Previous Article | Next Article 
Journal of Bacteriology, July 2000, p. 3688-3692, Vol. 182, No. 13
Department of Biochemistry, Virginia
Polytechnic Institute and State University, Blacksburg, Virginia
24061
Received 22 February 2000/Accepted 14 April 2000
Two putative malate dehydrogenase genes, MJ1425 and MJ0490, from
Methanococcus jannaschii and one from Methanothermus
fervidus were cloned and overexpressed in Escherichia
coli, and their gene products were tested for the ability to
catalyze pyridine nucleotide-dependent oxidation and reduction
reactions of the following The biosynthesis of the methanogenic
cofactors coenzyme M (2-mercaptoethanesulfonic acid),
methanopterin, coenzyme F420, and methanofuran c
(Fig. 1) requires the generation of an
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Identification of an Archaeal 2-Hydroxy Acid
Dehydrogenase Catalyzing Reactions Involved in Coenzyme Biosynthesis
in Methanoarchaea
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References
-hydroxy--keto acid pairs:
(S)-sulfolactic acid and sulfopyruvic acid;
(S)--hydroxyglutaric acid and -ketoglutaric acid;
(S)-lactic acid and pyruvic acid; and
1-hydroxy-1,3,4,6-hexanetetracarboxylic acid and
1-oxo-1,3,4,6-hexanetetracarboxylic acid. Each of these reactions is
involved in the formation of coenzyme M, methanopterin,
coenzyme F420, and methanofuran, respectively. Both the
MJ1425-encoded enzyme and the MJ0490-encoded enzyme were found to
function to different degrees as malate dehydrogenases, reducing
oxalacetate to (S)-malate using either NADH or NADPH as a
reductant. Both enzymes were found to use either NADH or NADPH to
reduce sulfopyruvate to (S)-sulfolactate, but the
Vmax/Km value for the
reduction of sulfopyruvate by NADH using the MJ1425-encoded enzyme
was 20 times greater than any other combination of enzymes and pyridine
nucleotides. Both the M. fervidus and the MJ1425-encoded enzyme catalyzed the NAD+-dependent oxidation of
(S)-sulfolactate to sulfopyruvate. The MJ1425-encoded
enzyme also catalyzed the NADH-dependent reduction of -ketoglutaric
acid to (S)-hydroxyglutaric acid, a component of
methanopterin. Neither of the enzymes reduced pyruvate to
(S)-lactate, a component of coenzyme F420. Only
the MJ1425-encoded enzyme was found to reduce
1-oxo-1,3,4,6-hexanetetracarboxylic acid, and this reduction occurred
only to a small extent and produced an isomer of
1-hydroxy-1,3,4,6-hexanetetracarboxylic acid that is not involved in
the biosynthesis of methanofuran c. We conclude that the MJ1425-encoded
enzyme is likely to be involved in the biosynthesis of both coenzyme M
and methanopterin.
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References
-hydroxy acid that either becomes a component in the final structure
or serves as an intermediate in the formation of the coenzyme. In the
case of coenzyme M, (S)-sulfolactate, formed from
phosphoenolpyruvate (PEP) and bisulfite, is an intermediate in the
biosynthesis (28-30). In the case of methanopterin
(24, 25) and several related modified folates (33, 34,
36), (S)-hydroxyglutaric acid (23) is
incorporated into the coenzyme during its biosynthesis (32,
35). For coenzyme F420 (6) and its
-polyglutamate derivatives (7, 8, 18),
(S)-hydroxypropionic acid (S-lactic acid)
becomes a part of the final structure. Finally, two
(1R)-diastereomers of
1-hydroxy-1,3,4,6-hexanetetracarboxylic acid (HHTCA) serve as
intermediates in the biosynthesis of the 1,3,4,6-hexanetetracarboxylic acid (HTCA) moiety of methanofuran (17; unpublished
results), and another diastereomer of HHTCA [(1S)-HHTCA]
is a component of methanofuran c (31). The HHTCA
intermediates in HTCA biosynthesis have the same absolute
stereochemistry at the -hydroxy acid portion of the molecule as the
pantothenic acid moiety of coenzyme A, the only other cofactor
containing an -hydroxy acid (10).
View larger version (26K):
[in a new window]
FIG. 1.
Methanogenic coenzymes that contain -hydroxy acids as
components of their structures. (S)-Sulfolactate is an
intermediate in the biosynthesis of coenzyme M, and
(S)-malate is an intermediate in the partial citric acid
cycle.
