Previous Article | Next Article ![]()
Journal of Bacteriology, June 2000, p. 3136-3141, Vol. 182, No. 11
School of Biological Sciences, University of
Wales Bangor, Bangor, Gwynedd LL57 2UW, Wales, United Kingdom
Received 18 January 2000/Accepted 17 March 2000
Pseudomonas sp. strain TW3 is able to metabolize
4-nitrotoluene to 4-nitrobenzoate and toluene to benzoate aerobically
via a route analogous to the upper pathway of the TOL plasmids. We report the cloning and characterization of a benzyl alcohol
dehydrogenase gene (ntnD) which encodes the enzyme for the
catabolism of 4-nitrobenzyl alcohol and benzyl alcohol to
4-nitrobenzaldehyde and benzaldehyde, respectively. The gene is located
downstream of the previously reported ntn gene cluster.
NtnD bears no similarity to the analogous TOL plasmid XylB (benzyl
alcohol dehydrogenase) protein either in its biochemistry, being
NAD(P)+ independent and requiring assay via dye-linked
electron transfer, or in its deduced amino acid sequence. It does,
however, have significant similarity in its amino acid sequence to
other NAD(P)+-independent alcohol dehydrogenases and
contains signature patterns characteristic of type III flavin adenine
dinucleotide-dependent alcohol oxidases. Reverse transcription-PCR
demonstrated that ntnD is transcribed during growth on
4-nitrotoluene, although apparently not as part of the same transcript
as the other ntn genes. The substrate specificity of the
enzyme expressed from the cloned and overexpressed gene was similar to
the activity expressed from strain TW3 grown on 4-nitrotoluene,
providing evidence that ntnD is the previously unidentified
gene in the pathway of 4-nitrotoluene catabolism. Examination of the
14.8-kb region around the ntn genes suggests that one or
more recombination events have been involved in the formation of their
current organization.
Nitrotoluenes, like many
xenobiotics, are candidate molecules for understanding the evolution of
microbial catabolism, since they have been present in the biosphere as
potential substrates for microbes for relatively short periods of time;
2- and 4-nitrotoluene and 2,4- and 2,6-dinitrotoluenes are precursors
of TNT and are therefore by-products of the explosives industry. There
are also very few naturally occurring nitro compounds upon which
bacteria have had the opportunity to evolve a repertoire of catabolic
strategies. Pathways by which nitro-substituted xenobiotics are
degraded encompass a wide range of different biochemical mechanisms.
Some proceed by elimination of nitrogen from the nitro groups as
nitrite as a result of oxygenase-catalyzed reactions, as in the
degradation of 2,4-dinitrotoluene by Burkholderia sp. strain
DNT (28, 30, 31) and 2-nitrotoluene by
Pseudomonas sp. strain JS42 (13, 20). Although
Pseudomonas putida OU83 reduces most of 3-nitrotoluene to
3-aminotoluene, it appears to mineralize a proportion by first oxidizing its methyl group to form 3-nitrobenzoate which is then converted to 3-nitrophenol, from which nitrite is subsequently eliminated (1). In the case of 4-nitrotoluene catabolism by a Mycobacterium, the nitro group is reduced to an amino
group in 6-amino-m-cresol and is eventually released as
ammonium by an uncharacterized metabolic reaction (29).
