by
H2 in the regA- and regB-disrupted
strains, as evidenced by the stimulation of hup expression
in the presence of endogenously produced (MG medium) or exogenously
added H2 in strains MS01 and SD01 (Table 3). Thus, the
RegB-RegA signal transduction system represses hydrogenase synthesis by
a mechanism that is independent of the HupT-HupR system, which
activates hupSLC synthesis in response to the presence of
H2 (13, 51). Interestingly, the RegB-RegA system
appears to be modulating hup expression under both aerobic and anaerobic growth conditions even though RegB kinase activity is
thought to be affected by the oxygen status of the cell.
View this table:
[in this window]
[in a new window]
|
TABLE 3.
Hydrogenase and -galactosidase activities of the
wild-type (SB1003), regA-disrupted (MS01), and
regB-disrupted (SD01) strains harboring plasmid
pAC142 (hupS::lacZ)
|
|
RegA directly represses hydrogenase gene expression.
We also
tested whether RegA affects hup expression by direct binding
to the hupSLC promoter region, by performing a DNase I
protection analysis with RegA*. A RegA* DNA-binding site, which extends
from bp
37 to
58 on the top strand (Fig. 1C) and from bp
44 to
61 on the bottom strand (Fig. 1D), was observed with as little as 5 µM RegA*. As also indicated in Fig. 1, when the RegA* concentration
was increased from 10 to 30 µM, a second protected region was
detected from bp
79 to
98 on the top strand and from bp
78 to
103 on the bottom strand. This second RegA*-protected region overlaps
with a previously described integration host factor (IHF) DNA-binding
site (50) that is located from bp
93 to
81 (Fig. 2B).
Expression of hupSLC is known to be strongly activated in
the presence of IHF (50), indicating that RegA may function as a repressor of hydrogenase gene expression in R. capsulatus by competing with IHF for binding to this region.
Hydrogenase expression is also highly dependent on the presence of
H2, which is mediated by the two-component transcriptional
regulator HupR, which binds upstream from the IHF-binding site, as
indicated in Fig. 2B (13, 51).
 |
DISCUSSION |
Hydrogenase and nitrogenase syntheses are coregulated by the
RegB-RegA system.
In the present study, we have identified two
important new elements of the reg regulon controlled by the
RegB-RegA two-component regulatory system in R. capsulatus
(Fig. 3). Using in vitro footprint analysis and in vivo lacZ fusion studies, we have
demonstrated that the response regulator RegA indirectly activates the
nifHDK nitrogenase genes and directly represses the
hupSLC hydrogenase structural genes. Uptake hydrogenase and
nitrogenase synthesis are coregulated in Rhizobium
leguminosarum bv. viciae by the nitrogen fixation regulator NifA
(7) and two FnrN proteins (28). However, no
genetic relationship had yet been established between nitrogenase and
hydrogenase in R. capsulatus. This study is the first
demonstration of coregulation between hydrogenase and nitrogenase
synthesis in R. capsulatus which occurs by the RegB-RegA
two-component regulatory system.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 3.
The reg regulon of R. capsulatus.
The RegB-RegA signal transduction system activates photosynthesis
(puf, puh, and puc), nitrogen fixation
(nifA2), and carbon assimilation (cbb) genes and
represses hydrogenase structural genes (hupSLC) and its own
expression. References are given in the text.
|
|
The nif genes required for biosynthesis and assembly of the
molybdenum nitrogenase are activated under conditions of both fixed
nitrogen and oxygen limitation (reviewed in reference
35). Under nitrogen limitation, the ntr
system activates the expression of the two functional copies of
nifA in R. capsulatus. It has been demonstrated
that NtrC binds to two tandem sites centered more than 100 bp upstream
of the nifA1 and nifA2 transcriptional start
sites and that NtrC~P activates the
70-containing RNA
polymerase holoenzyme (6, 24). The two NifA proteins then
activate the expression of all the other nif genes in the
absence of oxygen (35). Our results indicate that RegA enhances nifA2 expression under all growth conditions
tested. Since it has previously been shown that NtrC is absolutely
required for nifA2 expression (25), RegA appears
to function as a coactivator with NtrC to ensure optimal
nifA2 expression.