At present, nothing is known about the enzymes required for the
formation and the metabolism of these -hydroxy acids and -keto
acids in the methanoarchaea. Based on the S-stereochemistry of the (S)-hydroxyglutaric acid present in
methanopterin and the (S)-lactic acid present in
coenzyme F420, it is likely that each is formed by the
reduction of the corresponding -keto acid by a NAD(P)H-dependent
dehydrogenase related to the lactate/malate dehydrogenase group of
enzymes (1, 3, 9). Likewise, it could be argued, again based
on stereochemical grounds, that the oxidation of
(S)-sulfolactate to sulfopyruvate occurring during the
biosynthesis of coenzyme M could also be carried out by an enzyme
related to the lactate/malate dehydrogenases.
Two malate dehydrogenases, designated MdhI and MdhII, were recently
isolated from Methanobacterium thermoautotrophicum strain Marburg (22). Via the N-terminal sequences, the genes
encoding the malate dehydrogenases would correspond to those encoded
from the M. thermoautotrophicum (strain 
H) genes MT1205
and MT0188, respectively (22). From genomic sequence
data (21), the sequences of M. thermoautotrophicum genes MT1205 and MT0188 have 53.5 and 48.6%
sequence identity, respectively, to the Methanococcus
jannaschii genes MJ1425 and MJ0490 (2). In both of
these organisms, these are the only two genes with any clear sequence
homology to the lactate/malate family of dehydrogenases (2,
21). The M. jannaschii gene MJ0490,
producing the MdhII enzyme, has 49% sequence identity to the
(S)-lactate/malate dehydrogenases from bacteria and
eukaryotes (1, 9), and it aligns well with the
Archaeoglobus fulgidus AF0855-encoded malate dehydrogenase
(16). From many sequence comparisons and site-directed
mutagensis of members of this family of dehydrogenases, it could be
shown that the structure of the amino acid at one conserved position
can determine the substrate specificity and the coenzyme-binding
specificity (9). A sequence comparison of the MJ0490 gene
with those lactate/malate dehydrogenases would predict that the MJ0490
enzyme should prefer (S)-malate over
(S)-lactate and NADP over NAD. The MJ1425-encoded
enzyme, on the contrary, does not fit as well into the family of
lactate/malate dehydrogenases. The MJ1425-encoded enzyme has 44%
sequence identity with the malate dehydrogenases from the
methanoarchaea Methanothermus fervidus (12)
and the MTH1205-encoded enzyme mentioned above from M. thermoautotrophicum. The MJ1425-encoded enzyme has only 12%
sequence identity to a malate dehydrogenase from Bacillus subtilis.
It is not clear why the M. jannaschii and M. thermoautotrophicum genomes contain two genes for malate
dehydrogenases. Taking into account the lack of specificity of many of
the known dehydrogenases (3, 15, 37), we considered it
likely that one or more of these archaeal enzymes may be the enzyme(s)
used for producing one or more of the (S)--hydroxy acids
required for the biosynthesis of methanoarchaeal coenzymes.
To test these hypotheses, we have cloned and overexpressed the MJ0490 and MJ1425 genes from M. jannaschii and a malate dehydrogenase gene from M. fervidus in Escherichia coli and tested their protein products for the ability to reduce or oxidize desired coenzyme biosynthetic intermediates.
| |
MATERIALS AND METHODS |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References
|
|---|
Preparation of substrates.
The S and R
stereoisomers of sulfolactate were prepared by nitrous acid deamination
of (S)-cysteic acid and (R)-cysteic acid (M. Graupner and R. H. White, unpublished results). Sulfopyruvate was
prepared as previously described (29).
1-Oxo-1,3,4,6-hexanetetracarboxylic acid (KHTCA) was prepared by the
condensation of the dimethylketal derivative of -ketoglutarate with
the dimethyl ester of -bromoglutaric acid (Graupner and White,
unpublished results). The compound used as substrate consisted of a
racemic mixture of one part of erythro-KHTCA and two parts
of threo-KHTCA. Oxalacetate, pyruvate,
(S)-lactate, (S)-2-hydroxyglutaric acid, and
(R)-2-hydroxyglutaric acid were obtained from Sigma Chemical Co.