Pseudomonas sp. strains TW3 (23) and 4NT
(12) use a different route for 4-nitrotoluene catabolism
with initial steps similar to those of OU83, i.e., sequential oxidation
of the methyl group, to form 4-nitrobenzoate. The nitro group is
reduced through 4-nitrosobenzoate and 4-hydroxylaminobenzoate from
which it is directly eliminated as ammonia. These reactions from
4-nitrobenzoate were first reported in the 4-nitrobenzoate degrader
Comamonas acidovorans NBA10 (10, 11), and similar reactions have since been found in Pseudomonas sp. strain
YH102 (L. M. Newman and G. J. Zylstra, unpublished data) and
Ralstonia pickettii YH105 (35), but none of these
utilize 4-nitrotoluene. The genes encoding the initial enzymes of the
4-nitrotoluene pathway (from 4-nitrotoluene to 4-nitrobenzoate) have
been cloned from Pseudomonas sp. strain TW3 (17)
and are very similar in sequence and organization to the TOL
plasmid-encoded upper pathway genes which catalyze the analogous
reactions on unsubstituted and methyl-substituted substrates
(15). Pseudomonas sp. strain 4NT also contains a similar set of TOL plasmid-like genes (K. D. James and P. A. Williams, unpublished data). Strains TW3 and 4NT differ in the
4-nitrobenzyl alcohol dehydrogenase reaction which, in strain TW3, is
NAD(P)+ independent (17, 23), whereas the
activity in 4NT is NAD+ dependent like the TOL plasmid
benzyl alcohol dehydrogenase XylB (26). The ntn
operon in strain TW3 does contain a xylB homolog, but it is
only a pseudogene containing a stop codon within the reading frame and
is interrupted by the insertion of a transposable element fragment
(17).
Here, we report the cloning and sequencing of a region downstream of
the previously reported ntn gene cluster that includes a
gene, ntnD, which encodes the missing
NAD(P)+-independent alcohol dehydrogenase of the pathway.
Bacterial strains and plasmids.
The bacterial strains and
plasmids used in this study are listed in Table
1. Pseudomonas sp. strain TW3
utilizes 4-nitrotoluene as its sole carbon and nitrogen source
(23) and will also grow on toluene.
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Cloning and Expression of ntnD, Encoding
a Novel NAD(P)+-Independent 4-Nitrobenzyl Alcohol
Dehydrogenase from Pseudomonas sp. Strain TW3

![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
TABLE 1.
Bacterial strains and plasmids used in this study
Chemicals and growth media.
Aromatic and aliphatic
substrates were obtained from Aldrich Chemical Co.
Pseudomonas strain TW3 was grown on minimal salts medium
(5) supplemented with either solid 4-nitrotoluene (0.5 g/liter) or sodium succinate added at 10 mM. Escherichia
coli strains were grown on Luria-Bertani medium (25).
Where appropriate, ampicillin was added at 100 µg/ml and kanamycin
was added at 50 µg/ml. Bacteriophage
(FIX II; Stratagene) was
propagated according to the supplier's instructions.
DNA manipulations. Unless otherwise stated, standard methods for DNA manipulation were used (25). Total DNA was prepared from Pseudomonas sp. strain TW3 by the method of Ausubel et al. (3). Plasmid DNA was prepared from E. coli strains by using Qiaprep columns (QIAGEN). DNA fragments were recovered from agarose gels by using Qiaquick columns (QIAGEN). Southern blotting and plaque lifts were carried out as described by Sambrook et al. (25). Hybridizations were carried out with ECL direct labelling (Amersham) according to the manufacturer's instructions.
Preparation and screening of Pseudomonas sp. strain
TW3 genomic library.
Genomic DNA was partially digested with
Sau3AI, and the ends were filled in by incubation with DNA
polymerase Klenow fragment and the appropriate deoxynucleogide
triphosphates (dNTP) (dATP and dGTP), leaving a 2-bp overhang. The
genomic DNA fragments were ligated into phage
FIX II arms
(Stratagene) previously digested with XhoI and partially
filled in. The library was screened by hybridization to plaque lifts,
and lambda DNA was prepared from positive clones as described by
Sambrook et al. (25).
DNA sequencing and sequence analysis methods. DNA sequences were determined by MWG-Biotech, Ltd. (Ebersberg, Germany). PCR primers were designed with the aid of the Lasergene software package (DNAStar, Inc., Madison, Wis.). Sequence databases were searched by using FASTA (21), BLASTN, and BLASTX programs (2). The PROSITE and Pfam motif databases were searched with custom Perl scripts. Frame plot analysis (6) and determination of percentage G+C content and open reading frame location were carried out with Artemis (Pathogen Sequencing Unit, The Sanger Centre). Multiple sequence alignments were carried out by using ClustalW.
Expression of ntnD in E. coli.