The membrane-bound [NiFe]hydrogenase, encoded by the
hupSLC operon, catalyzes hydrogen oxidation in R. capsulatus. This enzyme allows cells to grow autotrophically, with
hydrogen as an electron source. Under photoheterotrophic growth
conditions, hupSLC expression is activated by hydrogen gas
evolved by nitrogenase as a by-product of nitrogen assimilation
(reviewed in reference 53). Hydrogenase synthesis is
known to be activated in the presence of hydrogen by the two-component
system HupT-HupR. The HupU and HupV proteins have been proposed to
sense the hydrogen stimulus and to transfer information to the
histidine protein kinase HupT (17, 18, 52). HupT is then
thought to control the phosphorylated state of the response regulator
HupR, which activates hupSLC transcription by directly
binding to the promoter (13, 51). Another regulatory factor
required for hupSLC expression is the histone-like IHF protein that binds to a region between RNA polymerase and HupR DNA-binding sites (13, 50). Our results indicate that the RegB-RegA two-component regulatory system is involved in repression of
hydrogenase gene expression under heterotrophic growth conditions. We
have also observed that RegA* binds to a region that overlaps the IHF
DNA-binding site. Presumably, competition between IHF and RegA for
binding to this region is the reason for the repressing effect of RegA.
In earlier studies, RegB and RegA were demonstrated to be required for
direct activation of transcription of the photosynthesis genes
(reviewed in reference 1). It has also recently been demonstrated that RegA directly activates the cbb operons
that code for enzymes of the Calvin CO2 fixation cycle in
R. capsulatus (P. Vichivanives, C. E. Bauer, and R. Tabita, submitted). Furthermore a functional regB gene is
required for the derepression of nitrogenase synthesis that occurs in
R. sphaeroides when the Calvin cycle is mutationally
disrupted, even in the presence of ammonium (32). Recent
studies have shown that the system also regulates aerobic respiration,
by controlling the biosynthesis of the two identified terminal oxidases
in R. capsulatus, as well as the electron transfer system
shared by respiration and photosynthesis processes (L. Swem, S. Elsen,
T. H. Bird, H. Myllykallio, F. Daldal, and C. E. Bauer,
unpublished data). Therefore, the RegB-RegA system appears to control
energy-generating and energy-consuming metabolisms involved in the
consumption and production of reduced equivalents. Specifically, this
two-component system represses hydrogenase synthesis that catalyzes
H2 oxidation, which is a net generator of reducing
equivalents, and activates CO2 assimilation and
N2 fixation, which are processes that utilize reducing
equivalents. RegB-RegA appears to function in a manner that would lower
the reducing-equivalent level in the cell. The system appears to be a
master cellular redox regulator that ensures that cells do not become overreduced.
The RegB-RegA system functions as a global regulator.
A common
occurrence among many RegB-RegA-controlled genes is the presence of
additional activators and/or repressors that regulate their expression.
Indeed, RegA activity appears to involve competition or synergy at its
target promoters, with a broad range of transcription factors such as
histone-like proteins (IHF), LysR family proteins (CbbR), and response
regulators (HupR, NtrC). For example, expression of the
light-harvesting photosystem II apoproteins encoded by the
puc operon is anaerobically activated by RegA as well as
aerobically repressed by CrtJ (15, 19, 44). For
H2 oxidation, hup expression is activated by the
presence of H2 via the response regulator HupR (13,
51) and repressed by RegA. In N2 fixation,
nifA2 expression is clearly dependent on limitation of fixed
nitrogen via activation by NtrC (24; reviewed in
reference 35), as well as activation by RegA. In carbon fixation, regulation of the cbb operons that code for
Calvin cycle enzymes involves activation by CbbR in response to fixed carbon levels as well as activated by RegA (16;
J. M. Dubbs, T. H. Bird, C. E. Bauer, and F. R. Tabita, submitted for publication). Hence, the RegB-RegA two-component
system appears to function as a secondary regulator that provides an
overlying layer of control on these otherwise specifically regulated
processes. In many respects, the global nature of the reg
regulon is similar to what has been observed for the ArcB-ArcA
two-component system in E. coli. The ArcB-ArcA global system
provides redox-responsive regulation of a variety of metabolic genes,
many of which are also regulated by additional transcription factors
(reviewed in reference 33).