Identification, cloning, and high-level expression of the gene product. Expression of MJ1425 and MJ0490 genes in E. coli was accomplished by the following procedure. The MJ1425 and MJ0490 genes were amplified by PCR, using genomic DNA from M. jannaschii (David E. Graham, Urbana, Ill.) as the template. The primers, 5' CATGCATATGATTTTAAAACCAGAAAATGAA 3' and 5' GATCGGATCCTTATTCAATATAGTCCTCAAT 3' derived from the MJ1425 DNA sequence and primers 5' CATGCATATGAAAGTTACAATTATAGGAGC 3' and 5' GATCGGATCCTTATAAGTTTTTAACTTCTTC 3' derived from MJ0490 DNA sequence were used. The PCR products, purified via absorption and desorption to a Qia quick spin column, were digested with NdeI and BamHI and were cloned into NdeI-BamHI-digested pT7-7 plasmid vector to obtain the constructs pT7-7-MJ1425 and pT7-7-MJ0490. The constructs were transformed to E. coli TB1 for plasmid preparation and to E. coli BL21(DE3) for protein expression. The expression plasmid for the malate dehydrogenase from Methanothermus fervidus (12) was a generous gift from R. Hensel (University of Essen, Essen, Germany); it was treated in the same manner as the M. jannaschii gene containing plasmids. The cells of E. coli BL21(DE3) containing the pT7-7-MJ1425 or pT7-7-MJ0490 plasmid were incubated in Luria-Bertani (LB) medium supplemented with 100 mg of ampicillin per liter at 37°C to an absorbance at 600 nm of 1.0.
Protein production was then induced by the addition of isopropylthio-
-D-galactoside (IPTG) to a final
concentration of 0.1 mM, and the cells were grown for an additional
4 h at 37°C. The cells were harvested by centrifugation
(4,000 × g, 5 min) and were frozen at 
20°C until
used. High-level expression of the desired gene products was
confirmed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis
(SDS-PAGE) (12% polyacrylamide) of the SDS-soluble cellular proteins.
Preparation and analysis of cell extracts. Cell extracts were prepared by sonication of the cell pellets (~300 mg [wet weight]) suspended in 3 ml of buffer [50 mM N-tris(hydroxymethyl)methyl-2-aminoethanesulfonic acid (TES) (pH 7.0), 10 mM MgCl2, 20 mM mercaptoethanol] followed by centrifugation (14,000 × g, 10 min). SDS-PAGE analysis of the pellets and the cell extracts showed that most (>90%) of the overexpressed proteins were present in a soluble form. Heating the extracts at 80°C for 30 min followed by centrifugation (14,000 × g, 10 min) removed most of the E. coli proteins and left essentially pure solutions of the overexpressed proteins (95% pure). These solutions were used for the analyses reported here. The protein concentrations were determined with the Bio-Rad Protein Assay.
Measurement of enzymatic activities.
The activities of the
enzymes were measured spectrophotometrically at 366 nm at 70°C in
1-ml quartz cuvettes (12). The 366-nm wavelength was used so
that higher concentrations of reduced pyridine nucleotides could be
used. NADH and NADPH had molar absorptivities of 1,800 M
1
cm1 and 1,900 M1 cm1,
respectively, at 70°C at 366 nm. For the determination of the Km and Vmax values of the
various substrates, the 1.0-ml assay mixture contained 0.1 M potassium
phosphate (pH 8.0), 0.3 mM NADH or NADPH, and 0 to 8 mM concentrations
of the indicated substrates. Oxalacetate at 1 and 2 mM was used for the
determination of the Km and
Vmax of NADH and NADPH, respectively. The
reaction was started by the addition of 10 µl of a 1:10 dilution of
the protein solution (2 to 5 mg/ml; Bio-Rad Protein Assay), and the
time-dependent decrease in NADH/NADPH absorbance was monitored for 4 min. One unit of enzyme activity refers to 1 µmol of NADH or NADPH
oxidized per min.
Product identification.
The products of the
NADH/NADPH-dependent reductions of each of the substrates were
identified by gas chromatography-mass spectrometry (GC-MS). The general
procedure in each case was to incubate the enzyme with the substrates,
isolate the products, convert the products into suitable methyl ester
derivatives, and analyze them by GC-MS using a known sample as a
reference. In the case of the identification of sulfolactate, 100 µl
of a cell extract containing the protein encoded from gene MJ1425 was
mixed with 275 µl of 50 mM TES (pH 8.0) and incubated for 1 h at
50°C in the presence of 13 mM NADH and 6.7 mM sulfopyruvate. After
the addition of an equal volume of 95% ethanol, the sample was heated
for 5 min at 100°C and centrifuged (10 min, 14,000 × g) to produce a clear solution. After evaporation of the ethanol,
the residue was dissolved in 0.5 ml of water, passed through a Dowex
50-8X (H+) column (0.5 by 1.5 cm), and evaporated to
dryness. After the sample was dissolved in methanol (100 µl), an
ether solution of diazomethane (300 µl) was added which generated a
cloudy yellow color, and the sample was clarified by centrifugation
(5,000 × g, 5 min). The resulting separated clear
solution was then evaporated to dryness, dissolved in methylene
dichloride, and analyzed by GC-MS (29). The remaining
compounds were assayed as their methyl esters, as previously described
(13). The absolute stereochemistry of malate and
-hydroxyglutaric acid was established by GC-MS of their methyl ester
derivatives using a type G-TA Chiraldex column (0.25 mm by 40 m;
Advanced Separation Technologies Inc., Whippany, N.J.) programmed from
95 to 180°C at 3°C per min. GC-MS was used in these analyses so
that positive identification of the GC peaks could be established even
in the complex mixtures. Both of these samples gave very well separated
peaks that were easily assigned to the respective R and
S isomers.
| |
RESULTS AND DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References
|
|---|
Reactions catalyzed by the overproduced enzymes.