The
ntnD gene was amplified by PCR from plasmid pTW3.10 with
Taq polymerase (Promega). Primers incorporating an
NdeI site in the forward primer and a BglII site
in the reverse primer were designed. The NdeI site was
positioned at the start codon of the ntnD open reading
frame. Primer sequences (with restriction sites underlined) were as
follows: forward, CATATGAATAATAATAACTTTGACGTG; reverse, AGATCTAACTCCTCGGTAGGAAGAGC (bp 8084 to
8110 and 9741 to 9716, respectively [GenBank accession no.
AF043544]). PCR amplifications were carried out in a 100-µl reaction
volume containing 10 ng of template DNA, 100 pmol of each primer, 200 µM each dNTP, 2 mM MgCl2, and 1 U of Taq
polymerase. After a 2-min hot start at 94°C, the reaction mixtures
were given 25 cycles of 1 min at 94°C, 1 min at 53°C, and 2 min at
72°C. The PCR product was cloned into pCR-blunt (Invitrogen) in
E. coli TOP10 with selection on 50 µg of kanamycin per ml.
The amplified gene was cut from the cloning vector with NdeI
and BglII and was ligated into pET5a cut with
NdeI and BamHI, placing the ntnD gene
in frame with the T7 promoter to create pETntnD. The NtnD
protein was expressed in E. coli BL21(DE3)/pLysS (Promega)
grown in Luria-Bertani broth to an optical density at 600 nm of 0.3 and
was induced with 0.2 mM IPTG
(isopropyl-
-D-thiogalactopyranoside) for 3 h prior
to harvesting.
SDS-PAGE. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was carried out by using the method of Laemmli (18) on a Mini-PROTEAN II Electrophoresis Cell (Bio-Rad, Hemel Hempstead, United Kingdom).
Enzyme assays.
Cells were harvested by centrifugation,
washed with 50 mM Na2HPO4 (pH 7.5), and
resuspended in the same buffer at approximately 0.2 g (wet weight)
per ml. Cells were disrupted by passing them through a precooled French
pressure cell (SLM Instruments Inc., Urbana, Ill.), and particulates
were removed by centrifugation at 45,000 × g and 4°C
for 30 min. Assays were carried out spectrophotometrically by following
the reduction of 2,6-dichlorophenol indophenol (DCPIP) at 600 nm. Each
3-ml assay contained 50 µl of 20 mM phenazine methosulfate, 25 µl
of 6.7 mM DCPIP, 30 µl of substrate (100 mM in dimethyl sulfoxide),
and 50 µl of cell extract and was buffered with 2,845 µl of 80 mM
Tris-HCl (pH 8.7). The Tris-HCl buffer was replaced with Bicine (pH 7.5 to 9.5) or CAPS (3-[cyclohexylamino]-1 propanesulfonic acid) (pH 9.5 to 11) to determine the pH profile. Assays were carried out at 28°C.
The assay mixture was preincubated without substrate for 2 min at
28°C, and the reaction was started by the addition of substrate. The
molar extinction coefficient for DCPIP at 600 nm was taken to be 21,000 M
1 cm
1.
RNA isolation and RT-PCR. Cells were grown on minimal media supplemented with either 4-nitrotoluene or succinate until they reached an optical density at 600 nm of 0.3. Total RNA was prepared from 109 cells with RNeasy Mini columns (QIAGEN), with elution in 30 µl of water. The RNA was treated with DNase I to remove any genomic DNA contamination by incubation for 30 min at 37°C with 1 U of RNase-free DNase (Promega) and 1 U of RNasin (Promega) in 40 mM Tris-HCl (pH 7.5) containing 10 mM NaCl, 10 mM CaCl2, and 6 mM MgSO4. The RNA was cleaned by passage through an RNeasy Mini column before reverse transcription-PCR (RT-PCR) was carried out with total RNA by using an Access RT-PCR kit (Promega). Primer sequences for ntnD were (Dforward) 5'-CGTGATCGTAGTTGGTAGCGGTGC and (Dreverse) 5'-GGGTTGGTGCGTTGGTGTTGC (bp 8107 to 8130 and 9629 to 9609, respectively [GenBank accession no. AF043544]). The primer sequences for the region spanning ntnAB*D were (AB*Dforward) 5'-GCAACTCGATTGGGGTGGGC and (AB*Dreverse) 5'-GCCCAACACCTTGCCAGAGCG (bp 6739 to 6758 and 8338 to 8318, respectively). PCRs were carried out in a 50-µl volume containing 0.1 µg of template RNA, 50 pmol of each primer, 50 µM each dNTP, 1 mM MgSO4, 5 U of avian myeloblastosis virus reverse transcriptase, and 5 U of Tfl DNA polymerase in the reaction buffer supplied by the manufacturer. After reverse transcription at 48°C for 45 min, the reaction mixtures were heated to 94°C for 2 min and given 40 cycles of 30 s at 94°C, 1 min at 52°C, and 2 min at 68°C followed by a final extension at 68°C for 10 min. Negative control reactions were performed in the same way without reverse transcriptase to eliminate the possibility of amplifying residual genomic DNA.
