Previous Article | Next Article 
Journal of Bacteriology, July 2000, p. 3754-3760, Vol. 182, No. 13
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Marinomonas mediterranea MMB-1 Transposon
Mutagenesis: Isolation of a Multipotent Polyphenol Oxidase
Mutant
Francisco
Solano,1
Patricia
Lucas-Elío,2
Eva
Fernández,1 and
Antonio
Sanchez-Amat2,*
Department of Biochemistry and Molecular
Biology B1 and Department of Genetics
and Microbiology,2 University of Murcia,
30100 Murcia, Spain
Received 5 January 2000/Accepted 18 April 2000
 |
ABSTRACT |
Marinomonas mediterranea is a melanogenic marine
bacterium expressing a multifunctional polyphenol oxidase
(PPO) able to oxidize substrates characteristic for laccases and
tyrosinases, as well as produce a classical tyrosinase. A new and quick
method has been developed for screening laccase activity in culture
plates to detect mutants differentially affected in this PPO activity. Transposon mutagenesis has been applied for the first time to M. mediterranea by using different minitransposons loaded in
R6K-based suicide delivery vectors mobilizable by conjugation. Higher
frequencies of insertions were obtained by using mini-Tn10
derivatives encoding kanamycin or gentamycin resistance. After applying
this protocol, a multifunctional PPO-negative mutant was obtained. By
using the antibiotic resistance cassette as a marker, flanking regions
were cloned. Then the wild-type gene was amplified by PCR and was
cloned and sequenced. This is the first report on cloning and
sequencing of a gene encoding a prokaryotic enzyme with laccase
activity. The deduced amino acid sequence shows the characteristic
copper-binding sites of other blue copper proteins, including fungal
laccases. In addition, it shows some extra copper-binding sites that
might be related to its multipotent enzymatic capability.
 |
INTRODUCTION |
Melanins are dark-colored
polyphenolic pigments synthesized by different organisms through the
entire phylogenetic scale, from bacteria to mammals. In higher
organisms and some bacteria, such as Streptomyces and
Rhizobium, melanin is made by using L-tyrosine as a precursor and tyrosinase as the key enzyme (EC 1.14.18.1). This
enzyme catalyzes two reactions (31): ortho hydroxylation of
L-tyrosine (cresolase activity) into L-dopa and
its subsequent oxidation to yield L-dopaquinone
(catecholase activity). After formation of this o-quinone,
the pathway can proceed spontaneously since that quinonic compound is
very reactive, and it undergoes a series of reactions involving
oxidation, isomerization, and polymerization that lead to the final
melanin pigment.
Tyrosinases are polyphenol oxidases (PPOs) that belong to the group of
nonblue copper proteins. The other important group of PPOs are the
blue-copper proteins named laccases (EC 1.10.3.2) since their first
description was in the lacquer tree (42). Laccases are
multicopper proteins characterized by the presence in the molecule of
three different types of copper (28), whereas tyrosinases
only have a pair of type III coppers. Experimentally, tyrosinases and
laccases have been classically differentiated on the basis of substrate
specificity and sensitivity to inhibitors, although they are able to
oxidize an overlapping range of diphenolic compounds. The most
important difference is that only tyrosinases show cresolase activity
and only laccases are able to oxidize methoxy-activated phenols such as
syringaldazine (40).
In fact, laccases have been found abundantly distributed in plants and
numerous fungi, where its involvement in melanin formation and a
variety of different, and sometimes contradictory, physiological functions has been frequently proposed (40). In bacteria,
laccase activity has been rarely described. It was described for the
first time in Azospirillum lipoferum (19) and
more recently in two marine bacteria, Marinomonas
mediterranea and strain 2-40 (37). Strikingly, laccase
activity in these marine strains is due to a unique multifunctional PPO
that shows not only laccase but also tyrosinase activity.
M. mediterranea is a melanogenic bacterium recently isolated
from the Mediterranean Sea (36, 37). It is the first
prokaryotic cell found to show tyrosinase and laccase activities, since
it contains two different PPOs. One of them appears to be a classical sodium dodecyl sulfate (SDS)-activated tyrosinase, similar to some
eukaryotic tyrosinases (29, 41). The other PPO is a
multipotent enzyme able to oxidize a wide range of substrates
characteristic for both tyrosinases and laccases (34). This
enzyme has been partially purified and characterized as a blue
multicopper membrane-bound protein (18).
It has also been found that tyrosinase and laccase are simultaneously
expressed in some fungi (23), and different isozymes of
these PPOs are present in numerous species (16, 25). It is
assumed that tyrosinase is involved in melanin synthesis and laccase is
involved in other cellular processes such as formation of fruiting
bodies, sexual differentiation, and lignolysis. However, the functions
of each enzyme have never been well delimited.
The unique characteristics of M. mediterranea PPOs made us
think that it would be an interesting model with which to gain knowledge on the physiological roles of tyrosinases and laccases. Due
to the overlapping substrate specificities and a series of common
features (enzymatic copper proteins, etc.), the classical methods for
protein purification are not enough to unambiguously distinguish the
function and properties of each enzyme; therefore, molecular techniques
are necessary. Unlike chemical mutagenesis, transposon-generated
mutations determine gene disruption, being very powerful tools for the
genetic analysis of bacteria (7, 13). So far, those
molecular techniques have been rarely applied to marine bacteria. To
our knowledge, transposon mutagenesis has been applied to members of
the genus Vibrio (6) and to a
Pseudomonas strain (1, 39), but there is no
report on its application to the genus Alteromonas or
Marinomonas. In this paper, we describe the development of
transposon mutagenesis for M. mediterranea. This technique
has allowed us to obtain a mutant strain affected in the multipotent
PPO and to clone the gene encoding this enzyme.
 |
MATERIALS AND METHODS |
Strains, plasmids, and media.