A question that is currently being addressed involves the mechanisms
that allow RegA to interact with such diverse transcription factors to
control target gene expression. Recently, Bowman et al. (5)
demonstrated that RegA and CrtJ proteins compete for overlapping
DNA-binding sites on the puc promoter. As suggested above,
one could envision that repression exerted by RegA on hupS expression may also result from competition with IHF for binding to the
hup promoter, since IHF and RegA DNA-binding sites overlap. Bowman et al. (5) also demonstrated that RegA recruits RNA polymerase-
70 to the puf and puc
promoters by establishing protein-protein interactions. It is
interesting that the nifA1 and nifA2 promoters in
R. capsulatus are atypical in that, although they do require NtrC for activation, they are recognized by the housekeeping RNA polymerase-
70 rather than RNA
polymerase-
54 (6). As observed for
puc and puf, RegA could play a role in recruiting
RNA polymerase-
70 to the nifA2 promoter, with
NtrC then playing a role in promoting activation. In such a case, RegA
would not directly activate transcription but instead would increase
expression by providing more RNA polymerase bound to the promoter
region that would then be activated by NtrC. Clearly, continued studies
of the mechanism of RegA activities on these target promoters are
warranted, given the diversity of promoter types that RegA regulates.
Oxygen is not a direct inhibitor of the histidine protein kinase,
RegB.
The RegB-RegA system was first identified as being
responsible for anaerobic activation of photosynthesis gene expression (40, 47). Oxygen was originally thought to directly inhibit RegB kinase activity, but this has never been directly demonstrated. The results of this study indicate that RegB and RegA are capable of
repressing hup gene expression even under conditions where oxygen is present (chemoheterotrophic conditions), suggesting that RegB
may be phosphorylating RegA in the presence of oxygen (Table 3). This
conclusion is supported by a previous study by Madigan and Gest
(34), which demonstrated that R. capsulatus cells
exhibited full pigment production under chemoautotrophic conditions
where O2, H2, and CO2 are present.
The current model is that the RegB-RegA system responds to the overall
redox state of the cell rather than to oxygen directly. This model is
supported by studies which demonstrate that R. capsulatus
and R. sphaeroides mutants lacking
cbb3-type cytochrome c oxidase
exhibit elevated photosynthesis gene expression under both aerobic and
anaerobic conditions (8, 41). Presumably electron flow
through a functional cbb3-type cytochrome
c oxidase is required for a normal regulation of photosystem
synthesis by transmitting a redox signal to RegB. The redox pathway in
R. sphaeroides appears to involve the protein CcoQ, one of
the cytochrome c oxidase components, and the protein RdxB
(41, 42). However, it is not yet clear if these proteins are
also involved in RegB sensing in R. capsulatus. A better
understanding of the redox-sensing pathway is needed to elucidate how
RegB-RegA is able to control the expression of such different metabolic processes in R. capsulatus.
We thank Howard Gest, Fevzi Daldal, and Terry Bird for
stimulating discussions and Robert Kranz for the nifA1 and
nifA2 reporter plasmids.
This work is supported by NIH grant GM53940 (to C.E.B.) and
CEA-CNRS-UJF grant (UMR 5092) (to A.C.).
| 1.
|
Bauer, C. E., and T. H. Bird.
1996.
Regulatory circuits controlling photosynthesis gene expression.
Cell
85:5-8[CrossRef][Medline].
|
| 2.
|
Bauer, E.,
T. Kaspar,
H. M. Fischer, and H. Hennecke.
1998.
Expression of the fixR-nifA operon in Bradyrhizobium japonicum depends on a new response regulator, RegR.
J. Bacteriol.
180:3853-3863[Abstract/Free Full Text].
|
| 3.
|
Bird, T. H.,
S. Du, and C. E. Bauer.
1999.
