Previous Article | Next Article 
Journal of Bacteriology, June 2000, p. 3587-3589, Vol. 182, No. 12
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
The Length of the Combined 3' Untranslated Region
and Poly(A) Tail Does Not Control Rates of Glyceraldehyde-3-Phosphate
Dehydrogenase mRNA Translation in Three Species of Parasitic
Protists
Benno H.
ter
Kuile1,* and
Fernando J.
Sallés2
The Rockefeller University, New York, New
York 10021-6399,1 and Department of
Pharmacology, State University of New York at Stony Brook, Stony
Brook, New York 11794-86512
Received 11 October 1999/Accepted 23 March 2000
 |
ABSTRACT |
Experimental observations suggested that the length of the
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA 3' end has a role
in regulating rates of translation in the parasitic protists Trypanosoma brucei, Leishmania donovani, and
Trichomonas vaginalis. Using a PCR assay for poly(A) tail
length, we measured the size of the RNA 3' end under different growth
conditions in all three species. Our results showed that the combined
3' untranslated region and poly(A) tail of GAPDH mRNA do not vary with
different rates of translation.
 |
TEXT |
Activities of the enzymes of the
glycolytic pathway of the parasitic protists Trypanosoma
brucei, Leishmania donovani, and Trichomonas
vaginalis are finely adjusted to the needs of the cell
(21-23). Cellular activities vary by a factor of 2 to 40 depending on growth conditions but rarely have a direct relationship to growth rate. Levels of RNA, both rRNA and different species of mRNA,
are far more directly related to growth rate and can vary by an order
of magnitude. The lack of correlation between steady-state mRNA levels
and activities of the corresponding enzymes suggests that control of
their expression occurs posttranscriptionally (23, 24).
Since most of the enzymes studied are not regulated by
low-molecular-weight effectors and no other posttranslational modification has been identified (3, 12, 13), activity can
be used as a measure for abundance. Therefore, expression of the genes
coding for the glycolytic enzymes must be regulated at the
translational level.
The importance of translational control in the overall regulation of
gene expression is increasingly recognized (10, 11, 14). A
role of the mRNA 3' end in regulation of translation has been suggested
for many species (6), including expression of the glucose
transporter (8) and procyclin genes in T. brucei (5, 7, 9, 18). In addition, the 3' untranslated region (UTR)
influences rates of turnover of hsp83 message of L. donovani (1). During oogenesis and early development in metazoans, a predominant form of translational regulation is a cytoplasmic change in
the length of the poly(A) tail (27). These changes in tail
length are controlled by sequences in the 3' UTR. The modifications at
the 3' end of mRNAs seem to be under the strict control of the cell
(28). Northern analysis of RNA isolated from cells grown in
chemostats (23, 24) revealed different migration patterns of
the same message isolated under different growth conditions. We
therefore tested whether the length of the poly(A) tail and/or 3' UTR
of the message encoding the glycolytic enzyme
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) had a role in
regulating its translation in these protists.
The length of the combined 3' UTR and poly(A) tail was measured on the
GAPDH mRNA found in T. brucei, L. donovani, and
T. vaginalis grown at different growth rates and under
different carbon regimens (23, 24). The organisms were grown
in single-stage flow-controlled chemostats (25, 26) under
glucose limitation or at excess glucose concentrations, in which case a
component of the serum was rate limiting. Steady states were obtained
at five growth rates, approximately 0.2, 0.4, 0.6, 0.8, and 0.95 times
the maximum for each species, for both limited-glucose and excess-glucose cells, giving a total of 10 steady states per species. Message levels and GAPDH activities for these cultures have been reported recently (23, 24). The length of the combined 3' UTR and poly(A) tail was measured using the ligase-mediated PCR poly(A)
test (PAT) (16, 17). This PCR-driven assay amplifies a
region between a specific site near the 3' end of an RNA and an
oligo(dT) primer that is targeted to the end of the poly(A) tail. The
resulting amplicon represents the 3' UTR and the poly(A) tail. Since
the oligo(dT) anchor is targeted to the extreme end of the poly(A)
tail, any change in length will manifest itself as a change in mobility
of the resulting amplicon. Briefly, RNA samples from each steady state
were incubated with oligo-p(dT)12-18 for 30 min at 42°C
in the presence of T4 DNA ligase. A fivefold molar excess of oligo(dT)
anchor (5'-GCGAGCTCCGCGGGCCGCC-T12) was added, followed by a
2-h incubation at 12°C. This allows targeting of the anchor sequence
to the region representing the extreme 3' end of the poly(A) tail.