Nucleotide sequence accession number. The nucleotide sequence of 14,861 bp presented in Fig. 1 is available in GenBank under accession no. AF043544.
| |
RESULTS |
|---|
|
|
|---|
Screening of Pseudomonas sp. strain TW3 genomic
library.
The TW3 genomic library was screened by hybridization by
using a probe containing part of the ntn operon previously
characterized (17). The probe was obtained by digesting
plasmid pTW3.6 with HindIII, yielding a 579-bp
HindIII fragment which included part of
ntnB*, downstream of ntnA (Fig.
1). Fifty positive clones were obtained
from screening 3.2 × 105
phage. One positive
clone was selected, from which an 8,626-bp XhoI/XbaI fragment was subcloned into pBluescript
(Stratagene) to create plasmid pTW3.10. The DNA sequence of the insert
of pTW3.10 was determined.
|
Analysis of the nucleotide sequence of pTW3.10.
From the
nucleotide sequence of pTW3.10, the presence of six complete open
reading frames was deduced (Fig. 1). Immediately downstream of
ntnB* is a 1,599-nucleotide gene (designated
ntnD) corresponding to a protein of 532 amino acids with a
molecular mass of 57.4 kDa. NtnD is similar to Gluconobacter
oxydans L-sorbose dehydrogenase which catalyzes the
conversion of L-sorbose to L-sorbosone (24) and to the alcohol dehydrogenase (AlkJ) from
Pseudomonas oleovorans (32) and from P. putida (27) which converts aliphatic medium-chain-length alcohols to aldhehydes during the metabolism of
alkanes (Table 2). The second and fourth
open reading frames (orf1 and -2, respectively) correspond to proteins
of unknown function and the 5' end of the fifth open reading frame
(orf3) shows some similarity to a putative transposase from
Deinococcus radiodurans (Table 2). The third open reading
frame (designated aldH*) is similar to an aldehyde
dehydrogenase from P. putida but is interrupted by a stop
codon and therefore appears to be a pseudogene like ntnB*.
This interruption coincides with an abrupt increase in G+C content
(Fig. 1). The final open reading frame (orf4) corresponds to part of a
transposase from Xanthomonas campestris.
|
Expression of ntnD in E. coli and alcohol
dehydrogenase assays.
A 4-nitrobenzyl alcohol dehydrogenase
specific activity of 0.28 U/mg with 4-nitrobenzyl alcohol as the
substrate was obtained at pH 8.7 from cell extracts of the cloned
ntnD gene overexpressed in E. coli BL21(DE3).
SDS-PAGE showed high levels of a polypeptide of ~57 kDa (Fig.
2). No activity or enhanced 57-kDa
protein band was detectable in controls where the expression vector
contained no insert. Activity was found only by the dye-linked assay,
and no reduction of NAD+, NADP+, or flavin
adenine dinucleotide (FAD) was detected in the presence of
4-nitrobenzyl alcohol, confirming earlier data obtained by using cell
extracts of 4-nitrotoluene-grown Pseudomonas sp. strain TW3
(17, 23).
|
|
RT-PCR analysis of transcripts present in TW3.