Autophosphorylation, phosphotransfer and DNA-binding properties of the RegB/RegA two-component regulatory system in Rhodobacter capsulatus.
J. Biol. Chem.
274:16343-16348[Abstract/Free Full Text].
|
| 4.
|
Bird, T. H.,
J. K. Grimsley,
J. A. Hoch, and G. B. Spiegelman.
1996.
The Bacillus subtilis response regulator Spo0A stimulates transcription of the spoIIG operon through modification of RNA polymerase promoter complexes.
J. Mol. Biol.
256:436-448[CrossRef][Medline].
|
| 5.
|
Bowman, W. C.,
S. Du,
C. E. Bauer, and R. G. Kranz.
1999.
In vitro activation and repression of photosynthesis gene transcription in Rhodobacter capsulatus.
Mol. Microbiol.
33:429-437[CrossRef][Medline].
|
| 6.
|
Bowman, W. C., and R. G. Kranz.
1998.
A bacterial ATP-dependent, enhancer binding protein that activates the housekeeping RNA polymerase.
Genes Dev.
12:1884-1893[Abstract/Free Full Text].
|
| 7.
|
Brito, B.,
M. Martinez,
D. Fernandez,
L. Rey,
E. Cabrera,
J. M. Palacios,
J. Imperial, and T. Ruiz-Argüezo.
1997.
Hydrogenase genes from Rhizobium leguminosarum bv. viciae are controlled by the nitrogen fixation regulatory protein NifA.
Proc. Natl. Acad. Sci. USA
94:6019-6024[Abstract/Free Full Text].
|
| 8.
|
Buggy, J., and C. E. Bauer.
1995.
Cloning and characterization of senC, a gene involved in both aerobic respiration and photosynthesis gene expression in Rhodobacter capsulatus.
J. Bacteriol.
177:6958-6965[Abstract/Free Full Text].
|
| 9.
|
Colbeau, A.,
A. Godfroy, and P. M. Vignais.
1986.
Cloning of DNA fragments carrying hydrogenase genes of Rhodopseudomonas capsulata.
Biochimie
68:147-155[Medline].
|
| 10.
|
Colbeau, A.,
B. C. Kelley, and P. M. Vignais.
1980.
Hydrogenase activity in Rhodopseudomonas capsulata: relationship with nitrogenase activity.
J. Bacteriol.
144:141-148[Abstract/Free Full Text].
|
| 11.
|
Colbeau, A., and P. M. Vignais.
1983.
The membrane-bound hydrogenase of Rhodopseudomonas capsulata is inducible and contains nickel.
Biochim. Biophys. Acta
748:128-138.
|
| 12.
|
Colbeau, A., and P. M. Vignais.
1992.
Use of hupS::lacZ gene fusion to study regulation of hydrogenase expression in Rhodobacter capsulatus: stimulation by H2.
J. Bacteriol.
174:4258-4264[Abstract/Free Full Text].
|
| 13.
|
Dischert, W.,
P. M. Vignais, and A. Colbeau.
1999.
The synthesis of Rhodobacter capsulatus HupSL hydrogenase is regulated by the two-component HupT/HupR system.
Mol. Microbiol.
34:995-1006[CrossRef][Medline].
|
| 14.
|
Ditta, G.,
S. Stanfield,
D. Corbin, and D. R. Helinski.
1980.
Broad host range DNA cloning system from Gram-negative bacteria: construction of a gene bank of Rhizobium meliloti.
Proc. Natl. Acad. Sci. USA
77:7347-7351[Abstract/Free Full Text].
|
| 15.
|
Du, S.,
T. H. Bird, and C. E. Bauer.
1998.
DNA binding characteristics of RegA*. A constitutively active anaerobic activator of photosynthesis gene expression in Rhodobacter capsulatus.
J. Biol. Chem.
273:18509-18513[Abstract/Free Full Text].
|
| 16.
|
Dubbs, J. M., and F. R. Tabita.
1998.
Two functionally distinct regions upstream of the cbbI operon of Rhodobacter sphaeroides regulate gene expression.