The
MJ1425-encoded enzyme, which we call MdhI, catalyzed the NADH-dependent
reduction of oxalacetate, -ketoglutarate, sulfopyruvate, and to a
much lower extent, 1-oxo-1,3,4,6-hexanetetracarboxylic acid (KHTCA)
(Table 1). The
Vmax/Km for reduction by
NADPH was less than 2% of those observed with NADH. The MJ0490-encoded
enzyme, which we call MdhII, catalyzed the reduction of only
oxalacetate and sulfopyruvate. Either NADH or NADPH serves as reductant
for these reactions, with NADPH being only marginally effective for the
MdhI catalyzing reduction of oxalacetate and -ketoglutarate. Based
on the measured Vmax/Km
for these different substrates and coenzymes, it is clear that the
NADH-dependent reduction of sulfopyruvate by the MJ1425-derived enzyme
is the most efficient reaction measured. The M. fervidus
MdhIII (MF-MdhIII) catalyzed only the reduction of oxalacetate and
sulfopyruvate. Like the MJ1425-encoded enzyme, this reduction
proceeds more efficiently with NADH than with NADPH. Although the
amino acid sequence of the M. fervidus enzyme is homologous to the MJ1425-encoded protein, this enzyme did not catalyze
the reduction of -ketoglutarate. Since the structure of the
methanopterin C1 carrier in M. fervidus
is not known, this finding may indicate that these cells simply do not
produce -hydroxyglutarate, since it is not needed for the
biosynthesis of their C1 carrier. Because of the
differences in the specificity of this enzyme compared with both the
MJ1425- and MJ0490-encoded enzymes, we are calling this enzyme MdhIII.
|
-hydroxyglutarate, and sulfolactate (Table 2). No reaction could be detected for the
(R)-sulfolactate and the
(R)--hydroxyglutaric acid, indicating that the
MJ1425-encoded enzyme oxidizes only the S isomers.
The MJ0490-encoded enzyme catalyzed the oxidation of
(S)-malate and (S)-sulfolactate (observed only in the presence of NADP), whereas the MF-Mdh catalyzed these reactions only in the presence of NAD. Again, the MF-malate
dehydrogenase
as we expected from its relationship to the
MJ1425-encoded enzymedid not accept
(S)--hydroxyglutarate as a substrate. (S)- and
(R)-lactate were not oxidized by any of the enzymes with NAD
or NADP.
|
-ketoglutarate
than for oxalacetate. Thus, MdhI can clearly produce the
(S)--hydroxyglutaric acid required for the biosynthesis
of methanopterin by the reduction of -ketoglutarate.
Sulfopyruvate was found to be reduced to sulfolactate by all of the
enzymes much more efficiently than oxalacetate (Table 1). Furthermore,
the reaction kinetics of the MJ1425-encoded enzyme and the MF-malate
dehydrogenase showed substrate inhibition at very low sulfopyruvate
concentrations (0.1 mM for both enzymes), as has been reported with
other malate dehydrogenases (14). This phenomenon has also
been observed with the malate dehydrogenase from ox heart mitochondria
but with oxalacetate used as the substrate (5). The malate
dehydrogenase from pig heart mitochondria has been shown to use
sulfopyruvate very poorly as substrate (26); the
Vmax/Km value was 460 times less than that for oxalacetate. Sulfolactate was not a substrate
for the chicken liver NADP-dependent malate enzyme but was in fact an
inhibitor (27). The MJ0490-encoded enzyme also prefers
sulfopyruvate as a substrate, but the differences of the
Vmax/Km values compared
to those for oxalacetate are not as pronounced as with the
MJ1425-encoded enzyme or the MF-malate dehydrogenase. In the
biosynthesis-relevant directionthat is, the oxidation of
(S)-sulfolactate to sulfopyruvate (30)only the
MJ1425-encoded enzyme and the MF-malate dehydrogenase were found to
oxidize (S)-sulfolactate using NAD as the oxidant, whereas the MJ0490-encoded enzyme prefered to oxidize (S)-malate
over (S)-sulfolactate using NADP (Table 2). None of the
enzymes catalyzed the oxidation of (R)-sulfolactate. These
results indicate the possible involvement of the MJ1425-encoded enzyme
and the MF MdhIII in the coenzyme M biosynthetic pathway and are
consistent with only the (S)-sulfolactate being an
intermediate in coenzyme M biosynthesis, as previously described
(30).