First-strand cDNAs were then synthesized by reverse transcription and
used as template for PCR. The samples were amplified using the
oligo(dT) anchor and a specific primer for GAPDH (T. brucei,
GTTATTCCCACCGTGTGGTG; L. donovani,
GACCTGGTGCGCTACATGGC; and T. vaginalis,
CAAACCCAGAAGGCCAAGGC), yielding a heterogeneous pool of
amplicons that represent the length of the mRNA from the specific GAPDH
primer site through the end of the poly(A) tail. The size of the
amplicons from each sample was determined by agarose gel
electrophoresis and ethidium bromide staining.
The combined length of the poly(A) tail and 3' UTR was calculated by
substracting the length of the region between the gene-specific primer
site and the end of the open reading frame from the total measured
length. This parameter varied within each sample by between 380 and 550 nucleotides (nt) in T. brucei, between 450 and 540 nt in
L. donovani, and between 130 and 170 nt in T. vaginalis (Fig. 1). There was no
meaningful difference among the size distributions of the 10 samples
from each species. For a regulatory role, one would expect size
differences of 50 to 600 nt (2, 4, 15, 27). No such
variation was observed, even though the ligase-mediated PAT can detect
differences of 10 nt (16). These data suggest that there is
no direct influence of the growth rate on the size distribution of the
3' UTR and poly(A) tail for the GAPDH message under conditions that
greatly alter GAPDH activity. This finding does not contradict reduced
rates of translation for individual mRNA copies caused by the
progressive shortening of the poly(A) tail during the translation
process (2, 4, 15). Messages with shorter 3' UTRs and/or
poly(A) tails may be translated at lower rates than those with longer
ones. Nevertheless, the data indicate that the length of the 3' end is
not a mechanism for regulating rates of translation in the case studied
here.

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 1.
(A) PAT analysis of GAPDH mRNA. Agarose gels of the
amplicons indicating the length of the combined poly(A) tail and 3' UTR
of the GAPDH messages of the three species grown under 10 different
conditions. Growth rates vary by a factor of 5, and cellular activities
vary up to 10-fold. As rates of turnover are below 2% per h, rates of
translation vary by a factor of 50 maximally. No meaningful differences
in size distributions between different samples of each species were
detected. The lower-molecular-weight band in the L. donovani
samples is an artifact due to internal hybridization, but as it also
shows no modifications, the conclusions would not change if it were the
primary signal. PAT cDNAs were prepared as described elsewhere using
avian myeloblastosis virus reverse transcriptase (16). cDNAs
were amplified under the following conditions: initial denaturation for
5 min at 93°C, followed by 35 cycles of 45 s at 93°C, 45 s at 60°C, and 75 s at 72°C. After cycling, the samples were
incubated at 72°C for 7 min as a final extension. Molecular weight
analysis was performed by electrophoresis on a 2% Metaphor (FMC) gel.
For each species, lanes 1 to 5 are from cells grown under glucose
limitation at approximately 0.2, 0.4, 0.6, 0.8, and 0.95 times the
maximum growth rate. Lanes 6 to 10 are from excess glucose-grown cells
at similar growth rates. The molecular weight estimations are derived
from a PBR-MSP1 digest electrophoresis in an adjacent well. The
reported 3' UTR length takes the length of the coding region that was
included in the amplicon into account. Numbers at right are
nucleotides. (B) Agarose gel of control amplifications demonstrating
reverse transcriptase dependence. T.b, T. brucei; L.d,
L. donovani; T.v, T. vaginalis. Reverse
transcriptase (rt) M-pBR322 digest was present (+) or absent ( ).