J. Bacteriol.
180:4903-4911[Abstract/Free Full Text].
|
| 17.
|
Elsen, S.,
A. Colbeau,
J. Chabert, and P. M. Vignais.
1996.
The hupTUV operon is involved in negative control of hydrogenase synthesis in Rhodobacter capsulatus.
J. Bacteriol.
178:5174-5181[Abstract/Free Full Text].
|
| 18.
|
Elsen, S.,
A. Colbeau, and P. M. Vignais.
1997.
Purification and in vitro phosphorylation of HupT, a regulatory protein controlling hydrogenase gene expression in Rhodobacter capsulatus.
J. Bacteriol.
179:968-971[Abstract/Free Full Text].
|
| 19.
|
Elsen, S.,
S. N. Ponnampalam, and C. E. Bauer.
1998.
CrtJ bound to distant binding sites interacts cooperatively to aerobically repress photopigment biosynthesis and light harvesting II gene expression in Rhodobacter capsulatus.
J. Biol. Chem.
273:30762-30769[Abstract/Free Full Text].
|
| 20.
|
Elsen, S.,
P. Richaud,
A. Colbeau, and P. M. Vignais.
1993.
Sequence analysis and interposon mutagenesis of the hupT gene, which encodes a sensor protein involved in repression of hydrogenase synthesis in Rhodobacter capsulatus.
J. Bacteriol.
175:7404-7412[Abstract/Free Full Text].
|
| 21.
|
Eraso, J. M., and S. Kaplan.
1994.
prrA, a putative response regulator involved in oxygen regulation of photosynthesis gene expression in Rhodobacter sphaeroides.
J. Bacteriol.
176:32-43[Abstract/Free Full Text].
|
| 22.
|
Eraso, J. M., and S. Kaplan.
1995.
Oxygen-insensitive synthesis of the photosynthetic membranes of Rhodobacter sphaeroides: a mutant histidine kinase.
J. Bacteriol.
177:2695-2706[Abstract/Free Full Text].
|
| 23.
|
Fisher, H. M.
1994.
Genetic regulation of nitrogen fixation in rhizobia.
Microbiol. Rev.
58:352-386[Abstract/Free Full Text].
|
| 24.
|
Fostner-Hartnett, D.,
P. J. Cullen,
E. M. Monika, and R. G. Kranz.
1994.
A new type of NtrC transcriptional activator.
J. Bacteriol.
176:6175-6187[Abstract/Free Full Text].
|
| 25.
|
Fostner-Hartnett, D., and R. G. Kranz.
1992.
Analysis of the promoters and upstream sequences of nifA1 and nifA2 in Rhodobacter capsulatus: activation requires ntrC but not rpoN.
Mol. Microbiol.
6:1049-1060[CrossRef][Medline].
|
| 26.
|
Gest, H.
1972.
Energy conversion and generation of reducing power in bacterial photosynthesis.
Adv. Microb. Physiol.
7:243-282.
|
| 27.
|
Gest, H.
1999.
Bioenergetic and metabolic process patterns in anoxyphototrophs, p. 11-19.
In
G. A. Pescheck, W. Löffelhardt, and G. Schmetterer (ed.), The phototrophic prokaryotes. Kluwer Academic/Plenum Publishers, New York, N.Y.
|
| 28.
|
Gutiérrez, D.,
Y. Hernando,
J. M. Palacios,
J. Imperial, and T. Ruiz- Argüeso.
1997.
FnrN controls symbiotic nitrogen fixation and hydrogenase activities in Rhizobium leguminosarum biovar viciae UPM791.
J. Bacteriol.
179:5264-5270[Abstract/Free Full Text].
|
| 29.
|
Hübner, P.,
J. C. Willison,
P. M. Vignais, and T. A. Bickle.
1991.
Expression of regulatory nif genes in Rhodobacter capsulatus.
J. Bacteriol.
173:2993-2999[Abstract/Free Full Text].
|
| 30.
|
Imhoff, J. F., and H. G. Truper.
1992.
The genus Rhodospirillum and related genera, p. 2141-2155.