The bacterial strains and
plasmids used in this study are listed in Table
1. Inorganic salts to prepare buffers and
culture media were obtained from Merck (Darmstadt, Germany). Peptones and yeast extract were from Oxoid Ltd. (Basingstoke, England). All
substrates for the enzymatic assays and the antibiotics were from Sigma
Chemical Co. (St. Louis, Mo.), except 2,6-dimethoxyphenol (DMP), which
was from Fluka Chemie (Bucks, Switzerland). Escherichia coli
strains were grown in Luria-Bertani (LB) medium (33). When required, this medium was supplemented with the appropriate antibiotic.
M. mediterranea was usually grown in marine broth, Agar 2216 (Difco), or several marine media (complex MMC, DIC, and minimal
MMM).
MMC has been previously described (
18). DIC is a
modification
of MMC in which no Mg
2+ was added to allow
detection of tetracycline resistance. This
medium contained per liter:
30 g of NaCl, 4 g of Na
2SO
4, 0.7 g
of KCl, 1.25 g of CaCl
2, 75 mg of
K
2HPO
4, 100 mg of iron citrate,
5 g of
peptone, and 1 g of yeast extract. MMM is a chemically
defined
medium containing, per liter, 20 g of NaCl, 7 g of
MgSO
4 7H
2O, 5.3 g of MgCl
2
5H
2O, 0.7 g of KCl, 1.25 g of CaCl
2,
25 mg
of FeSO
4 7H
2O, 5 mg of CuSO
4
5H
2O, 75 mg of K
2HPO
4, 2 g of
sodium
glutamate, and 6.1 g of Tris base. The media were adjusted
to
pH 7.4.
Conjugation and transposon mutagenesis.
Plasmids containing
different transposons were mobilized from donor E. coli
S17-1 (
pir) into M. mediterranea by conjugation. Usually,
the spontaneous rifampicin-resistant (Rifr) M. mediterranea MMB-1R was used, so that antibiotic was added to MMC
to counterselect E. coli. It was also possible to
counterselect E. coli by growing the cells in MMM. Donor and
recipient strains were grown overnight in LB and MMC media,
respectively, with appropriate antibiotics for plasmid and transposon
resistance markers. Then, both strains were reinoculated into fresh
media without antibiotics and were allowed to reach the exponential
phase of growth. Conjugation was performed on the surface of an agar
plate. Several media were assayed: LB with 15 g of NaCl per liter,
marine agar 2216, and LB2216, obtained by mixing equal amounts of the
previous two media. A 40-µl sample of the exponentially growing
recipient cells was spotted on the surface of the plate and allowed to
dry before 40 µl of the donor E. coli was added onto the
previous spot. Controls with only M. mediterranea or
E. coli were also carried out. The plates were incubated
overnight and then cells were collected by scraping and were suspended
in 1 ml of MMC. Appropriate dilutions were plated on selective media. A
second antibiotic to which the transposon or plasmid encoded resistance
was also included. A series of preliminary experiments were performed
to establish optimal antibiotic concentrations for M. mediterranea.
Total numbers of recipient cells were calculated by plating the
conjugation suspension in MMC with rifampicin (50 µg/ml).
Transposition frequencies were calculated as the ratio of recipient
cells expressing transposon-encoded antibiotic resistance versus
the
total number of cells. In order to check the stability of
the delivery
vector in the recipient cell, cellular suspensions
were also plated in
media containing the plasmid
marker.
Southern blot analysis and probe labeling.
Chromosomal DNA
was extracted from several independent transconjugants:
Rifr, ampicillin-sensitive (Amps),
gentamycin-resistant (Gmr), or kanamycin-resistant
(Kmr) M. mediterranea obtained after the
E. coli S17-1 (
pir) (pBSL182) or (pLBT) × M. mediterranea MMB-1R matings. Southern blot analysis was carried
out after digesting these samples with different restriction enzymes. A
0.9-kb SacI fragment of pBSL182 or a NotI
fragment of pLBT encompassing the genes coding for antibiotic
resistances was used as a digoxigenin-labeled probe.
Probes encoding tyrosinases from
Rhizobium meliloti
(
27) or
Streptomyces (
21) or PM1
laccase (
9) were labeled with
[

-
32P]ATP by
using random primers (Boehringer radiolabeling kit) to
explore possible
homologue genes.
ppoA was also labeled in the
same way for
use as a probe in Northern blotting. RNA was isolated
from
M. mediterranea cultures in exponential and early stationary
phase by
centrifugation in
CsCl.
Screening for mutants affected in PPO activity.
M.
mediterranea mutants affected in melanization were detected by
visually inspecting the pigmentation of the surviving colonies in
complex medium (MMC). Mutants in laccase activity were detected in
0.5% agarose plates containing 2 mM DMP in 0.1 M sodium phosphate buffer, pH 5. Surviving microorganisms were allowed to grow for 3 or 4 days and were then replicated by using a toothpick in DMP and MMC
plates. Laccase activity was detected by the quick appearance of a
bright orange color in the DMP plate.
Cloning of the transposon-interrupted and complete
ppoA genes from M. mediterranea.
Isolated
genomic DNA of M. mediterranea Tn101 was digested with
SphI and ligated to pUC19 digested with the same enzyme. The ligation mixture was transformed in E. coli DH5
, and
transformants were selected for ampicillin and gentamycin resistance.