The MJ1425-encoded enzyme could carry out the reduction of the KHTCA
with NADH. Despite the fact that the high Km of
15 mM makes the reduction of questionable biochemical relevance, the GC-MS analysis of the produced isomer was shown to be
xylo-HHTCA, an isomer different from that involved in HTCA
biosynthesis (31). Considering the stereospecificity of the
MJ1425-encoded enzyme for the (S)-isomers (Table 2), the
isomer produced by the MJ1425-encoded enzyme could be assigned to
(S)-xylo-HHTCA. From these results, we conclude
that the naturally occurring isomers of HHTCA must be produced by an
enzyme that reduces the keto acid group to the hydroxy acid with
R stereochemistry, as opposed to the S
stereochemistry observed here. These results clearly demonstrate that
neither of these enzymes is involved in the biosynthesis of the HHTCA intermediates used in HTCA biosynthesis.
Pyruvate was found not to serve as a substrate for either enzyme with
either of the reduced pyridine nucleotides. Thus, the source of the
(S)-lactate present in coenzyme F420 is still
unknown. This finding could indicate that the lactate moiety of
F420 may arise by an alternate route, perhaps by the
reduction of PEP.
If the MJ1425-encoded enzyme is indeed involved in the biosynthesis of
these coenzymes, we may expect that this gene could be in a
cluster of other genes that are involved in the biosynthesis of the
coenzymes. In M. jannaschii, the MJ1425 gene is located within a group of genes that has no clear relationship to coenzyme biosynthesis. However, the homologous gene in M. thermoautotrophicum, MHT1205, is next to the recently established
sulfopyruvate decarboxylase genes MTH1206 and MTH1207 encoding
another enzyme involved in coenzyme M biosynthesis. This finding thus
establishes a genetic link of this gene to the biosynthesis of coenzyme M.
In conclusion, the data presented here are consistent with the idea
that the MdhI enzyme may participate in the biosynthesis of coenzyme M
and methanopterin by catalyzing the oxidation of sulfolactate
to sulfopyruvate in the biosynthetic pathway to coenzyme M and in
supplying -hydroxyglutarate for the biosynthesis of methanopterin. This enzyme would thus function in these cells in a multiple capacity, not only functioning as part of a NADPH:NAD transhydrogenase (22) but also supplying metabolites for the biosynthesis of coenzymes. This enzyme thus joins an established but
growing list of enzymes, such as hexokinase (4),
transaminases (20), fatty acid synthases, acetohydroxy acid
synthases (23a), nucleoside mono and diphosphate kinases
(19), and the AksA enzyme involved in the biosynthesis of
coenzyme B (13), that are able to catalyze more than one
metabolically essential reaction.
| |
ACKNOWLEDGMENT |
|---|
This work was supported in part by National Science Foundation grant MCB963086.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Biochemistry (0308), Virginia Polytechnic Institute and State University, Blacksburg, VA 24061. Phone: (540) 231-6605. Fax: (540) 231-9070. E-mail: rhwhite{at}vt.edu.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References
|
|---|
| 1. | Birktoft, J. J., R. T. Fernley, R. A. Bradshaw, and L. J. Banaszak. 1992. Amino acid sequence homology among the 2-hydroxy acid dehydrogenases: mitochondrial and cytoplasmic malate dehydrogenases from a homologous system with lactate dehydrogenase. Proc. Natl. Acad. Sci. USA 79:6166-6170. |