Numbers at left are as defined for panel A.
|
|
Regulation of translation by the length of the 3' UTR has been
demonstrated for mammalian and plant cells (19, 20) in addition to the examples from T. brucei and L. donovani mentioned above. The results of the present study do not
exclude an effect of the length of the 3' UTR and/or poly(A) tail on
rates of translation of specific mRNAs. In fact, such an effect is
highly likely, as translation initiation seems to involve interaction
of translation initiation factors with both the 5' and 3' ends of
messages (11, 14). However, the results of this study
contradict the hypothesis that the length of the 3' UTR and/or poly(A)
tail has a role in controlling rates of translation for the specific
cases of GAPDH message in the three protists studied. The reason for
this is that, while rates of translation of the individual message
copies may vary (23, 24), the size distribution of the
combined 3' UTR and poly(A) tail did not vary under those conditions
that produced different translation rates.
 |
ACKNOWLEDGMENTS |
We thank M. Müller for critical reading of an earlier version
of the manuscript and S. Strickland for support and stimulating discussions.
This study was financed by grant 1 R29 AI34981 from the National
Institute of Allergy and Infectious Diseases to B. H. ter Kuile
and a minority supplement to F. Sallés on 2R01 GM5158405 to S. Strickland.
 |
FOOTNOTES |
*
Corresponding author. Present address: Leiden Institute
of Chemistry, Gorlaeus Laboratories, Leiden University, Einsteinweg 5/P.O. Box 9502, 2300 RA Leiden, The Netherlands. Phone: 31-71-5275272. Fax: 31-71-5274537. E-mail:
b.terkuile{at}chem.leidenuniv.nl.
 |
REFERENCES |
| 1.
|
Aly, R.,
M. Argaman,
S. Halman, and M. Shapira.
1994.
A regulatory role for the 5' and 3' untranslated regions in differential expression of hsp83 in Leishmania.
Nucleic Acids Res.
22:2922-2929[Abstract/Free Full Text].
|
| 2.
|
Beelman, C. A., and R. Parker.
1995.
Degradation of mRNA in eukaryotes.
Cell
81:179-183[CrossRef][Medline].
|
| 3.
|
Callens, M.,
D. A. Kuntz, and F. R. Opperdoes.
1991.
Kinetic properties of fructose bisphosphate aldolase from Trypanosoma brucei compared to aldolase from rabbit muscle and Staphylococcus aureus.
Mol. Biochem. Parasitol.
47:1-9[CrossRef][Medline].
|
| 4.
|
Caponigro, G., and R. Parker.
1996.
Mechanisms and control of mRNA turnover in Saccharomyces cerevisiae.
Microbiol. Rev.
60:233-249[Free Full Text].
|
| 5.
|
Furger, A.,
N. Schurch,
U. Kurath, and I. Roditi.
1997.
Elements in the 3' untranslated region of procyclin mRNA regulate expression in insect forms of Trypanosoma brucei by modulating RNA stability and translation.
Mol. Cell. Biol.
17:4372-4380[Abstract].
|
| 6.
|
Gray, N. K., and M. Wickens.
1998.
Control of translation initiation in animals.
Annu. Rev. Cell Dev. Biol.
14:399-458[CrossRef][Medline].
|
| 7.
|
Hotz, H. R.,
C. Hartmann,
K. Huober,
M. Hug, and C. Clayton.
1997.
Mechanisms of developmental regulation in Trypanosoma brucei: a polypyrimidine tract in the 3'-untranslated region of a surface protein mRNA affects RNA abundance and translation.
Nucleic Acids Res.
25:3017-3025[Abstract/Free Full Text].
|
| 8.
|
Hotz, H. R.,
P. Lorenz,
R. Fischer,
S. Krieger, and C. Clayton.
1995.
Role of 3'-untranslated regions in the regulation of hexose transporter mRNAs in Trypanosoma brucei.
Mol. Biochem. Parasitol.
75:1-14[CrossRef][Medline].
|
| 9.
|
Hug, M.,
V. B. Carruthers,
C. Hartmann,
D. S. Sherman,
G. A. Cross, and C. Clayton.
1993.
A possible role for the 3'-untranslated region in developmental regulation in Trypanosoma brucei.
Mol. Biochem. Parasitol.
61:87-95[CrossRef][Medline].
|
| 10.
|
Kleijn, M.,
G. C. Scheper,
H. O. Voorma, and A. A. Thomas.
1998.
Regulation of translation initiation factors by signal transduction.
Eur. J. Biochem.
253:531-544[Medline].
|
| 11.
|
McCarthy, J. E. G.