The plasmid obtained (LB1) was subcloned in pBluescript KS II by using
the SacI restriction sites that the transposon has close to
both IS10 sequence edges and XhoI or
KpnI restriction sites in the M. mediterranea chromosomic DNA. The DNA adjacent to the insertion point was sequenced by using the forward and reverse M13 universal primers.
The complete
ppoA gene was amplified from the chromosome of
wild-type
M. mediterranea by PCR by using the proofreading
Pfu DNA polymerase (Stratagene) and the primers MFEF
(forward), TTGAAGCTTCCATAGACAGCAATCTAAC,
and MFER (reverse),
TTTGAATTCATGCACCAGTCTGCTT, designed from the
LB1 plasmid
sequence. These oligonucleotides respectively incorporated
cloning
HindIII and
EcoRI restriction sites. PCR
consisted of
25 cycles of 95°C for 45 s, 61°C for 1 min, and
72°C for 6 min
15 s. The mixture contained 5%
dimethylsulfoxide, 1 µg of each
primer, and 100 ng of template DNA.
After digestion of the amplified
product with the mentioned enzymes, it
was cloned in pUC19, yielding
a plasmid with an insert of approximately
2.2
kb.
Enzymatic determinations in cell extracts and gel
electrophoresis.
Total cell extracts, membrane, and soluble
fractions were prepared as previously described (18).
Tyrosine hydroxylase and dopa oxidase activities were determined by
monitoring the respective oxidations of 2 mM L-tyrosine and
L-dopa at 475 nm in 0.1 M phosphate buffer, pH 5.0. For
tyrosine hydroxylase activity, 25 µM L-dopa was added to
the assay mixture to eliminate the lag period (37). When
required, the activities were also assayed in the presence of 0.02%
SDS. Dimethoxyphenol oxidase and syringaldazine oxidase activities were
respectively determined by monitoring the oxidation of 2 mM DMP at 468 nm in 0.1 M sodium phosphate buffer, pH 5.0, or the oxidation of 50 µM syringaldazine at 525 nm, pH 6.5 (36). Reference
cuvettes always had the same composition except for the enzymatic
extract. In all cases, 1 U was defined as the amount of enzyme that
catalyzes the appearance of 1 µmol of product per min at 37°C.
Specific activities were normalized by milligram of protein, measured
by using the bicinchoninic acid kit (Pierce Europe). Polyacrylamide
electrophoresis under nondissociating conditions and subsequent
specific PPO gel staining using L-dopa in the presence or
absence of SDS were performed as previously described (36).
Nucleotide sequence accession number.
The nucleotide
sequence of the ppoA gene of M. mediterranea
reported in this paper has been submitted to GenBank and assigned accession number AF184209.
 |
RESULTS |
Laccase activity detection and transposon mutagenesis in M. mediterranea.
In a previous report, we communicated that
amelanotic M. mediterranea mutants selected after
nitrosoguanidine treatment were specifically affected in the
SDS-activated tyrosinase activities (36). We were also
interested in obtaining complementary mutants affected in the
multipotent laccase-like PPO, the second PPO that this microorganism
seemed to contain. Different methods were assayed in order to simplify
the detection of this enzymatic activity. The addition to the culture
plates of laccase substrates, such as guaiacol, did not allow the
detection of this activity, mainly because the appearance of dark
bacterial melanin hindered the observation of the expected
yellowish-colored product resulting from laccase action on that
substrate. However, laccase activity could be easily detected by taking
part of a colony with a toothpick and picking it in a 0.5% agarose
plate containing 2 mM DMP. Under these conditions, the wild-type
M. mediterranea, as well as the amelanotic mutant strain
ng56 (36), yielded a bright orange color. The applicability
of this method to detect null-laccase mutants was checked by submitting
M. mediterranea to nitrosoguanidine mutagenesis. It was
observed that it could be possible to isolate mutants, such as ngd67,
with a phenotype complementary to strain ng56. That is, they produced
melanins but did not show laccase activity.
We approached the problem of cloning the gene by transposon
mutagenesis. As this technique has not been previously reported
for
study of the genus
Marinomonas, different transposons and
delivery vectors were assayed. The conditions of conjugation between
E. coli S-17 and
M. mediterranea were optimized
by using plasmids
pKT230 and pSUP102Gm. These plasmids contain the
mob region from
plasmid RP4 and the p15 origin of
replication. They could be mobilized
at high frequencies and were able
to replicate in
M. mediterranea (Table
2). At 25°C, the mixed LB2216 medium
yielded higher conjugation
frequencies than cultures at 37°C or other
media, so these conditions
were selected for conjugation experiments.
Plasmids containing the
ori R6K behaved as true suicidal
vectors in
M. mediterranea. Thus, several plasmid
derivatives containing
mini-Tn
5 (
4,
13) and
mini-Tn
10 (
3,
21) were tested (Table
2).
Mini-Tn
10 derivatives yielded higher exconjugant frequencies
than mini-Tn
5, although the antibiotic marker also affected
that
parameter. The best transposition results were obtained with
kanamycin
and gentamycin as resistance
markers.
Chromosomal DNA was extracted from several independent transconjugants
of
M. mediterranea obtained after the
E. coli
S17-1
(

pir) (pBSL182) or (pLBT) ×
M. mediterranea
MMB-1R matings. Southern
blot analyses were carried out by using
the genes coding for antibiotic
resistance as probes. A single band of
different sizes was observed
in each one, indicating that a single,
random insertion event
took place (data not
shown).
Several thousand exconjugants obtained by using plasmid pBSL182,
pLOFKm, or pLBT were inspected for the formation of dark-pigmented
melanized colonies and for their capacity to oxidize DMP. One
mini-Tn
10 mutant affected in the oxidation of DMP was
detected,
although we were unable to detect any amelanotic mutants.