In order to
show that the ntnD gene encodes an enzyme involved in the
catabolism of 4-nitrotoluene, we examined transcripts from cells grown
on 4-nitrotoluene and on succinate as a control. Two primer sets were
constructed, one spanning from ntnA, across ntnB*, and through to ntnD and the other spanning
ntnD alone (Fig. 3A). The
expected RT-PCR size for ntnAB*D was 1,599 bp, and for ntnD alone it was 1,522 bp. The PCR products obtained,
together with restriction digests of the products chosen to confirm the presence of expected restriction sites, were analyzed by agarose gel
electrophoresis. Figure 3B shows that products of the expected size
were obtained from total RNA of cells grown on 4-nitrotoluene by using
the ntnD primers, and the presence of restriction sites in
the expected positions was confirmed by digestion with BamHI and EcoRI. No products were obtained from total RNA of
succinate-grown cells (data not shown) or from reaction mixtures from
which the reverse transcriptase had been omitted. No products were
obtained across ntnAB*D by using RNA prepared from
4-nitrotoluene-grown cells, although the primers did amplify a product
of the correct size by using genomic DNA as the template (data not
shown).
|
| |
DISCUSSION |
|---|
|
|
|---|
We have cloned and sequenced a genomic DNA fragment from Pseudomonas sp. strain TW3 downstream of the genes of the ntn operon (17). We have located ntnD directly adjacent to and downstream of the insertionally inactivated XylB homologue ntnB*. The NtnD protein catalyzes the catabolism of 4-nitrobenzyl alcohol to 4-nitrobenzaldehyde, and the location and identification of its gene complete the characterization of the genes encoding the pathway from 4-nitrotoluene to 4-nitrobenzoate. Previous biochemical analysis of this pathway demonstrated that the enzyme catalyzing this step in 4-nitrotoluene- or toluene-grown cells was anomalous in being NAD(P)+ independent (17, 23). This anomaly was highlighted by the reports that, in the other 4-nitrotoluene-degrading Pseudomonas sp. strain, 4NT, the analogous enzyme was NAD+ dependent (12) and that the other genes for the catabolism to 4-nitrobenzoate in TW3 were highly homologous to the genes on the TOL plasmid pWW0 (15, 17), in which the benzyl alcohol dehydrogenase XylB is a Zn2+-containing, NAD+- dependent alcohol dehydrogenase (26). There is in TW3 a considerable region of homology with the TOL plasmid xylB, but this appears to be a pseudogene with the potential reading frame interrupted by an insertion and has been designated ntnB* (17).
The NtnD amino acid sequence shares clear homology with similar NAD(P)+-independent enzymes, i.e., the alcohol dehydrogenase (AlkJ) from P. oleovorans and P. putida (27, 32) and L-sorbose dehydrogenase from G. oxydans (24). NtnD, like its NAD(P)+-independent counterparts, possesses a possible glycine box (GXGXXG) close to the amino terminus at residues 12 to 17 (GSGAAG) which is typical of the binding site of the ADP moiety of FAD (19, 33). Examination of the amino acid sequence in PROSITE (4) shows that at residues 80 to 103 (GKVLGGGTSVNAMCYVRGQKRDFD) and at residues 253 to 267 (GAVHSPKILMHSGIG), NtnD has signature patterns characteristic of FAD oxidoreductases (GA)-(RKN)-X- (LIV)-G(2)-(GST)(2)-X-(LIVM)-N-X(3)-(FYWA)-X(2)- (PAG)-X(5)-(DNESH) and (GS)-(PSTA)-X(2)-(ST)-P-X-(LIVM)(2)-X(2)-S-G-(LIVM)-G, respectively, but the function of these domains is not yet known. These data suggest that NtnD is also a flavoprotein.