| 2. | Bult, C. J., O. White, G. J. Olsen, L. Zhou, R. D. Fleischmann, G. G. Sutton, J. A. Blake, L. M. FitzGerald, R. A. Clayton, J. D. Gocayne, A. R. Kerlavage, B. A. Dougherty, J.-F. Tomb, M. D. Adams, C. I. Reich, R. Overbeek, E. F. Kirkness, K. G. Weinstock, J. M. Merrick, A. Glodek, J. L. Scott, N. S. M. Geoghagen, J. F. Weidman, J. L. Fuhrmann, D. Nguyen, T. R. Utterback, J. M. Kelley, J. D. Peterson, P. W. Sadow, M. C. Hanna, M. D. Cotton, K. M. Roberts, M. A. Hurst, B. P. Kaine, M. Borodovsky, H.-P. Klenk, C. M. Fraser, H. O. Smith, C. R. Woese, and J. C. Venter. 1996. Complete genome sequence of the methanogenic archaeon, Methanococcus jannaschii. Science 273:1058-1073[Abstract]. |
| 3. | Bur, D., M. A. Lutaen, H. Wynn, L. R. Provencher, J. B. Jones, M. Gold, J. D. Friesen, A. R. Clark, and J. J. Holbrook. 1989. An evaluation of the substrate specificity and asymmetric synthesis potential of the cloned L-lactate dehydrogenase from Bacillus stearothermophilus. Can. J. Chem. 67:1065-1070[CrossRef]. |
| 4. | Crane, R. K. 1962. Hexokinases and pentokinases, p. 47-66. In P. D. Boyer, H. Lardy, and K. Myrback (ed.), The enzymes, vol. 6. Academic Press, New York, N.Y. |
| 5. | Davies, D., and E. Kun. 1957. Isolation and properties of malic dehydrogenase from ox-heart mitochondria. Biochem. J. 1957:307-316. |
| 6. | Eirich, L. D., G. D. Vogels, and R. S. Wolfe. 1978. Proposed structure of coenzyme F420 from Methanobacterium. Biochemistry 17:4583-4593[CrossRef][Medline]. |
| 7. | Gorris, L. G. M., C. van der Drift, and G. D. Vogels. 1988. Separation and quantification of cofactors from methanogenic bacteria by high-performance liquid chromatography: optimum and routine analyses. J. Microbiol. Methods 8:175-190[CrossRef]. |
| 8. | Gorris, L. G. M., and C. van der Drift. 1994. Cofactor contents of methanogenic bacteria reviewed. Biofactors 4:139-145[Medline]. |
| 9. | Goward, C. R., and D. J. Nicholls. 1994. Malate dehydrogenase: a model for structure, evolution, and catalysis. Protein Sci. 3:1883-1888[Medline]. |
| 10. | Hill, R. K., and T. H. Chan. 1970. The absolute configuration of pantothenic acid. Biochem. Biophys. Res. Commun. 38:181-183[CrossRef][Medline]. |
| 11. |
Hohorst, J. J.
1963.
L-()-Malate determination with malate dehydrogenase and DPN, p. 328-332.
In
H.-U. Bergmeyer (ed.), Methods of enzymatic analysis. Academic Press, New York, N.Y.
|
| 12. | Honka, E., S. Fabry, T. Niermann, P. Palm, and R. Hensel. 1990. Properties and primary structure of the L-malate dehydrogenases from the extremely thermophilic archaebacterium Methanothermus fervidus. Eur. J. Biochem. 188:623-632[Medline]. |
| 13. |
Howell, D. M.,
K. Harich,
H. Xu, and R. H. White.
1998.
The -keto acid chain elongation reactions involved in the biosynthesis of coenzyme B (7-mercaptoheptanoylthreonine phosphate) in methanogenic Archaea.
Biochemistry
37:10108-10117[CrossRef][Medline].
|
| 14. | Kagawa, T., and P. L. Bruno. 1988. NADP-malate dehydrogenase from leaves of Zea mays: purification and physical, chemical and kinetic properties. Arch. Biochem. Biophys. 260:674-695[CrossRef][Medline]. |
| 15. | Kim, M.-J., and G. M. Whitesides. 1988. L-Lactate dehydrogenase: substrate specificity and use as a catalyst in the synthesis of homochiral 2-hydroxy acids. J. Am. Chem. Soc. 110:2959-2964[CrossRef]. |
| 16. | Langelandsvik, A. S., I. H. Steen, N. K. Birkeland, and T. Lien. 1997. Properties and primary structure of a thermostable L-malate dehydrogenase from Archaeoglobus fulgidus. Arch. Microbiol. 168:59-67[CrossRef][Medline]. |
| 17. | Leigh, J. A., L. L. Reinhart, Jr., and R. S. Wolfe. 1984. Structure of methanofuran, the carbon dioxide reduction factor of Methanobacterium thermoautotrophicum. J. Am. Chem. Soc. 106:3636-3640[CrossRef]. |
| 18. |
Lin, X., and R. H. White.
1986.
Occurrence of coenzyme F420 and its -monoglutamyl derivative in nonmethanogenic archaebacteria.