In
A. Balows, H. G. Trüper, M. Dworkin, W. Harder, and K.-H. Schleifer (ed.), The prokaryotes: a handbook on the biology of bacteria, 2nd edition, vol. 3. Springer-Verlag, New York, N.Y.
|
| 31.
|
Inoue, K.,
J. L. K. Kouadio,
C. S. Mosley, and C. E. Bauer.
1995.
Isolation and in vitro phosphorylation of sensory transduction components controlling anaerobic induction of light harvesting and reaction center gene expression in Rhodobacter capsulatus.
Biochemistry
34:391-396[CrossRef][Medline].
|
| 32.
|
Joshi, H. M., and F. R. Tabita.
1996.
A global two-component signal transduction system that integrates the control of photosynthesis, carbon dioxide assimilation, and nitrogen fixation.
Proc. Natl. Acad. Sci. USA
93:14515-14520[Abstract/Free Full Text].
|
| 33.
|
Lynch, A. S., and E. C. C. Linn.
1996.
Responses to molecular oxygen, p. 1526-1538.
In
F. C. Neidhardt, et al. (ed.), (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed. ASM Press, Washington, D.C.
|
| 34.
|
Madigan, M. T., and H. Gest.
1979.
Growth of the photosynthetic bacterium Rhodopseudomonas capsulata chemoautotrophically in darkness with H2 as energy source.
J. Bacteriol.
137:524-530[Abstract/Free Full Text].
|
| 35.
|
Masepohl, B., and W. Klipp.
1996.
Organization and regulation of genes encoding the molybdenum nitrogenase and the alternative nitrogenase in Rhodobacter capsulatus.
Arch. Microbiol.
165:80-90[CrossRef].
|
| 36.
|
Masepohl, B.,
W. Klipp, and A. Pühler.
1988.
Genetic characterization and sequence analysis of the duplicated nifA/nifB gene region of Rhodobacter capsulatus.
Mol. Gen. Genet.
212:27-37[CrossRef][Medline].
|
| 37.
|
Masuda, S.,
Y. Matsumoto,
K. V. P. Nagashima,
K. Shimada,
K. Inoue,
C. E. Bauer, and K. Matsuura.
1999.
Structural and functional analyses of photosynthetic regulatory genes regA and regB from Rhodovulum sulfidophilum, Roseobacter denitrificans, and Rhodobacter capsulatus.
J. Bacteriol.
181:4205-4215[Abstract/Free Full Text].
|
| 38.
|
Maxam, A. M., and W. Gilbert.
1980.
Sequencing end-labeled DNA with base-specific chemical cleavages.
Methods Enzymol.
65:499-560[Medline].
|
| 39.
|
Meyer, J.,
B. C. Kelley, and P. M. Vignais.
1978.
Effect of light on nitrogenase function and synthesis in Rhodopseudomonas capsulata.
J. Bacteriol.
136:201-208[Abstract/Free Full Text].
|
| 40.
|
Mosley, C. S.,
J. Y. Suzuki, and C. E. Bauer.
1994.
Identification and molecular genetic characterization of a sensor kinase responsible for coordinately regulating light harvesting and reaction center gene expression in response to anaerobiosis.
J. Bacteriol.
176:7566-7573[Abstract/Free Full Text].
|
| 41.
|
O'Gara, J. P.,
J. M. Eraso, and S. Kaplan.
1998.
A redox-responsive pathway for aerobic regulation of photosynthesis gene expression in Rhodobacter sphaeroides 2.4.1.
J. Bacteriol.
180:4044-4050[Abstract/Free Full Text].
|
| 42.
|
Oh, J. I., and S. Kaplan.
1999.
The cbb3 terminal oxidase of Rhodobacter sphaeroides 2.4.1: structural and functional implications for the regulation of spectral complex formation.
Biochemistry
38:2688-2696[CrossRef][Medline].
|
| 43.
|
Pollock, D.,
C. E. Bauer, and P. A. Scolnik.
1988.
Transcription of the Rhodobacter capsulatus nifHDK operon is modulated by the nitrogen source. Construction of plasmid expression vectors based on the nifHDK promoter.