This
mutant was obtained by using plasmid pBSL182, and hence, it was
Gm
r. It was denominated
M. mediterranea
Tn
101, and it was phenotypically
very similar to
nitrosoguanidine mutant ngd67. Consistent with
the qualitative tests
used for mutant detection, the enzymatic
oxidase assays indicated that
both strains retained soluble SDS-activated
tyrosinase activities, but
they were affected in membrane-bound
multipotent PPO activity (Table
3). In addition, when cellular
extracts
of wild-type
M. mediterranea and mutant strain Tn101
were subject to polyacrylamide gel electrophoresis under
nondissociating
conditions (
36), it was observed that the
mutant strain retained
the SDS-activated tyrosinase while the broad
band corresponding
to the membrane-bound PPO was lost (Fig.
1).
View this table:
[in this window]
[in a new window]
|
TABLE 3.
Specific activities (milliunits per milligram) in the
soluble and membrane fractions of cell extracts from wild-type and
mutant M. mediterranea strains
|
|

View larger version (95K):
[in this window]
[in a new window]
|
FIG. 1.
Electrophoretic analysis of the PPO activity in
wild-type (wt) M. mediterranea and mutant strain Tn101.
Polyacrylamide gels (10%) were run under nondissociating conditions
and were stained for dopa oxidase activity in the absence and presence
of 0.02% SDS. Upper arrow points to the multipotent PPO that can be
stained with either laccase or tyrosinase substrates. Lower arrow
points to the SDS-activated tyrosinase.
|
|
ppoA sequencing and analysis.
The chromosomal
region flanking the mini-Tn10 insertion in M. mediterranea Tn101 was cloned by a marker rescue
experiment. Chromosomal DNA from this strain was digested with the
restriction enzyme SphI and was ligated to pUC19. The
transformants in E. coli DH5
were selected for gentamycin
and ampicillin resistance. A plasmid (pLB1) was obtained with an insert
containing the mini-Tn10 transposon and two flanking regions
of M. mediterranea chromosomal DNA of approximately 8.1 and
3.8 kb (Fig. 2). The two SacI
restriction sites close to both IS10 sequences of the
transposon were used for subcloning the flanking regions to the
insertion point. SacI/XhoI digestions of pLB1
were ligated to the corresponding site of plasmid pBluescript KS II
obtaining plasmids pK
and pK
comprising, respectively, the
sequences downstream and upstream of the transposon insertion site.
Finally, a SacI/KpnI fragment of plasmid pK
was subcloned into pUC19, generating the plasmid pKK (Fig. 2). The
sequencing of the plasmids pK
and pKK indicated that the transposon
was inserted in an open reading frame 1 (ORF1), designated
ppoA for PPO, of 2,091 bp (GenBank accession no. AF184209).
The accuracy of the sequence was checked by PCR amplification from
wild-type M. mediterranea and sequencing this
ppoA. The analysis of this sequence revealed that the
transposon had inserted in the chromosome, generating a 9-bp direct
duplication that is a characteristic feature of Tn10
(7).

View larger version (10K):
[in this window]
[in a new window]
|
FIG. 2.
Genetic map of the chromosomal region around
ppoA cloned in plasmid LB1, by marker rescue. The site of
Tn10 insertion is marked by a triangle. Relevant restriction
sites are marked. The fragments subcloned in different plasmids are
indicated at the bottom. Bar = 1 kb.
|
|
ORF1 starts with two codons, TTG and ATG, that might encode the initial
methionine. However, no putative ribosome binding
site could be
detected upstream of them. Thus, the methionine
situated at position 22 in this ORF1 seems to be the most likely
candidate for the
transductional start of
ppoA, as it is preceded
by a region
resembling the promoter consensus, as well as by a
putative
Shine-Dalgarno sequence. In consequence, a protein of
675 amino acids
showing a signal peptide seems to be codified
by the
ppoA
gene. Another feature of this gene is that 21 nucleotides
downstream of
the TAA stop codon, a palindromic sequence was found
(AAAAGCGAGCCAAAGGCTCGCTTTT) that is a putative intrinsic
transcription
terminal
signal.
ppoA is preceded by a small ORF2 of 309 bp, not showing
homology to any other gene. The sequencing of the approximately 400
bp
upstream of the ORF2 to complete the insert in pKK revealed
what seemed
to be the 3' end of another
gene.
Preliminary experiments studying regulation reveal that the
ppoA gene seems to be transcriptionally regulated and that
the
proposed promoter is controlling its expression. Northern analysis
with
32P-labeled
ppoA probe reveals a
significant increase in the mRNA
content of
M. mediterranea
cultures reaching the early stationary
phase. However, the increase in
mRNA is not comparable to the
large increase in the enzymatic activity
observed at that stage
(
18).
The sequence deduced for PpoA shows all four characteristic
copper-binding sites of blue copper proteins. Table
4 shows an
alignment among the different
prokaryotic blue copper proteins
and the deduced sequence from the
cloned ORF1, illustrating that
the four copper-binding sites are very
well conserved. Moreover,
ORF1 has other additional histidine clusters
(29HQTDHASH and 167HHNH)
that might also be involved in additional
copper binding and might
be related to the multifunctional activity of
this enzyme, sharing
laccase and tyrosinase capabilities
(
34).
View this table:
[in this window]
[in a new window]
|
TABLE 4.