1998.
Posttranscriptional control of gene expression in yeast.
Microbiol. Mol. Biol. Rev.
62:1492-1553[Abstract/Free Full Text].
|
| 12.
|
Müller, M.
1988.
Energy metabolism of protozoa without mitochondria.
Annu. Rev. Microbiol.
42:465-488[CrossRef][Medline].
|
| 13.
|
Opperdoes, F. R.
1987.
Compartmentation of carbohydrate metabolism in trypanosomes.
Annu. Rev. Microbiol.
41:127-151[CrossRef][Medline].
|
| 14.
|
Pain, V. M.
1996.
Initiation of protein synthesis in eukaryotic cells.
Eur. J. Biochem.
236:747-771[Medline].
|
| 15.
|
Ross, J.
1995.
mRNA stability in mammalian cells.
Microbiol. Rev.
59:423-450[Abstract/Free Full Text].
|
| 16.
|
Sallés, F. J.,
W. G. Richards, and S. Strickland.
1999.
Assaying the polyadenylation state of mRNAs.
Methods
17:38-45[CrossRef][Medline].
|
| 17.
|
Sallés, F. J., and S. Strickland.
1995.
Rapid and sensitive analysis of mRNA polyadenylation states by PCR.
Genome Res.
4:317-321[Abstract/Free Full Text].
|
| 18.
|
Schurch, N.,
A. Furger,
U. Kurath, and I. Roditi.
1997.
Contributions of the procyclin 3' untranslated region and coding region to the regulation of expression in bloodstream forms of Trypanosoma brucei.
Mol. Biochem. Parasitol.
89:109-121[CrossRef][Medline].
|
| 19.
|
Tanguay, R. L., and D. R. Gallie.
1996.
The effect of the length of the 3'-untranslated region on expression in plants.
FEBS Lett.
394:285-288[CrossRef][Medline].
|
| 20.
|
Tanguay, R. L., and D. R. Gallie.
1996.
Translational efficiency is regulated by the length of the 3' untranslated region.
Mol. Cell. Biol.
16:146-156[Abstract].
|
| 21.
|
Ter Kuile, B. H.
1996.
Metabolic adaptation of Trichomonas vaginalis to growth rate and glucose availability.
Microbiology
142:3337-3345[Abstract].
|
| 22.
|
ter Kuile, B. H.
1997.
Adaptation of metabolic enzyme activities of Trypanosoma brucei promastigotes to growth rate and carbon regimen.
J. Bacteriol.
179:4699-4705[Abstract/Free Full Text].
|
| 23.
|
ter Kuile, B. H.
1999.
Regulation and adaptation of glucose metabolism of the parasitic protist Leishmania donovani at the enzyme and mRNA levels.
J. Bacteriol.
181:4863-4872[Abstract/Free Full Text].
|
| 24.
|
Ter Kuile, B. H., and Y. Bonilla.
1999.
Influence of growth conditions on RNA levels in relation to activity of core metabolic enzymes in the parasitic protists Trypanosoma brucei and Trichomonas vaginalis.
Microbiology
145:755-765[Abstract].
|
| 25.
|
Ter Kuile, B. H., and F. R. Opperdoes.
1991.
Chemostat cultures of Leishmania donovani promastigotes and Trypanosoma brucei procyclic trypomastigotes.
Mol. Biochem. Parasitol.
45:171-173[CrossRef][Medline].
|
| 26.
|
Veldkamp, H.
1976.
Continuous culture in microbial physiology and ecology.
Meadowfield Press, Durham, United Kingdom.
|
| 27.
|
Wickens, M.,
J. Kimble, and S. Strickland.
1996.
Translational control of developmental decisions, p. 411-450.
In
J. W. Hershey, et al. (ed.), Translational control. Cold Spring Harbor Laboratory Press, Plainview, N.Y.
|
| 28.
|
Zhao, J.,
L. Hyman, and C. Moore.
1999.
Formation of mRNA 3' ends in eukaryotes: mechanism, regulation, and interrelationships with other steps in mRNA synthesis.
Microbiol. Mol. Biol. Rev.
63:405-445[Abstract/Free Full Text].
|
Journal of Bacteriology, June 2000, p. 3587-3589, Vol. 182, No. 12
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.