J. Bacteriol.
168:444-448 |
| 19. | Parks, R. E., Jr., and R. P. Agarwal. 1973. Nucleoside diphosphokinases, p. 307-333. In P. D. Boyer (ed.), The enzymes, 3d ed., vol. VIII. Academic Press, New York, N.Y. |
| 20. | Pittard, A. J. 1996. Biosynthesis of the aromatic amino acids, p. 458-484. In F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed., vol. 1. American Society for Microbiology, Washington, D.C. |
| 21. |
Smith, D. R.,
L. A. Doucette-Stamm,
C. Deloughery,
H. Lee,
J. Dubois,
T. Aldredge,
R. Bashirzadeh,
D. Blakely,
R. Cook,
K. Gilbert,
D. Harrison,
L. Hoang,
P. Keagle,
W. Lumm,
B. Potheir,
D. Qiu,
R. Spadafora,
R. Vicaire,
Y. Wang,
J. Wierzbowski,
R. Gibson,
N. Jiwani,
A. Caruso,
D. Bush,
H. Safer,
D. Patwell,
S. Prabhakar,
S. McDougall,
G. Shimer,
A. Goyal,
S. Pietrokovski,
G. M. Church,
C. J. Daniels,
J. Mao,
P. Rice,
J. Nölling, and J. N. Reeve.
1997.
Complete genome sequence of Methanobacterium thermoautrophicum.
J. Bacteriol.
179:7135-7155 |
| 22. | Thompson, H., A. Tersteegen, R. K. Thauer, and R. Hedderich. 1998. Two malate dehydrogenases in Methanobacterium thermoautotrophicum. Arch. Microbiol. 170:38-42[CrossRef][Medline]. |
| 23. | Thurston-Solow, B., and R. H. White. 1997. The absolute stereochemistry of 2-hydroxyglutaric acid present in methanopterin. Chirality 9:678-680[CrossRef]. |
| 23a. | Umbarger, H. E. 1996. Biosynthesis of branched-chain amino acids, p. 442-457. In F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed., vol. 1. American Society for Microbiology, Washington, D.C. |
| 24. | Van Beelen, P., A. P. M. Strassen, J. W. G. Bosch, G. D. Vogels, W. Guijt, and C. A. G. Haasnoot. 1984. Elucidation of the structure of methanopterin, a coenzyme from Methanobacterium thermoautotrophicum, using two-dimensional nuclear-magnetic-resonance techniques. Eur. J. Biochem. 138:563-571[Medline]. |
| 25. | Van Beelen, P., J. F. A. Labro, J. T. Labro, J. T. Keltjens, W. J. Geerts, G. D. Vogels, W. H. Laarhoven, and C. A. G. Haasnoot. 1984. Derivatives of methanopterin, a coenzyme involved in methanogenesis. Eur. J. Biochem. 139:359-365[Medline]. |
| 26. |
Weinstein, C. L., and O. W. Griffith.
1986.
-Sulfopyruvate: chemical and enzymatic syntheses and enzymatic assay.
Anal Biochem.
156:154-160[CrossRef][Medline].
|
| 27. |
Weinstein, C. L., and O. W. Griffith.
1988.
Cysteinesulfonate and -sulfopyruvate metabolism: partitioning between decarboxylation, transamination, and reduction pathways.
J. Biol. Chem.
263:3735-3743 |
| 28. | White, R. H. 1985. Biosynthesis of coenzyme M (2-mercaptoethanesulfonic acid). Biochemistry 24:6487-6493[CrossRef]. |
| 29. | White, R. H. 1986. Intermediates in the biosynthesis of coenzyme M (2-mercaptoethanesulfonic acid). Biochemistry 25:5304-5308[CrossRef]. |
| 30. | White, R. H. 1988. Characterization of the enzymatic conversion of sulfopyruvate and L-cysteine into coenzyme M (mercaptoethanesulfonic acid). Biochemistry 27:7458-7462[CrossRef]. |
| 31. | White, R. H. 1988. Structural diversity in the methanofuran from different methanogenic bacteria. J. Bacteriol. 170:4544-4597. |
| 32. | White, R. H. 1990. Biosynthesis of methanopterin. Biochemistry 29:5397-5404[CrossRef][Medline]. |
| 33. | White, R. H. 1993. Structure of the modified folates in the thermophilic archaebacteria Pyrococcus furiosus. Biochemistry 32:745-753[CrossRef][Medline]. |
| 34. |
White, R. H.
1993.
Structures of the modified folates in the extremely thermophilic archaebacteria Thermococcus litoralis.
J. Bacteriol.
175:3661-3663 |
| 35. | White, R. H. 1996. Biosynthesis of methanopterin. Biochemistry 35:3447-3456[CrossRef][Medline]. |
| 36. | White, R. H. 1997. Structural characterization of modified folates in Archaea. Methods Enzymol. 281:391-401[Medline]. |
| 37. | Wilks, H. M., D. J. Halsall, T. Atkinson, W. N. Chia, A. R. Clarke, and J. J. Holbook. 1990. Designs for a broad substrate specificity keto acid dehydrogenase. Biochemistry 29:8587-8591[CrossRef][Medline]. |
Journal of Bacteriology, July 2000, p. 3688-3692, Vol. 182, No. 13
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Krishnakumar, A. M., Sliwa, D., Endrizzi, J. A., Boyd, E. S., Ensign, S. A., Peters, J. W.