There are three major classes of alcohol dehydrogenases (22): (i) the NAD(P)+-dependent alcohol dehydrogenases which are subdivided into three subgroups according to their metal dependence, the medium-chain Zn-dependent enzymes, the short-chain Zn-independent enzymes, and the Fe-activated enzymes; (ii) the NAD(P)+-independent enzymes which use pyrroloquinoline quinone, a heme group in association with pyrroloquinoline quinone (7-9), or cofactor F420 as a cofactor; and (iii) the FAD-dependent alcohol oxidases, which catalyze an essential irreversible oxidation of alcohols. The presence of a FAD signature sequence in NtnD suggests that it is a FAD-dependent alcohol dehydrogenase. Although the in vivo electron acceptor of NtnD, like that of the homologous AlkJ, is unknown, Van Beilen et al. (32) have shown that AlkJ transfers electrons from the substrate onto molecular O2, possibly through the electron transfer chain.
In this study, NtnD has been highly expressed from the vector pET5a. The cloned NtnD alcohol dehydrogenase activity shows the same relative substrate specificity as that of the wild-type TW3 grown on 4-nitrotoluene, providing evidence that the cloned gene is indeed the one expressed during growth on 4-nitrotoluene or toluene. Similarly, the RT-PCR provides further evidence that ntnD is being transcribed during growth on 4-nitrotoluene. However, it appears that the gene is not being cotranscribed with the other ntn genes. Because of its location, downstream of ntnB*, this implies that within the insertion in that pseudogene there is some termination signal for transcription. However, the inducibility of NtnD during growth on toluene and 4-nitrotoluene also implies that upstream on ntnD there is also a regulatory element controlling its growth substrate-dependent expression separately from that of the other ntn genes.
The average G+C content of the DNA from ntnU through to the stop codon in aldH*, being only 49.7%, is unusually low for Pseudomonas. This contrasts with the DNA at either end, which is 59.4% (at the 5' end) and 58.2% (at the 3' end) (Fig. 1), both corresponding much more closely to the norm for Pseudomonas. This suggests that it was incorporated into the genome of strain TW3 by some (relatively) recent recombination event. It also shows its close relationship with the homologous xylUWCMABN operon from the TOL plasmid, which is also unusually low in G+C content (50.2%) compared with the norm for Pseudomonas and which contrasts with the TOL lower operon xylXYZLTEGFJKIH (61.8%). The presence of DNA within and around the ntn gene cluster of sequences homologous to transposase-like genes (or partial genes), including the insertion within pseudogene ntnB*, adds credence to the likelihood that this cluster of genes was incorporated into the TW3 genome by one or more transposition events. It is possible that at some stage during, or after, acquisition of these genes, the xylB homolog became inactivated by insertion, and this event may have also been accompanied by the deletion of a xylN homolog which is present at the 3' end of the TOL operon but absent from the ntn gene cluster. To compensate for the inactivation of ntnB, the gene for NtnD may have been recruited from elsewhere within the genome or from incoming heterologous DNA in order to carry out the conversion of benzyl alcohols to benzaldehydes. This scenario, based upon the structure of the DNA around these ntn genes, adds additional support for hypotheses (14, 16, 34) that strains have evolved novel catabolic pathways through the acquisition of genetic modules encoding operons or parts of operons.
| |
ACKNOWLEDGMENT |
|---|
This research was funded under the auspices of the Biotechnology Research program of the European Commission.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: School of Biological Sciences, University of Wales Bangor, Bangor, Gwynedd LL57 2UW, Wales, United Kingdom. Phone: (44) 1248 382363. Fax: (44) 1248 370731. E-mail: P.A.Williams{at}bangor.ac.uk.
Present address: The Sanger Centre, Wellcome Trust Genome Campus,
Hinxton, Cambridge CB10 1SA, United Kingdom.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Alisadat, S., K. S. Mohan, and S. K. Walia. 1995. A novel pathway for the biodegradation of 3-nitrotoluene in Pseudomonas putida. FEMS Microbiol. Ecol. 17:169-176. |
| 2. | Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403-410[CrossRef][Medline]. |
| 3. | Ausubel, F. M., R. Brent, R. E. Kingston, D. E. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.). 1987. Current protocols in molecular biology. John Wiley & Sons, Inc., New York, N.Y. |
| 4. |
Bairoch, A.,
P. Bucher, and K. Hofman.
1997.