Alignment of the four characteristic copper-binding
sites (A, B, C, and D) in some prokaryotic blue multicopper
proteins and a fungal laccase included for comparison
|
|
Regarding the
ppoA gene in mutant strains, the site of the
Tn
10 insertion in the mutant Tn101 was located
relatively close
to the 3' extreme of the gene, truncating the ORF1 at
529M. Furthermore,
the
ppoA gene from mutant strain ngd67
was also amplified and
sequenced, revealing a nonsense mutation in
which the codon 328
(TGG) coding for W changed to stop codon TGA. In
both cases, copper-binding
motifs C and D are suppressed, supporting
the complete lost of
enzymatic activity. On the other hand, no mutation
was detected
in the
ppoA gene of the amelanotic mutant
ng56.
 |
DISCUSSION |
Based on kinetic data and cellular localization studies, we had
proposed that M. mediterranea is a melanogenic bacterium
containing two different PPOs (36): an unusual multipotent
PPO able to oxidize substrates characteristics of both tyrosinase and
laccase (18, 34) and an SDS-activated tyrosinase. To explore
their respective cellular functions and the structures of these
enzymes, we needed to develop methods for detecting mutants affected
differentially in both PPOs.
The detection of the SDS-activated tyrosinase can be easily done by
checking the melanization of the colony (36). Using that
method, we have already detected ng56 and some other amelanotic mutants
lacking that activity but still expressing the multifunctional PPO. We
now present a rapid test for this activity in agar plates containing
DMP. According to this test, the wild-type and the mutant ng56 strains
showed no differences, indicating that tyrosinase is not involved in
the DMP oxidation. However, the test has proven to be an effective
method for the detection of the laccase-lacking mutants, such as ngd67
and others, that had lost multipotent PPO activity but which were still
able to synthesize melanins.
A systematic transposon mutagenesis of M. mediterranea with
the mini-Tn10 transposons encoding gentamycin resistance
allowed us to clone the multipotent PPO gene. This technique has
already been used in the study of other marine bacteria (1,
39). Southern blot analysis of genomic DNA revealed that the
transposition was a single event on the bacterial chromosome. However,
the randomness of the insertion is uncertain, since after screening
thousands of mutant strains, only one (Tn101) affected in the
multifunctional PPO was found, and no amelanotic mutants phenotypically
similar to ng56 and presumably affected in the SDS-activated tyrosinase gene have been so far detected. Further rounds of mutagenesis are
underway to assess this point.
M. mediterranea Tn101 was obtained by using pBSL182.
Marker rescue experiments allowed the cloning and characterization of the gene in which the gentamycin resistance marker was inserted. These
data support the existence of two different PPOs encoded at different
loci. The strains Tn101 and ngd67 are specifically affected in the
multipotent membrane-bound PPO as shown by direct enzymatic activity
measurements (Table 3) and polyacrylamide gel electrophoresis staining
(Fig. 1). The site of the transposon insertion easily accounts for this
phenotype, as two characteristic copper centers of laccases (Table 4,
columns C and D) are lost either by transposon insertion (Tn101)
or by a premature stop codon (ngd67). In contrast, their cellular
extracts maintained the SDS-activated oxidation of tyrosine and dopa.
These strains are pigmented, indicating that the SDS-activated
tyrosinase is the only PPO activity required for pigmentation. This
point is important, since laccase activity has been involved in the
melanization of A. lipoferum (17) and in the
formation of fungal dihydroxynaphthalene-melanins (15). In
contrast, our data support most of the bacterial strains so far
studied, where L-tyrosine is the most common substrate for
melanization and tyrosinase has been linked to this process (27,
32).
The protein sequence of PpoA revealed a signal peptide that it is very
likely involved in its transport to the membrane (30). The
mature protein remains bound to the membrane rather than released to
the periplasmic space, and it is released by lipase treatment of
membrane preparations (18), supporting the existence of a covalent link. Although the position for the hydrolysis site of the
signal peptide will remain uncertain until direct sequencing of the N
terminus of the purified mature protein, cleavage after 25A would
permit the preservation of 26C in the N terminus, which would also
allow for the anchoring of the protein to the membrane through a
thioester bond, as a prokaryotic membrane lipid attachment protein
(prosite PDOC00013 [20]).
The ppoA gene from M. mediterranea shows the four
characteristic copper centers for laccases and other blue-copper
proteins, but the similarity scores of ppoA from M. mediterranea with fungal laccases are quite low (around 40)
(38). This fact accounts for the negative results obtained
in all of our previous attempts to clone the multipotent laccase-like
PPO gene by using genes from related PPO, such as prokaryotic
tyrosinases or fungal laccases, to probe genomic digested DNA
(10). In turn, PpoA differs from typical laccases in that it
has cresolase activity, oxidizing L-tyrosine and other
related monophenols that are specific substrates of tyrosinase. Further
studies will be necessary in order to clarify the relationship between
the presence of additional copper-binding domains and the range of
substrates for this PPO. The histidine-containing motifs (HQTDHASH)
occurring in the amino termini of ppoA or the HHNH cluster
sited between amino acids 167 and 170 could be involved in its unique
multifunctional catalytic properties. Directed mutagenesis studies are
planned in the near future to correlate the presence of those binding
copper sites with the enzymatic activities.
The prokaryotic blue-multicopper proteins constitute a group
of proteins with different functions whose putative PPO
activities have not been profoundly studied. Streptomyces
phenoxazinone synthase is involved in antibiotic synthesis
(22), CotA is expressed during the sporulation of
Bacillus (14), the proteins from
Pseudomonas syringae and Xanthomonas campestris
are involved in copper resistance (24, 26), and there are
other hypothetical proteins proposed from the systematic genomic
sequencing of strains such as E. coli (8) and
Aquifex aoelicus (11) without known function.