Gene
65:269-275[CrossRef][Medline].
|
| 44.
|
Ponnampalam, S. N.,
J. J. Buggy, and C. E. Bauer.
1995.
Characterization of an aerobic repressor that coordinately regulates bacteriochlorophyll, carotenoid, and light-harvesting II expression in Rhodobacter capsulatus.
J. Bacteriol.
177:2990-2997[Abstract/Free Full Text].
|
| 45.
|
Qian, Y., and F. R. Tabita.
1996.
A global signal transduction system regulates aerobic and anaerobic CO2 fixation in Rhodobacter sphaeroides.
J. Bacteriol.
178:12-18[Abstract/Free Full Text].
|
| 46.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 47.
|
Sganga, M. W., and C. E. Bauer.
1992.
Regulatory factors controlling photosynthetic reaction center and light-harvesting gene expression in Rhodobacter capsulatus.
Cell
68:945-954[CrossRef][Medline].
|
| 48.
|
Taylor, D. P.,
S. N. Cohen,
W. G. Clark, and B. L. Marrs.
1983.
Alignment of genetic and restriction maps of the photosynthesis region of the Rhodopseudomonas capsulata chromosome by a conjugation-mediated marker rescue technique.
J. Bacteriol.
154:580-590[Abstract/Free Full Text].
|
| 49.
|
Tiwari, R. P.,
W. G. Reeve,
M. J. Dilworth, and A. R. Glenn.
1996.
Acid tolerance in Rhizobium meliloti strain WSM419 involves a two-component sensor-regulator system.
Microbiology
142:1693-1704[Abstract].
|
| 50.
|
Toussaint, B.,
I. Delic-Attree,
R. de Sury d'Aspremont,
L. David,
M. Vincon, and P. M. Vignais.
1993.
Purification of the integration host factor homolog of Rhodobacter capsulatus: cloning and sequencing of the hipA gene, which encodes the -subunit.
J. Bacteriol.
175:6499-6504[Abstract/Free Full Text].
|
| 51.
|
Toussaint, B.,
R. de Sury d'Aspremont,
I. Delic-Attree,
V. Berchet,
S. Elsen,
A. Colbeau,
W. Dischert,
Y. Lazzaroni, and P. M. Vignais.
1997.
The Rhodobacter capsulatus hupSLC promoter: identification of cis-acting regulatory elements and of trans-activating factors involved in H2 activation of hupSLC transcription.
Mol. Microbiol.
26:927-937[CrossRef][Medline].
|
| 52.
|
Vignais, P. M.,
B. Dimon,
N. A. Zorin,
A. Colbeau, and S. Elsen.
1997.
HupUV proteins of Rhodobacter capsulatus can bind H2: evidence from the H-D exchange reaction.
J. Bacteriol.
179:290-292[Abstract/Free Full Text].
|
| 53.
|
Vignais, P. M.,
B. Toussaint, and A. Colbeau.
1995.
Regulation of hydrogenase gene expression, p. 1175-1190.
In
R. E. Blankenship, M. T. Madigan, and C. E. Bauer (ed.), Anoxygenic photosynthetic bacteria. Kluwer Academic Publishers, Dordrecht, The Netherlands.
|
| 54.
|
Weaver, P. F.,
J. D. Wall, and H. Gest.
1975.
Characterization of Rhodopseudomonas capsulata.
Arch. Microbiol.
105:207-216[CrossRef][Medline].
|
| 55.
|
Yen, H. C., and B. L. Marrs.
1976.
Map of genes for carotenoid and bacteriochlorophyll biosynthesis in Rhodopseudomonas capsulata.
J. Bacteriol.
126:619-629[Abstract/Free Full Text].
|
| 56.
|
Young, D. A.,
C. E. Bauer,
J. C. Williams, and B. L. Marrs.
1989.
Genetic evidence for superoperonal organization of genes for photosynthetic pigments and pigment-binding proteins in Rhodobacter capsulatus.
Mol. Gen. Genet.
218:1-12[CrossRef][Medline].
|