The PROSITE database, its status in 1997.
Nucleic Acids Res.
25:217-221 |
| 5. |
Bauchop, T., and S. R. Elsden.
1960.
The growth of microorganisms in relation to energy supply.
J. Gen. Microbiol.
23:457-469 |
| 6. | Bibb, M. J., P. R. Findlay, and M. W. Johnson. 1984. The relationship between base composition and codon usage in bacterial genes and its use for the simple and reliable identification of protein-coding sequences. Gene 30:157-166[CrossRef][Medline]. |
| 7. | Duine, J. A. 1991. Quinoproteins: enzymes containing the quinoid cofactor pyrroloquinoline quinone, topaquinone or tryptophan-tryptophan quinone. Eur. J. Biochem. 200:271-284[Medline]. |
| 8. | Groen, B. W., and J. A. Duine. 1990. Quinoprotein alcohol dehydrogenase from Pseudomonas aeruginosa and quinohemoprotein alcohol dehydrogenase from Pseudomonas testosteroni. Methods Enzymol. 188:33-39[Medline]. |
| 9. | Groen, B. W., M. A. G. van Kleef, and J. A. Duine. 1986. Quinohemoprotein alcohol-dehydrogenase apoenzyme from Pseudomonas testosteroni. Biochem. J. 234:611-615[Medline]. |
| 10. | Groenewegen, P. E. J., and J. A. M. deBont. 1992. Degradation of 4-nitrobenzoate via 4-hydroxylaminobenzoate and 3,4-dihydroxybenzoate in Comamonas acidovorans NBA-10. Arch. Microbiol. 158:381-386[CrossRef]. |
| 11. | Groenewegen, P. E. J., P. Breeuwer, J. M. L. M. Vanhelvoort, and A. A. M. Langenhoff. 1992. Novel degradative pathway of 4-nitrobenzoate in Comamonas acidovorans NBA-10. J. Gen. Microbiol. 138:1599-1605. |
| 12. |
Haigler, B. E., and J. C. Spain.
1993.
Biodegradation of 4-nitrotoluene by Pseudomonas sp. strain 4NT.
Appl. Environ. Microbiol.
59:2239-2243 |
| 13. |
Haigler, B. E.,
W. H. Wallace, and J. C. Spain.
1994.
Biodegradation of 2-nitrotoluene by Pseudomonas sp. strain JS42.
Appl. Environ. Microbiol.
60:3466-3469 |
| 14. | Harayama, S. 1994. Codon usage patterns suggest independent evolution of two catabolic operons on toluene degradative plasmid TOL pWW0 of Pseudomonas putida. J. Mol. Evol. 39:328-335. |
| 15. |
Harayama, S.,
M. Rekik,
M. Wubbolts,
K. Rose,
R. A. Leppik, and K. N. Timmis.
1989.
Characterization of five genes in the upper-pathway operon of TOL plasmid pWW0 from Pseudomonas putida and identification of the gene products.
J. Bacteriol.
171:5048-5055 |
| 16. | Horn, J. M., S. Harayama, and K. N. Timmis. 1991. DNA sequence determination of the TOL plasmid (pWW0) xylGFJ genes of Pseudomonas putida: implications for the evolution of aromatic catabolism. Mol. Microbiol. 5:2459-2474[Medline]. |
| 17. |
James, K. D., and P. A. Williams.
1998.
ntn genes determining the early steps in the divergent catabolism of 4-nitrotoluene and toluene in Pseudomonas sp. strain TW3.
J. Bacteriol.
180:2043-2049 |
| 18. | Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685[CrossRef][Medline]. |
| 19. | Lamark, T., I. Kaasen, M. W. Eshoo, P. Falkenberg, J. McDougal, and A. R. Strom. 1991. DNA sequence and analysis of the bet genes encoding the osmoregulatory choline-glycine betaine pathway of Escherichia coli. Mol. Microbiol. 5:1049-1064[Medline]. |
| 20. | Parales, J. V., A. Kumar, R. E. Parales, and D. T. Gibson. 1996. Cloning and sequencing of the genes encoding 2-nitrotoluene dioxygenase from Pseudomonas sp. JS42. Gene 181:57-61[CrossRef][Medline]. |
| 21. |
Pearson, W. R., and D. J. Lipman.