Other, still uncloned, laccases have been found to be involved in other functions, as is the laccase from A. lipoferum, which is
under the same control as the synthesis of components of the
respiratory chain (2). At this point, the
physiological role of the PpoA protein from M. mediterranea is unclear. The comparison of PpoA with other
bacterial blue-multicopper proteins using the BLAST 2 Sequences
(38) shows that the alignment score is significant, but low
(Table 5). It is tempting to speculate
that PpoA may be involved in some kind of response to stress
conditions, since its expression is induced during the stationary phase
of growth (18). This work has shown that M. mediterranea is amenable to genetic manipulation. The
characterization of the mutant strain Tn101 in comparison with the
wild type is in progress, but it has not yet revealed any phenotypic
alteration except the loss of the multipotent PPO activity. Hopefully,
the combination of different approaches will help to clarify the
physiological role of this unique PPO, as well as its possible
relationship with the SDS-activated tyrosinase responsible for melanin
pigmentation.
 |
ACKNOWLEDGMENTS |
This work was supported by grant PB97-1060 from the CICYT, Spain.
P. Lucas-Elío and E. Fernández were recipients of
predoctoral fellowships from, respectively, Séneca Foundation
(Comunidad Autónoma de Murcia) and Ministerio de Educación
y Ciencia, Spain.
We are grateful to R. Santamaría, J. Olivares, M. Alexeyev, V. de Lorenzo, S. Kjelleberg, and T. D. Connell for providing bacterial strains and plasmids and to J. C. García-Borrón for helpful suggestions. We also thank the
DNA sequencing service of CIB, Madrid, Spain, for their excellent and
rapid work.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Genetics and Microbiology, Faculty of Biology, University of Murcia, Murcia 30100, Spain. Phone: 34 968 364955. Fax: 34 968 363963. E-mail:
antonio{at}fcu.um.es.
 |
REFERENCES |
| 1.
|
Albertson, N. A.,
S. Stretton,
S. Pongpattanakitshote,
J. Östling,
K. C. Marshall,
A. E. Goodman, and S. Kjelleberg.
1996.
Construction and use of a new vector/transposon, pLBT::mini-Tn10:lac:kan, to identify environmentally responsive genes in a marine bacterium.
FEMS Microbiol. Lett.
140:287-294[CrossRef][Medline].
|
| 2.
|
Alexandre, G.,
R. Bally,
B. L. Taylor, and I. B. Zhulin.
1999.
Loss of cytochrome c oxidase activity and acquisition of resistance to quinone analogs in a laccase-positive variant of Azospirillum lipoferum.
J. Bacteriol.
181:6730-6738[Abstract/Free Full Text].
|
| 3.
|
Alexeyev, M. F., and I. N. Shokolenko.
1995.
Mini-Tn10 transposon derivatives for insertion mutagenesis and gene delivery into the chromosome of Gram-negative bacteria.
Gene
160:59-62[CrossRef][Medline].
|
| 4.
|
Alexeyev, M. F.,
I. N. Shokolenko, and T. P. Croughan.
1995.
New mini-Tn5 derivatives for insertion mutagenesis and genetic engineering in Gram-negative bacteria.
Can. J. Microbiol.
41:1053-1055[Medline].
|
| 5.
|
Bagdasarian, M.,
R. Lurz,
B. Rückert,
F. C. H. Franklin,
M. M. Bagdasarian,
J. Frey, and K. N. Timmis.
1981.
Specific purpose plasmid cloning vectors. II. Broad host range, high copy number, RSF1010-derived vectors, and a host-vector system for gene cloning in Pseudomonas.
Gene
16:237-247[CrossRef][Medline].
|
| 6.
|
Belas, R.,
A. Mileham,
M. Simon, and M. Silverman.
1984.
Transposon mutagenesis of marine Vibrio sp.
J. Bacteriol.
158:890-896[Abstract/Free Full Text].
|
| 7.
|
Berg, C. M.,
D. E. Berg, and E. A. Groisman.
1989.
Transposable elements and the genetic engineering of bacteria, p. 879-925.
In
D. E. Berg, and M. M. Howe (ed.), Mobile DNA. American Society for Microbiology, Washington, D.C.
|
| 8.
|
Blattner, F. R.,
G. Plunkett III,
C. A. Bloch,
N. T. Perna,
V. Burland,
M. Riley,
J. Collado-Vides,
J. D. Glasner,
C. K. Rode,
G. F. Mayhew,
J. Gregor,
N. W. Davis,
H. A. Kirkpatrick,
M. A. Goeden,
D. J. Rose,
B. Mau, and Y. Shao.
1997.
The complete genome sequence of Escherichia coli K-12.
Science
277:1453-1474[Abstract/Free Full Text].
|
| 9.
|
Coll, P. M.,
C. Tabernero,
R. Santamaría, and P. Pérez.
1993.
Characterization and structural analysis of the laccase I gene from the newly isolated lignolytic basidiomycete PM1 (CECT 2971).
Appl. Environ. Microbiol.
59:4129-4135[Abstract/Free Full Text].
|
| 10.
|
Connell, T. D.,
A. J. Matone, and R. K. Holmes.
1995.
A new mobilizable cosmid vector for use in Vibrio cholerae and other Gram bacteria.
Gene
153:85-87[CrossRef][Medline].
|
| 11.
|
Deckert, G.,
P. V. Warren,
T. Gaasterland,
W. G. Young,
A. L. Lenox,
D. E. Graham,
R. Overbeek,
M. A. Snead,
M. Keller,
M. Aujay,
R. Huber,
R. A. Feldman,
J. M. Short,
G. J. Olson, and R. V. Swanson.
1998.