(2008). Getting a Handle on the Role of Coenzyme M in Alkene Metabolism. Microbiol. Mol. Biol. Rev.
72: 445-456
[Abstract] [Full Text] -
Mashhadi, Z., Zhang, H., Xu, H., White, R. H.
(2008). Identification and Characterization of an Archaeon-Specific Riboflavin Kinase. J. Bacteriol.
190: 2615-2618
[Abstract] [Full Text] -
Grochowski, L. L., Xu, H., White, R. H.
(2006). Identification of Lactaldehyde Dehydrogenase in Methanocaldococcus jannaschii and Its Involvement in Production of Lactate for F420 Biosynthesis.. J. Bacteriol.
188: 2836-2844
[Abstract] [Full Text] -
Chistoserdova, L., Rasche, M. E., Lidstrom, M. E.
(2005). Novel Dephosphotetrahydromethanopterin Biosynthesis Genes Discovered via Mutagenesis in Methylobacterium extorquens AM1. J. Bacteriol.
187: 2508-2512
[Abstract] [Full Text] -
Ownby, K., Xu, H., White, R. H.
(2005). A Methanocaldococcus jannaschii Archaeal Signature Gene Encodes for a 5-Formaminoimidazole-4-carboxamide-1-{beta}-D-ribofuranosyl 5'-Monophosphate Synthetase: A NEW ENZYME IN PURINE BIOSYNTHESIS. J. Biol. Chem.
280: 10881-10887
[Abstract] [Full Text] -
Rein, U., Gueta, R., Denger, K., Ruff, J., Hollemeyer, K., Cook, A. M.
(2005). Dissimilation of cysteate via 3-sulfolactate sulfo-lyase and a sulfate exporter in Paracoccus pantotrophus NKNCYSA. Microbiology
151: 737-747
[Abstract] [Full Text] -
Muramatsu, H., Mihara, H., Kakutani, R., Yasuda, M., Ueda, M., Kurihara, T., Esaki, N.
(2005). The Putative Malate/Lactate Dehydrogenase from Pseudomonas putida Is an NADPH-dependent {Delta}1-Piperideine-2-carboxylate/{Delta}1-Pyrroline-2-carboxylate Reductase Involved in the Catabolism of D-Lysine and D-Proline. J. Biol. Chem.
280: 5329-5335
[Abstract] [Full Text] -
Caccamo, M. A., Malone, C. S., Rasche, M. E.
(2004). Biochemical Characterization of a Dihydromethanopterin Reductase Involved in Tetrahydromethanopterin Biosynthesis in Methylobacterium extorquens AM1. J. Bacteriol.
186: 2068-2073
[Abstract] [Full Text] -
Rasche, M. E., Havemann, S. A., Rosenzvaig, M.
(2004). Characterization of Two Methanopterin Biosynthesis Mutants of Methylobacterium extorquens AM1 by Use of a Tetrahydromethanopterin Bioassay. J. Bacteriol.
186: 1565-1570
[Abstract] [Full Text] -
Li, H., Xu, H., Graham, D. E., White, R. H.
(2003). The Methanococcus jannaschii dCTP Deaminase Is a Bifunctional Deaminase and Diphosphatase. J. Biol. Chem.
278: 11100-11106
[Abstract] [Full Text] -
Scott, J. W., Rasche, M. E.
(2002). Purification, Overproduction, and Partial Characterization of {beta}-RFAP Synthase, a Key Enzyme in the Methanopterin Biosynthesis Pathway{dagger}. J. Bacteriol.
184: 4442-4448
[Abstract] [Full Text] -
Graham, D. E., Xu, H., White, R. H.
(2002). Identification of Coenzyme M Biosynthetic Phosphosulfolactate Synthase. A NEW FAMILY OF SULFONATE-BIOSYNTHESIZING ENZYMES. J. Biol. Chem.
277: 13421-13429
[Abstract] [Full Text] -
Graupner, M., Xu, H., White, R. H.
(2002). New Class of IMP Cyclohydrolases in Methanococcus jannaschii. J. Bacteriol.
184: 1471-1473
[Abstract] [Full Text] -
Graupner, M., White, R. H.
(2001). Methanococcus jannaschii Generates L-Proline by Cyclization of L-Ornithine. J. Bacteriol.
183: 5203-5205
[Abstract] [Full Text] -
Graupner, M., Xu, H., White, R. H.
(2000). Identification of the Gene Encoding Sulfopyruvate Decarboxylase, an Enzyme Involved in Biosynthesis of Coenzyme M. J. Bacteriol.
182: 4862-4867
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»