1988.
Improved tools for biological sequence comparison.
Proc. Natl. Acad. Sci. USA
85:2444-2448 |
| 22. | Reid, M. F., and C. A. Fewson. 1994. Molecular characterization of microbial alcohol dehydrogenases. Crit. Rev. Microbiol. 20:13-56[Medline]. |
| 23. |
Rhys-Williams, W.,
S. C. Taylor, and P. A. Williams.
1993.
A novel pathway for the catabolism of 4-nitrotoluene by Pseudomonas.
J. Gen. Microbiol.
139:1967-1972 |
| 24. | Saito, Y., Y. Ishii, H. Hayashi, Y. Imao, T. Akashi, K. Yoshikawa, Y. Noguchi, S. Soeda, M. Yoshida, M. Niwa, J. Hosoda, and K. Shimomura. 1997. Cloning of genes coding for L-sorbose and L-sorbosone dehydrogenases from Gluconobacter oxydans and microbial production of 2-keto-L-gulonate, a precursor of L-ascorbic acid, in a recombinant G. oxydans strain. Appl. Environ. Microbiol. 63:454-460[Abstract]. |
| 25. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 26. |
Shaw, J. P.,
M. Rekik,
F. Schwager, and S. Harayama.
1993.
Kinetic studies on benzyl alcohol dehydrogenase encoded by TOL plasmid pWW0.
J. Biol. Chem.
265:10842-10850 |
| 27. | Smits, T. H. M., M. Röthlisberger, B. Witholt, and J. B. van Beilen. 1999. Molecular screening for alkane hydroxylase genes in Gram-negative and Gram-positive strains. Environ. Microbiol. 1:307-317[CrossRef][Medline]. |
| 28. |
Spanggord, R. J.,
J. C. Spain,
S. F. Nishino, and K. E. Mortelmans.
1991.
Biodegradation of 2,4-dinitrotoluene by a Pseudomonas sp.
Appl. Environ. Microbiol.
57:3200-3205 |
| 29. |
Spiess, T.,
F. Desiere,
P. Fischer,
J. C. Spain,
H. J. Knackmuss, and H. Lenke.
1998.
A new 4-nitrotoluene degradation pathway in a Mycobacterium strain.
Appl. Environ. Microbiol.
64:446-452 |
| 30. |
Suen, W.-C.,
B. E. Haigler, and J. C. Spain.
1996.
2,4-Dinitrotoluene dioxygenase from Burkholderia sp. strain DNT: similarity to naphthalene dioxygenase.
J. Bacteriol.
178:4926-4934 |
| 31. |
Suen, W. C., and J. C. Spain.
1993.
Cloning and characterization of Pseudomonas sp. strain DNT genes for 2,4-dinitrotoluene degradation.
J. Bacteriol.
175:1831-1837 |
| 32. | Van Beilen, J. B., G. Eggink, H. Enequist, R. Bos, and B. Witholt. 1992. DNA sequence determination and functional characterization of the OCT-plasmid-encoded alkJKL genes of Pseudomonas oleovorans. Mol. Microbiol. 6:3121-3136[CrossRef][Medline]. |
| 33. |
Wierenga, R. K.,
P. Terpstra, and W. G. J. Hol.
1986.
Prediction of the occurrence of the ADP-binding ![]() ![]() -fold in proteins, using an amino acid sequence fingerprint.
J. Mol. Biol.
187:101-107[CrossRef][Medline].
|
| 34. | Williams, P. A., and J. R. Sayers. 1994. The evolution of pathways for aromatic hydrocarbon oxidation in Pseudomonas. Biodegradation 5:195-217[CrossRef][Medline]. |
| 35. | Yabannavar, A. V., and G. J. Zylstra. 1995. Cloning and characterization of the genes for p-nitrobenzoate degradation from Pseudomonas pickettii YH105. Appl. Environ. Microbiol. 61:4284-4290[Abstract]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»