The complete genome of the hyperthermophilic bacterium Aquifex aeolicus.
Nature
392:353-358[CrossRef][Medline].
|
| 12.
|
de Lorenzo, V.,
M. Herrero,
U. Jakubzik, and K. N. Timmis.
1990.
Mini-Tn5 transposon derivatives for insertion mutagenesis, promoter probing, and chromosomal insertion of cloned DNA in Gram-negative eubacteria.
J. Bacteriol.
172:6568-6572[Abstract/Free Full Text].
|
| 13.
|
de Lorenzo, V. M., and K. N. Timmis.
1994.
Analysis and construction of stable phenotypes in Gram-negative bacteria with Tn-5 and Tn-10-derived mini-transposons.
Methods Enzymol.
235:386-405[Medline].
|
| 14.
|
Donovan, W.,
L. B. Zheng,
K. Sandman, and R. Losick.
1987.
Genes encoding spore coat polypeptides from Bacillus subtilis.
J. Mol. Biol.
196:1-10[CrossRef][Medline].
|
| 15.
|
Edens, W. E.,
T. G. Goings,
D. Dooley, and J. M. Henson.
1999.
Purification and characterization of a secreted laccase of Gaeumannomyces graminis var. tritici.
Appl. Environ. Microbiol.
65:3071-3074[Abstract/Free Full Text].
|
| 16.
|
Eggert, C.,
U. Temp, and K. E. L. Eriksson.
1996.
The ligninolytic system of the white rot fungus Pycnoporus cinnabarinus: purification and characterization of the laccase.
Appl. Environ. Microbiol.
62:1151-1158[Abstract].
|
| 17.
|
Faure, D.,
M. L. Bouillant, and R. Bally.
1994.
Isolation of Azospirillum lipoferum 4T Tn5 mutants affected in melanization and laccase activity.
Appl. Environ. Microbiol.
60:3413-3415[Abstract/Free Full Text].
|
| 18.
|
Fernández, E.,
A. Sanchez-Amat, and F. Solano.
1999.
Location and catalytic characteristics of a multipotent bacterial polyphenol oxidase.
Pigm. Cell Res.
12:331-339[CrossRef][Medline].
|
| 19.
|
Givaudan, A.,
A. Effosse,
D. Faure,
P. Potier,
M. L. Bouillant, and R. Bally.
1993.
Polyphenol oxidase from Azospirillum lipoferum isolated from rice rhizosphere: evidence for laccase activity in non-motile strains of Azospirillum lipoferum.
FEMS Microbiol. Lett.
108:205-210[CrossRef].
|
| 20.
|
Hayashi, S., and H. C. Wu.
1990.
Lipoproteins in bacteria.
J. Bioenerg. Biomembr.
22:451-471[CrossRef][Medline].
|
| 21.
|
Herrero, M.,
V. de Lorenzo, and K. N. Timmis.
1990.
Transposon vectors containing non-antibiotic resistance selection markers for cloning and stable chromosomal insertion of foreign genes in Gram-negative bacteria.
J. Bacteriol.
172:6557-6567[Abstract/Free Full Text].
|
| 22.
|
Hsieh, C. J., and G. H. Jones.
1995.
Nucleotide sequence, transcriptional analysis, and glucose regulation of the phenoxazinone synthase gene (phsA) from Streptomyces antibioticus.
J. Bacteriol.
177:5740-5747[Abstract/Free Full Text].
|
| 23.
|
Huber, M., and K. Lerch.
1987.
The influence of copper on the induction of tyrosinase and laccase in Neurospora crassa.
FEBS Lett.
219:335-338[CrossRef][Medline].
|
| 24.
|
Lee, Y. A.,
M. Hendson,
N. J. Panopoulos, and M. N. Schroth.
1994.
Molecular cloning, chromosomal mapping, and sequence analysis of copper resistance genes from Xanthomonas campestris pv. juglandis: homology with small blue copper proteins and multicopper oxidase.
J. Bacteriol.
176:173-188[Abstract/Free Full Text].
|
| 25.
|
Mansur, M.,
T. Suárez,
J. B. Fernández-Larrea,
M. A. Brizuela, and A. E. González.
1997.
Identification of a laccase gene family in the new lignin-degrading basiodiomycete CECT 210197.
Appl. Environ. Microbiol.
63:2637-2646[Abstract].
|
| 26.
|
Mellano, M. A., and D. A. Cooksey.
1988.
Nucleotide sequence and organization of copper resistance genes from Pseudomonas syringae pv. tomato.
J. Bacteriol.
170:2879-2883[Abstract/Free Full Text].
|
| 27.
|
Mercado-Blanco, J.,
F. Garcia,
M. Fernandez-Lopez, and J. Olivares.
1993.
Melanin production by Rhizobium meliloti GR4 is linked to nonsymbiotic plasmid pRmeGR4b: cloning, sequencing and expression of the tyrosinase gene mepA.
J. Bacteriol.
175:5403-5410[Abstract/Free Full Text].
|
| 28.
|
Messerschmidt, A., and R. Huber.
1990.
The blue oxidases, ascorbate oxidase, laccase and ceruloplasmin. Modelling and structural relationships.
Eur. J. Biochem.
187:341-352[Medline].
|
| 29.
|
Moore, B. M., and W. H. Flurkey.
1990.
Sodium dodecyl sulfate activation of a plant polyphenoloxidase.
J. Biol. Chem.
265:4982-4988[Abstract/Free Full Text].
|
| 30.
|
Nielsen, H.,
J. Engelbrecht,
S. Brunak, and G. von Heijne.
1997.
Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites.
Protein Eng.
10:1-6[Abstract/Free Full Text].
|
| 31.
|
Pomerantz, S. H.
1966.
The tyrosine hydroxylase activity of mammalian tyrosinase.
J. Biol. Chem.
241:161-168[Abstract/Free Full Text].
|
| 32.
|
Pomerantz, S. H., and V. V. Murthy.
1974.
Purification and properties of tyrosinases from Vibrio tyrosinaticus.
Arch. Biochem. Biophys.
160:73-82[CrossRef][Medline].
|
| 33.
|
Sambrook, J.,
E. J. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 34.
|
Sanchez-Amat, A., and F. Solano.
1997.
A pluripotent polyphenol oxidase from the melanogenic marine Alteromonas sp. shares catalytic capabilities of tyrosinases and laccases.
Biochem. Biophys. Res. Commun.
240:787-792[CrossRef][Medline].
|
| 35.
|
Simon, R.,
J. Quandt, and W. Klipp.
1989.
New derivatives of transposon Tn5 suitable for mobilization of replicons, generation of operon fusions and induction of genes in Gram-negative bacteria.
Gene
80:161-169[CrossRef][Medline].
|
| 36.
|
Solano, F.,
E. García,
E. Pérez de Egea, and A. Sanchez-Amat.
1997.
Isolation and characterization of strain MMB-1 a novel melanogenic marine bacterium.
Appl. Environ. Microbiol.
63:3499-3506[Abstract].
|
| 37.
|
Solano, F., and A. Sanchez-Amat.
1999.
Studies on the phylogenetic relationships of melanogenic marine bacteria. Proposal of Marinomonas mediterranea sp. nov.
Int. J. Syst. Bacteriol.
49:1241-1246[Abstract/Free Full Text].
|
| 38.
|
Tatusova, T. A., and T. L. Madden.
1999.
BLAST 2 Sequences, a new tool for comparing protein and nucleotide sequences.
FEMS Microbiol. Lett.
174:247-250[CrossRef][Medline].
|
| 39.
|
Techkarnjanaruk, S.,
S. Pongpattanakitshote, and A. E. Goodman.
1997.
Use of a promoterless lacZ gene insertion to investigate chitinase gene expression in the marine bacterium (Pseudoalteromonas sp. strain S).
Appl. Environ. Microbiol.
63:2989-2999[Abstract].
|
| 40.
|
Thurston, C. F.
1994.
The structure and function of fungal laccases.
Microbiology
140:19-26.
|
| 41.
|
Wittenberg, C., and E. L. Triplett.
1985.
A detergent-activated tyrosinase from Xenopus laevis. I. Purification and partial characterization.
J. Biol. Chem.
260:12535-12541[Abstract/Free Full Text].
|
| 42.
|
Yoshida, H.
1883.
Chemistry of lacquer (Urushi) part I.
J. Chem. Soc.
43:231-237.
|
Journal of Bacteriology, July 2000, p. 3754-3760, Vol. 182, No. 13
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Lopez-Serrano, D., Solano, F., Sanchez-Amat, A.
(2007). Involvement of a novel copper chaperone in tyrosinase activity and melanin synthesis in Marinomonas mediterranea. Microbiology
153: 2241-2249
[Abstract]
[Full Text]
-
Sanchez-Sutil, M. C., Gomez-Santos, N., Moraleda-Munoz, A., Martins, L. O., Perez, J., Munoz-Dorado, J.
(2007). Differential Expression of the Three Multicopper Oxidases from Myxococcus xanthus. J. Bacteriol.
189: 4887-4898
[Abstract]
[Full Text]
-
Lucas-Elio, P., Gomez, D., Solano, F., Sanchez-Amat, A.
(2006). The Antimicrobial Activity of Marinocine, Synthesized by Marinomonas mediterranea, Is Due to Hydrogen Peroxide Generated by Its Lysine Oxidase Activity.. J. Bacteriol.
188: 2493-2501
[Abstract]
[Full Text]
-
Hernandez-Romero, D., Solano, F., Sanchez-Amat, A.
(2005). Polyphenol Oxidase Activity Expression in Ralstonia solanacearum. Appl. Environ. Microbiol.
71: 6808-6815
[Abstract]
[Full Text]
-
Hernandez-Romero, D., Lucas-Elio, P., Lopez-Serrano, D., Solano, F., Sanchez-Amat, A.
(2003). Marinomonas mediterranea is a lysogenic bacterium that synthesizes R-bodies. Microbiology
149: 2679-2686
[Abstract]
[Full Text]
-
Endo, K., Hayashi, Y., Hibi, T., Hosono, K., Beppu, T., Ueda, K.
(2003). Enzymological Characterization of EpoA, a Laccase-Like Phenol Oxidase Produced by Streptomyces griseus. J Biochem
133: 671-677
[Abstract]
[Full Text]
-
Lucas-Elio, P., Solano, F., Sanchez-Amat, A.
(2002). Regulation of polyphenol oxidase activities and melanin synthesis in Marinomonas mediterranea: identification of ppoS, a gene encoding a sensor histidine kinase. Microbiology
148: 2457-2466
[Abstract]
[Full Text]
-
Endo, K., Hosono, K., Beppu, T., Ueda, K.
(2002). A novel extracytoplasmic phenol oxidase of Streptomyces: its possible involvement in the onset of morphogenesis. Microbiology
148: 1767-1776
[Abstract]
[Full Text]
-
Kim, C., Lorenz, W. W., Hoopes, J. T., Dean, J. F. D.
(2001). Oxidation of Phenolate Siderophores by the Multicopper Oxidase Encoded by the Escherichia coli yacK Gene. J. Bacteriol.
183: 4866-4875
[Abstract]
[Full Text]